ID: 1030963183

View in Genome Browser
Species Human (GRCh38)
Location 7:115952986-115953008
Sequence GGAGGATGGACCCAGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1057
Summary {0: 1, 1: 1, 2: 13, 3: 97, 4: 945}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030963183_1030963190 11 Left 1030963183 7:115952986-115953008 CCACCTCCCTGGGTCCATCCTCC 0: 1
1: 1
2: 13
3: 97
4: 945
Right 1030963190 7:115953020-115953042 CATGACACCGATGTGCTCACTGG No data
1030963183_1030963193 14 Left 1030963183 7:115952986-115953008 CCACCTCCCTGGGTCCATCCTCC 0: 1
1: 1
2: 13
3: 97
4: 945
Right 1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 66
1030963183_1030963191 12 Left 1030963183 7:115952986-115953008 CCACCTCCCTGGGTCCATCCTCC 0: 1
1: 1
2: 13
3: 97
4: 945
Right 1030963191 7:115953021-115953043 ATGACACCGATGTGCTCACTGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1030963183_1030963192 13 Left 1030963183 7:115952986-115953008 CCACCTCCCTGGGTCCATCCTCC 0: 1
1: 1
2: 13
3: 97
4: 945
Right 1030963192 7:115953022-115953044 TGACACCGATGTGCTCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030963183 Original CRISPR GGAGGATGGACCCAGGGAGG TGG (reversed) Intronic
900158816 1:1213887-1213909 GGAGGCTGGTCCTGGGGAGGGGG - Intronic
900367532 1:2317378-2317400 GTAGGAGGGGCACAGGGAGGTGG + Intergenic
900391505 1:2435960-2435982 GGAGGAGGGAAGAAGGGAGGAGG - Intronic
900391620 1:2436306-2436328 GGAGGAGGGAGGAAGGGAGGAGG - Intronic
900391640 1:2436359-2436381 GGAGGAGGGAGGAAGGGAGGAGG - Intronic
900421316 1:2557138-2557160 GGGGGCTGGACCCAGGTGGGTGG + Intronic
900582267 1:3415096-3415118 GGAGCCAGGCCCCAGGGAGGTGG + Intronic
900584233 1:3424776-3424798 GGAGGAAGGTCACAGGGAGCTGG + Intronic
900679389 1:3908033-3908055 GAAGGATGGAGCCAGGCAGGGGG - Intergenic
900979952 1:6040671-6040693 GCAGGACTGACCCTGGGAGGGGG - Intronic
901236346 1:7669598-7669620 GCAGGCTGGAGCCTGGGAGGTGG - Intronic
901256767 1:7835606-7835628 GGAGGCTGTCCACAGGGAGGAGG + Intronic
901642870 1:10701904-10701926 GGGGGATGGGCCGGGGGAGGTGG - Intronic
902210230 1:14899688-14899710 GGAGGAGGGAGCTAGGGAGGTGG - Intronic
902410131 1:16207492-16207514 GGAGGGGGGTCCCTGGGAGGAGG - Intronic
902583808 1:17425952-17425974 AGAGGTGGGACCCAGAGAGGGGG - Intronic
902787949 1:18745264-18745286 GGAGGATGGTGCCTGAGAGGAGG + Intronic
902804073 1:18850053-18850075 GTAGGAAGGACCCAGGGATCAGG - Intronic
902832984 1:19029653-19029675 GCAGGATGGAGCAAGGCAGGCGG - Intergenic
902945057 1:19829835-19829857 GTAGCTTGAACCCAGGGAGGCGG - Intergenic
903367592 1:22814719-22814741 TGAGGTAGGGCCCAGGGAGGCGG + Intronic
903489726 1:23719214-23719236 GGAGGAGGGACCCAGGGAAGAGG - Intergenic
903793948 1:25914159-25914181 GGAGGATGGAACCAGGGAAAGGG - Intergenic
903967576 1:27100120-27100142 GGAGGATGCTTCCCGGGAGGCGG + Exonic
904072178 1:27809545-27809567 GGAGAATTGAATCAGGGAGGCGG - Intronic
