ID: 1030941603 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:115657730-115657752 |
Sequence | GTCTCTCCATGTACATAAAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1030941601_1030941603 | 24 | Left | 1030941601 | 7:115657683-115657705 | CCTGGCACATTTGAATCGGTGAA | No data | ||
Right | 1030941603 | 7:115657730-115657752 | GTCTCTCCATGTACATAAAATGG | No data | ||||
1030941602_1030941603 | -8 | Left | 1030941602 | 7:115657715-115657737 | CCTATTTGAATGTCAGTCTCTCC | No data | ||
Right | 1030941603 | 7:115657730-115657752 | GTCTCTCCATGTACATAAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1030941603 | Original CRISPR | GTCTCTCCATGTACATAAAA TGG | Intergenic | ||