ID: 1030938066

View in Genome Browser
Species Human (GRCh38)
Location 7:115611349-115611371
Sequence TTGGATAGTCAAATCAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030938060_1030938066 4 Left 1030938060 7:115611322-115611344 CCTCCCGTTTTATGATGCTTCCA No data
Right 1030938066 7:115611349-115611371 TTGGATAGTCAAATCAGACAAGG No data
1030938061_1030938066 1 Left 1030938061 7:115611325-115611347 CCCGTTTTATGATGCTTCCATTC No data
Right 1030938066 7:115611349-115611371 TTGGATAGTCAAATCAGACAAGG No data
1030938062_1030938066 0 Left 1030938062 7:115611326-115611348 CCGTTTTATGATGCTTCCATTCC No data
Right 1030938066 7:115611349-115611371 TTGGATAGTCAAATCAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030938066 Original CRISPR TTGGATAGTCAAATCAGACA AGG Intergenic
No off target data available for this crispr