904273823 1:29367491-29367513 GGAGGATGGACCCAGTGACAAGG + Intergenic
904322752 1:29707641-29707663 GAAGGAGGGACACAGAGAGGGGG + Intergenic
904364149 1:29999812-29999834 GGAGGATGGACCCAGGAATGAGG + Intergenic
904490130 1:30853521-30853543 GGAGGATGGATTTGGGGAGGAGG - Intergenic
904497605 1:30895861-30895883 GGAGGAGGGAGGGAGGGAGGGGG + Intronic
904890595 1:33776670-33776692 GGAGGATTGACTGAGTGAGGGGG + Intronic
905271008 1:36787450-36787472 GGAGGCTGGAGCCAGGGAAACGG - Intergenic
905357809 1:37396837-37396859 GCAGGAAGGAGCCAGGCAGGAGG - Intergenic
905449646 1:38047898-38047920 GAAGGATGGGCTCAGGGAAGGGG + Intergenic
905484725 1:38287201-38287223 GGAGGATGGACCCAGGGAAGAGG - Intergenic
905503415 1:38457010-38457032 GGAGGTTGGACCCAGAAATGAGG - Intergenic
905734785 1:40317407-40317429 GGAGGCTGGACCGAGCGGGGCGG - Intronic
905748270 1:40437899-40437921 GGAGGATTGTTCCAGAGAGGAGG + Intergenic
906265277 1:44424303-44424325 GGAGGATGGGGACAGGGATGGGG + Intronic
906447164 1:45911989-45912011 GGAGGATAGACCCAAGGTTGGGG + Intronic
906788180 1:48634539-48634561 GTAGGATGGACCCATGGAGAGGG + Exonic
906908779 1:49924288-49924310 GGAGGATGGAGAGTGGGAGGAGG + Intronic
906952320 1:50344994-50345016 GGAGGAGGGACCTGGGGAGTAGG + Intergenic
907141356 1:52188324-52188346 GGAGGGTGGAGGCTGGGAGGAGG + Intronic
907909437 1:58814066-58814088 GCAGGATGGACCCAGAGGGCTGG + Intergenic
908353171 1:63306298-63306320 GGAGTAGGGACACAGGGAAGAGG + Intergenic
908528418 1:65010325-65010347 GGAGGATGGATGGAGGAAGGGGG - Intergenic
909297042 1:73963826-73963848 GGAGGATGGAAGGTGGGAGGAGG - Intergenic
909962350 1:81861794-81861816 GGAGAATTGAACCTGGGAGGTGG + Intronic
910721467 1:90291204-90291226 GGGTGATGGACCCATGGTGGTGG - Intergenic
911482739 1:98464683-98464705 GGAGGCTGGAGGCAGGGAGATGG + Intergenic
911794525 1:102059041-102059063 GGAGGATGTACCCTGCGAGGAGG - Intergenic
912530134 1:110314556-110314578 GGAGGATGGGCTGGGGGAGGTGG + Intergenic
912594634 1:110861929-110861951 GGAGGGTGGAGTCTGGGAGGAGG - Intergenic
912904500 1:113689613-113689635 GGAGAAGGGATGCAGGGAGGGGG + Intergenic
912968103 1:114254467-114254489 GGAGTATGAAAACAGGGAGGGGG + Intergenic
913320977 1:117588221-117588243 GGTGGATGGAATCAAGGAGGTGG - Intergenic
913373787 1:118129633-118129655 GGAGGATGGGCAGGGGGAGGAGG - Intronic
913380073 1:118201129-118201151 GGAGGAAGGAGACGGGGAGGAGG - Intergenic
913494811 1:119418736-119418758 GAAGGATGGAGTCTGGGAGGTGG - Intronic
915117138 1:153608248-153608270 GGAGGAGGGACCCAGGGCCTAGG - Intronic
915300031 1:154946551-154946573 GGAGCAAGGCCCCAGGGAGCAGG - Exonic
915564953 1:156707979-156708001 GGAGGCTGGAGCCAGGCAGTGGG + Intergenic
915589544 1:156862770-156862792 GCTGTAGGGACCCAGGGAGGGGG - Intronic
915932390 1:160068602-160068624 GGAGGAAGAAACGAGGGAGGAGG - Intronic
916742444 1:167658182-167658204 GGAGGCTGGACACAGGGAGGGGG - Intronic
917349501 1:174062448-174062470 GGAGGCCTGACCCTGGGAGGTGG - Intergenic
