ID: 1030941603

View in Genome Browser
Species Human (GRCh38)
Location 7:115657730-115657752
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030941601_1030941603 24 Left 1030941601 7:115657683-115657705 CCTGGCACATTTGAATCGGTGAA No data
Right 1030941603 7:115657730-115657752 GTCTCTCCATGTACATAAAATGG No data
1030941602_1030941603 -8 Left 1030941602 7:115657715-115657737 CCTATTTGAATGTCAGTCTCTCC No data
Right 1030941603 7:115657730-115657752 GTCTCTCCATGTACATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030941603 Original CRISPR GTCTCTCCATGTACATAAAA TGG Intergenic