ID: 1030937095

View in Genome Browser
Species Human (GRCh38)
Location 7:115598104-115598126
Sequence GATTCTTCCTACCATGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030937095_1030937096 -7 Left 1030937095 7:115598104-115598126 CCACACTCATGGTAGGAAGAATC No data
Right 1030937096 7:115598120-115598142 AAGAATCAGTATCGTGAAAATGG 0: 259
1: 7353
2: 8733
3: 4634
4: 2792

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030937095 Original CRISPR GATTCTTCCTACCATGAGTG TGG (reversed) Intergenic
No off target data available for this crispr