917811244 1:178660308-178660330 TGAGAATGGACCCAGCCAGGAGG + Intergenic
917952564 1:180055635-180055657 GGAGAATGGCGCCTGGGAGGCGG - Intronic
918107707 1:181427779-181427801 GGAGGAGGGAGGGAGGGAGGGGG - Intronic
918483013 1:184999982-185000004 GGAGGGTGGAGTCTGGGAGGAGG - Intergenic
919814904 1:201431177-201431199 GGAGGAAGCAGCCAGGGAGGTGG - Intergenic
919928082 1:202202986-202203008 GGCAGATGGACTCATGGAGGGGG + Intronic
920293924 1:204944331-204944353 GCTGCATGGACCCAGGGCGGCGG - Exonic
920443853 1:206000983-206001005 GGGGAAAGGAACCAGGGAGGGGG - Intronic
921117007 1:212101363-212101385 GGAGTATGGACCCTGACAGGAGG - Intronic
921556555 1:216604981-216605003 GGTGGATGGAAGGAGGGAGGGGG + Intronic
922079699 1:222283826-222283848 GGAGGATGGAGCTGGAGAGGGGG + Intergenic
922334014 1:224604581-224604603 GGAGGCTGGAGCCAGGGATGGGG + Intronic
922799551 1:228358950-228358972 GGGAGATGGAGCCAGGCAGGAGG + Intronic
922799836 1:228360149-228360171 GGAGGAGGGCACCATGGAGGAGG + Intronic
923392698 1:233529878-233529900 GGAGGATGAACCCAGGGAAGAGG - Intergenic
1062938083 10:1402685-1402707 GAGGGGTGGCCCCAGGGAGGAGG - Intronic
1063366035 10:5491525-5491547 GGCAGTTGGACCCAGGGAGGGGG - Intergenic
1063570427 10:7210415-7210437 GCAGGAGGGACCCAGGGCGAGGG + Intronic
1064377979 10:14814397-14814419 GGAGGATGGAGGCTGGGAGGAGG + Intergenic
1065019963 10:21495749-21495771 GGCGGATGGAGCCAGGGCTGCGG + Exonic
1065497398 10:26343320-26343342 GGAGGATGGAGGGAGGGACGAGG + Intergenic
1066370390 10:34814774-34814796 GGAGGAGAGGCGCAGGGAGGCGG - Intronic
1067286452 10:44911120-44911142 GGAGGAGGGAGCCAAGGAGTGGG - Intergenic
1067660980 10:48236011-48236033 GGAGGATGGAGCATGGCAGGTGG - Intronic
1069406215 10:68102213-68102235 GGAGGATCGAGCCTGGGAGGTGG - Intergenic
1069633918 10:69913926-69913948 AGAGAATTGACCCAGAGAGGAGG + Intronic
1069944902 10:71979014-71979036 GAAGGAAGGATGCAGGGAGGAGG - Intronic
1071772025 10:88739766-88739788 GGAGAATGGAACCCAGGAGGTGG + Intronic
1072357431 10:94625010-94625032 GGAGCATGCAGACAGGGAGGTGG - Intergenic
1072369151 10:94745796-94745818 GTAGGAAGGACCCAGGTGGGAGG + Intronic
1073017843 10:100416013-100416035 GGAGGACAGACCCAGGGAAGAGG + Intergenic
1073339628 10:102735168-102735190 GGAGGAAGGACACAGAGGGGAGG - Intronic
1073553712 10:104427796-104427818 GGAGGGAGGACCCAGCCAGGTGG + Intronic
1073795137 10:106979073-106979095 GGAGGCTTGGCCCAGGGTGGTGG + Intronic
1074320845 10:112400794-112400816 GGAGGCTGGAGTCGGGGAGGGGG - Intronic
1074699701 10:116082390-116082412 GGTGGAAAGTCCCAGGGAGGAGG - Intronic
1075110073 10:119572260-119572282 GGAGAATTGAACCTGGGAGGTGG - Exonic
1075219372 10:120571388-120571410 GGAGGATGGAGGTAGGGTGGGGG + Intronic
1075399473 10:122150630-122150652 GGAGGCAGGGCCCAGGGAGGTGG + Intronic
1075798288 10:125136179-125136201 GCTGGAGGGACCCAGGCAGGGGG + Intronic
1075853632 10:125609066-125609088 GGAGGCTTGAACCTGGGAGGCGG + Intronic
