ID: 1030941602

View in Genome Browser
Species Human (GRCh38)
Location 7:115657715-115657737
Sequence GGAGAGACTGACATTCAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030941602_1030941603 -8 Left 1030941602 7:115657715-115657737 CCTATTTGAATGTCAGTCTCTCC No data
Right 1030941603 7:115657730-115657752 GTCTCTCCATGTACATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030941602 Original CRISPR GGAGAGACTGACATTCAAAT AGG (reversed) Intergenic
No off target data available for this crispr