1075863692 10:125698914-125698936 TGAGAATGGACCAAGGAAGGAGG - Intergenic
1075886427 10:125903377-125903399 GGAGGCTGGAAGAAGGGAGGAGG + Intronic
1076033111 10:127175921-127175943 CGAGGCTGGACCCATGGAGGAGG - Exonic
1076054944 10:127364793-127364815 GGAGGAAGGAAGAAGGGAGGAGG - Intronic
1076623673 10:131808829-131808851 GGAGGATGGCCACAGGAAGACGG - Intergenic
1076727344 10:132419781-132419803 GGAGGCTGGACCCAGAGCAGGGG - Intergenic
1076768638 10:132651271-132651293 GGGAGATGGACCCAGGCCGGGGG - Intronic
1076768679 10:132651363-132651385 GGGAGATGGACCCAGGCCGGGGG - Intronic
1076768700 10:132651409-132651431 GGGAGATGGACCCAGGCCGGGGG - Intronic
1076778084 10:132709256-132709278 GGGGGATGGAGGGAGGGAGGGGG + Intronic
1076880314 10:133236573-133236595 AGAGGTTGGAGCCCGGGAGGCGG - Intergenic
1077102267 11:827534-827556 GCAGCAGGGCCCCAGGGAGGTGG - Intronic
1077137174 11:1006269-1006291 GCAGGAGGGGCCGAGGGAGGAGG + Intronic
1077254417 11:1573910-1573932 GGAGGCTTGGCCCTGGGAGGGGG + Intergenic
1077274623 11:1698288-1698310 GGAGGGTGGACGGTGGGAGGAGG - Intergenic
1077305627 11:1867580-1867602 GGAGGAGGGACCCAGGGACCCGG - Intronic
1077333763 11:1994472-1994494 TGAGGGTGGCCACAGGGAGGAGG - Intergenic
1077340965 11:2026139-2026161 GGCTGTTGGACCCAGTGAGGTGG - Intergenic
1077365358 11:2159351-2159373 GGAGGCTGGGCTGAGGGAGGGGG - Intronic
1077420922 11:2449495-2449517 GGTGGTTGGAGCCAGGGAGCTGG + Intronic
1077433263 11:2526439-2526461 GAGGGAGGAACCCAGGGAGGGGG + Intronic
1077461464 11:2712841-2712863 GGGGGCTGGACACAGGGAGGAGG + Intronic
1077809436 11:5622529-5622551 GGAGAATCGAACCTGGGAGGCGG + Intronic
1078580987 11:12539433-12539455 GGATGAGAGAGCCAGGGAGGAGG + Intergenic
1079393672 11:20043530-20043552 GGAGGATCACCCCGGGGAGGTGG - Intronic
1079580343 11:22055861-22055883 GGAGGAACTACCCAGTGAGGAGG + Intergenic
1079593092 11:22205195-22205217 GGAGGATGGAGGGTGGGAGGAGG + Intronic
1079929684 11:26542412-26542434 GGAGGATGGAGCCATGGAGAGGG + Intronic
1080193666 11:29581905-29581927 GGAGGGTGGAGGCTGGGAGGAGG + Intergenic
1080673205 11:34400227-34400249 GGAGGATGGACCCAGGGACAAGG + Intergenic
1080708358 11:34721095-34721117 GGAGAATAGACCCAGAGAAGAGG - Intergenic
1081667581 11:44925525-44925547 TGAGGCTGCACCCAGGCAGGTGG - Intronic
1081939282 11:46927185-46927207 GTGGGAGGGACCCAGGGGGGAGG + Intergenic
1082774545 11:57235383-57235405 GAAGGATGGATGGAGGGAGGGGG + Exonic
1083183014 11:61000379-61000401 GGACGATGGAAACATGGAGGTGG - Intronic
1083187674 11:61026982-61027004 GGGGAAGGGAGCCAGGGAGGGGG - Intergenic
1083290509 11:61687293-61687315 GGAGAATGGCCTCATGGAGGAGG - Intronic
1083737113 11:64687650-64687672 GGAGGAGGGAAGGAGGGAGGTGG + Intronic
1084374861 11:68769603-68769625 GGAGGCAGGACACGGGGAGGTGG - Intronic
1084434436 11:69130685-69130707 AGAGGATGCTCCCAGGGAGTCGG + Intergenic
1084562950 11:69914399-69914421 GAAGGCTGCAGCCAGGGAGGGGG + Intergenic
1084564134 11:69920046-69920068 GGAGCATTCACCCAAGGAGGGGG - Intergenic
1084944322 11:72630723-72630745 GGAGCCTGGACCCAAGCAGGCGG + Intronic
1085027560 11:73245446-73245468 GGAGGATGGGACCAGGGTGGCGG + Intergenic
1085038315 11:73312622-73312644 GGAGGATAGAGGCAGGGAGGGGG + Intronic
1085263314 11:75221204-75221226 GGAGGATGGAGGGTGGGAGGAGG - Intergenic
1085819416 11:79776436-79776458 GAAGGATGGATGCAGGGAAGAGG - Intergenic
1087070414 11:94074201-94074223 TGAGGATGGGTCCAGGGAGAGGG - Intronic
1087498739 11:98923677-98923699 GGAGGAGGGAAGCAGGGAGTAGG - Intergenic
1087812708 11:102625230-102625252 GGAGGCTGCAACTAGGGAGGGGG + Exonic
1087864513 11:103207466-103207488 GGGGGATAGATCCAGGTAGGTGG + Intronic
1088365214 11:109033124-109033146 GGAGGATGGAGAGTGGGAGGAGG - Intergenic
1089537294 11:119168733-119168755 CGGGGATGGAGGCAGGGAGGGGG + Intronic
1089556152 11:119316900-119316922 GGATCGGGGACCCAGGGAGGAGG + Intronic
1089680303 11:120115592-120115614 GGAGGCTGGCCAAAGGGAGGAGG + Intronic
1090020645 11:123125474-123125496 GGAGGAAGGAGGGAGGGAGGAGG - Intronic
1090046810 11:123342920-123342942 GGAGGAGGGACCTAGTGGGGAGG + Intergenic
1090390555 11:126384670-126384692 GGAGGAGGCCCCTAGGGAGGTGG - Intronic
1090522741 11:127496400-127496422 GGAGGATGGCCACAGGGAAATGG + Intergenic
1090983241 11:131742071-131742093 GGAGGGTGGAGGCTGGGAGGTGG + Intronic
1090983835 11:131748557-131748579 AGTGGATGGGCACAGGGAGGAGG - Intronic
1091069330 11:132548424-132548446 GGAGGATGGGCCTAGGGCAGGGG + Intronic
1091132014 11:133154150-133154172 GCAGGATGGAGCCAGGAGGGAGG + Intronic
1091154425 11:133360609-133360631 GGAGGAGGGAAGAAGGGAGGAGG + Intronic
1091206446 11:133824488-133824510 GCAGGAAGGACTCAGGAAGGAGG - Intergenic
1091291392 11:134442257-134442279 GGCAGATGGACCCAGGGTGTGGG + Intergenic
1202816743 11_KI270721v1_random:49654-49676 TGAGGGTGGCCACAGGGAGGAGG - Intergenic
1202823950 11_KI270721v1_random:81328-81350 GGCTGTTGGACCCAGTGAGGTGG - Intergenic
1091383526 12:77952-77974 CGAGGCTGGACGCTGGGAGGGGG - Intronic
1092325524 12:7527568-7527590 GGAGGACCCACCCAGTGAGGAGG + Intergenic
1092745623 12:11669634-11669656 TGGGGAGGGACCCGGGGAGGAGG - Intronic
1092961794 12:13602997-13603019 GGAGGAAGCCCACAGGGAGGTGG - Intronic
1093167174 12:15817502-15817524 GGAGGGTGGAGGGAGGGAGGAGG + Intronic
1095420371 12:42018472-42018494 GAAGAGTGGACCCAGGGAAGAGG - Intergenic
1095943096 12:47739060-47739082 GGGGGATGGAGGCAGGAAGGGGG + Intronic
1095943107 12:47739087-47739109 GGGGGATGGAGGCAGGAAGGGGG + Intronic
1096073858 12:48789779-48789801 AGTGGAGGGACCCAGGGAAGGGG + Intergenic
1096583004 12:52600499-52600521 GTGGGAGGGACCCAGGGGGGAGG + Intronic
1096854901 12:54473779-54473801 GGAGGATGGCCCCAAAGATGGGG - Intergenic
1096976027 12:55699673-55699695 GGAGGAGGCCCCCAGGGTGGTGG - Intronic
1096980510 12:55725951-55725973 GACTGATGGACCAAGGGAGGGGG - Intronic
1097152698 12:56991323-56991345 GAAGGAAGGTACCAGGGAGGAGG - Intergenic
1097248872 12:57621493-57621515 GGAGGAAGGACGGAGGGTGGAGG + Intronic
1097419297 12:59354206-59354228 GGAGGATGAAGGCTGGGAGGAGG - Intergenic
1097810583 12:64014462-64014484 GGAGGATGGAGGCTGGGAGGAGG + Intronic
1099228890 12:80000482-80000504 GGAAGACAGACCCAGGGAAGAGG + Intergenic
1099314981 12:81073294-81073316 GGAGAATTGCCTCAGGGAGGTGG - Intronic
1100361817 12:93886249-93886271 GGAGGATCGAGCCCAGGAGGTGG - Intronic
1100390634 12:94143456-94143478 GGCGTATGGCCCCAGGGTGGGGG - Intergenic
1100606224 12:96154214-96154236 GGAGGATGGAAACTGAGAGGAGG - Intergenic
1100900661 12:99236948-99236970 GGAGGATGGAGGGTGGGAGGAGG + Intronic
1101264821 12:103073175-103073197 GGAGGATGGAGGGTGGGAGGAGG + Intergenic
1102418433 12:112784704-112784726 GTAGGGTGGACACAGGGAGAAGG + Intronic
1102538437 12:113600176-113600198 GGGAGATGGAACCAGGGTGGGGG - Intergenic
1102598766 12:114012975-114012997 GGAGGAGGGAGAGAGGGAGGAGG + Intergenic
1102809142 12:115808991-115809013 GGAAGGTGGAACCAGGGAGAGGG - Intergenic
1103207766 12:119143729-119143751 GGAGAATGGATCCATGGATGAGG + Intronic
1103402111 12:120650177-120650199 GGGAGATGGCCTCAGGGAGGGGG - Intronic
1103909438 12:124344273-124344295 GAAGGATGGAAGCAGGGAAGTGG + Intronic
1103921581 12:124402197-124402219 AGAGGGGGGAGCCAGGGAGGAGG + Intronic
1104522102 12:129485547-129485569 GGTGGGTGGACCCAGGAAAGAGG - Intronic
1104638357 12:130451583-130451605 CGAGGATGGTCCCAGGCAGAGGG + Intronic
1104717110 12:131023395-131023417 GGAGGATGGAGACAGAGCGGGGG - Intronic
1104946680 12:132417749-132417771 GGAGGCTGGGCCGTGGGAGGAGG - Intergenic
1104992576 12:132634456-132634478 GGCAGATGGACCCAGGTTGGAGG - Intronic
1105252410 13:18711336-18711358 GGGTGATGGACCCATGGTGGTGG + Intergenic
1105503654 13:20992262-20992284 GGGGGATGGACCCACAGATGGGG + Intronic
1105600199 13:21879790-21879812 GGTGGATGGACCCAGGTAGGTGG - Intergenic
1105964524 13:25372313-25372335 GGAGGGTGGGCCCGGGGCGGGGG + Intronic
1106144742 13:27040788-27040810 GGAGGATGTTATCAGGGAGGAGG - Intergenic
1106208771 13:27621850-27621872 GGAGGACGGAAGGAGGGAGGAGG - Exonic
1107015950 13:35707806-35707828 GGTGGGTGGACCCTGGAAGGGGG - Intergenic
1107119245 13:36779098-36779120 GGAGGATCCACCCAGCCAGGAGG - Intergenic
1108197537 13:48010000-48010022 GGAGGATGGAACCTGGGAGGGGG - Intergenic
1108419317 13:50232797-50232819 GTTGGAGGGACCCAGGGGGGAGG + Intronic
1108723922 13:53160440-53160462 GGAGCCTGCTCCCAGGGAGGAGG + Intergenic
1109382282 13:61578527-61578549 GGAGGATGGAGGTTGGGAGGAGG + Intergenic
1110148303 13:72221053-72221075 GGGGGATGGACCCTGGCAGGTGG + Intergenic
1110214943 13:73014873-73014895 GGAGAATTGAACCTGGGAGGTGG - Intronic
1110862574 13:80359220-80359242 GAAGGATGGAAGCAGGAAGGAGG - Intergenic
1111048469 13:82846925-82846947 GGAGGAGGGAGGAAGGGAGGAGG + Intergenic
1111048475 13:82846940-82846962 GGAGGAGGGAGGAAGGGAGGAGG + Intergenic
1111267428 13:85835333-85835355 GGAGAATCGAACCTGGGAGGCGG + Intergenic
1111955705 13:94756037-94756059 TGAGGATGGAGAGAGGGAGGAGG - Intergenic
1112336864 13:98523392-98523414 GGGGTGTGGACCCAGAGAGGTGG - Intronic
1112493681 13:99888660-99888682 GGAGAATCGAACCCGGGAGGCGG + Intronic
1112653945 13:101428626-101428648 GGAGGAGGGAGGGAGGGAGGGGG - Intergenic
1113093516 13:106639099-106639121 GGTGGATGTGCTCAGGGAGGTGG + Intergenic
1113483958 13:110641210-110641232 AGAGCAGGGACCCCGGGAGGCGG - Intergenic
1113649932 13:112027886-112027908 GGGGCATGGACCCAGCCAGGAGG + Intergenic
1113661118 13:112106939-112106961 GGAGGAGGGGCCCAGGGAGGGGG + Intergenic
1113740138 13:112706163-112706185 GCAGGATGGACCGAGATAGGAGG + Intronic
1113742684 13:112722293-112722315 GGAGGGTGGGCCCGGGGAGAGGG + Intronic
1113915180 13:113866348-113866370 GGAGGTTGGACCCAGGGCAATGG + Intergenic
1114696439 14:24631398-24631420 GGAGGCTGGCCCCTGGGATGAGG - Intronic
1116021762 14:39469690-39469712 GGAGGATGGGGGCAGGGAGGAGG + Intergenic
1116051111 14:39804381-39804403 AGAGGATGGAGTCAAGGAGGAGG + Intergenic
1117449450 14:55836891-55836913 GGGTGATGGCACCAGGGAGGTGG + Intergenic
1118426195 14:65665929-65665951 GGAGGGTGGACAATGGGAGGAGG + Intronic
1118747479 14:68784659-68784681 GGAGGACGGAGTCTGGGAGGAGG - Intergenic
1119046286 14:71320995-71321017 GGAGGGGGGCCCGAGGGAGGCGG - Intronic
1119164460 14:72480678-72480700 TGAAGATGGGGCCAGGGAGGAGG + Intronic
1119386259 14:74259712-74259734 TGAGGATGGACTCGGGCAGGGGG - Exonic
1119902368 14:78272345-78272367 AGAGAATGGACCCTGGGAAGAGG + Intronic
1119941282 14:78644181-78644203 GAAAGATGGATCCAGGGAAGAGG + Intronic
1120368999 14:83607861-83607883 GGAGGCTCCACCCAGTGAGGAGG + Intergenic
1120738966 14:88086696-88086718 GGAGGATGGAGAATGGGAGGAGG - Intergenic
1120769892 14:88367557-88367579 GGAGGGTGGAGGCAGGGAGGAGG - Intergenic
1121040626 14:90743863-90743885 GCTGGATGGGGCCAGGGAGGTGG - Intronic
1121416704 14:93784292-93784314 GAAGGATGGATGCAGGGAGGAGG - Intronic
1121422217 14:93824055-93824077 GGAAAATGGGCTCAGGGAGGGGG + Intergenic
1121536664 14:94695643-94695665 GGAGGATGCACCCAGGGTTCCGG + Intergenic
1121675641 14:95750522-95750544 GGAGGAAGGTCCCAGGGATGAGG + Intergenic
1121719648 14:96100460-96100482 GGAGGAGGGAGGTAGGGAGGAGG - Intergenic
1121719654 14:96100475-96100497 GGAGGAGGGAGGTAGGGAGGAGG - Intergenic
1121815715 14:96926494-96926516 GGAGAATTGAGCCTGGGAGGTGG + Intronic
1122143071 14:99673937-99673959 GGAGGGTGCACCGAGGGGGGTGG + Intronic
1122177384 14:99931110-99931132 TGGGGATCAACCCAGGGAGGGGG - Intronic
1122227713 14:100289439-100289461 AGAGGCTGGCCCCTGGGAGGTGG + Intergenic
1122308702 14:100781235-100781257 GGAGGCTGCACCCAGAGGGGAGG + Intergenic
1122356466 14:101125894-101125916 GCAGGATGGGTCCAGGGATGGGG - Intergenic
1122626641 14:103088423-103088445 GGAGGACGGTGCTAGGGAGGGGG - Intergenic
1122671768 14:103378280-103378302 GGAGGAGGAAACCGGGGAGGAGG + Intergenic
1122718691 14:103710048-103710070 GGAGGATGGAAGCTGGCAGGAGG + Intronic
1122778819 14:104135049-104135071 TGATGGTGGACGCAGGGAGGGGG + Intergenic
1122797113 14:104211519-104211541 GGAGGCAGAGCCCAGGGAGGAGG + Intergenic
1122799563 14:104222891-104222913 GGAGGCTGTACCCAAGGAGCTGG - Intergenic
1122854393 14:104553217-104553239 GGAGCCTGGACTCAGGGTGGTGG + Intronic
1122862355 14:104588344-104588366 GGTGGGTGCACCCACGGAGGGGG - Intronic
1122928610 14:104923003-104923025 GGAGGATGGATCCAGGCTTGGGG - Intergenic
1122958771 14:105085026-105085048 GCAAGCAGGACCCAGGGAGGGGG + Intergenic
1123102373 14:105813433-105813455 GGAGGGTGGAGGCCGGGAGGAGG - Intergenic
1202871655 14_GL000225v1_random:170544-170566 GGAGGCTGGAAGAAGGGAGGAGG - Intergenic
1123800318 15:23811964-23811986 GGAGGATGGTGGGAGGGAGGAGG + Intergenic
1124034252 15:26039433-26039455 GGAGGCTGAAACCTGGGAGGCGG - Intergenic
1124690235 15:31815678-31815700 GCAGGATGGAGCCAGGCTGGGGG + Intronic
1124971834 15:34496080-34496102 GGAGTAGGGAACCAGGGCGGAGG - Intergenic
1125703854 15:41713429-41713451 GGAAGAAGGAATCAGGGAGGAGG + Exonic
1125768482 15:42150286-42150308 GGAGGAGGGACCCAAGAGGGTGG - Intronic
1126253231 15:46593483-46593505 GGAGAATGGAAGGAGGGAGGGGG - Intergenic
1126457380 15:48878335-48878357 GGAGGAAGGCCCAATGGAGGAGG + Exonic
1126862176 15:52896073-52896095 GGAGAATGGAATTAGGGAGGAGG + Intergenic
1127223019 15:56900191-56900213 GGAGGCTTGAACCTGGGAGGCGG - Intronic
1127287326 15:57543222-57543244 TGAAGATGGACACAGGGAAGTGG - Intronic
1127315666 15:57791823-57791845 AGAGGATAAACCCAGGGATGAGG + Intergenic
1128514925 15:68336024-68336046 AGAGGCAGGACCCAGGAAGGGGG + Intronic
1128550770 15:68596671-68596693 TGAGGATGGAGCCAGGGCAGAGG + Intronic
1128570585 15:68730455-68730477 GGAGAATGGATCCAGCGAAGGGG + Intergenic
1128728738 15:70006560-70006582 GGGGCATGGACGCAGGGAGGTGG - Intergenic
1128728745 15:70006581-70006603 GGGGCATGGACGCAGGGAGGTGG - Intergenic
1128728752 15:70006602-70006624 GGGGCATGGACGCAGGGAGGTGG - Intergenic
1128728759 15:70006623-70006645 GGGGCATGGATGCAGGGAGGTGG - Intergenic
1128728766 15:70006644-70006666 GGGGCATGGATGCAGGGAGGTGG - Intergenic
1128728773 15:70006665-70006687 GGGGCATGGATGCAGGGAGGTGG - Intergenic
1129189946 15:73931317-73931339 GGAGCAAGGGACCAGGGAGGAGG - Intronic
1129392269 15:75226353-75226375 GGCAGATGGACAGAGGGAGGGGG + Intergenic
1129472125 15:75761812-75761834 GGCAGATGGACAGAGGGAGGGGG - Intergenic
1129536919 15:76320926-76320948 GGAGGATGGACTGAGGGATGGGG + Intergenic
1129565190 15:76614245-76614267 GGAGGATGGAGGGTGGGAGGAGG + Intronic
1129676079 15:77632930-77632952 GGAGGAGGGATCGAGGGAGGAGG + Intronic
1129697292 15:77747877-77747899 GGAGGAAGGAGGCAGGGAGGAGG + Intronic
1129803675 15:78436944-78436966 GGAAAATGGACAGAGGGAGGAGG + Intergenic
1129829578 15:78659876-78659898 GGAGCAGGGAACCAGTGAGGAGG + Intronic
1129933118 15:79428486-79428508 GGAGGAAGGAGGGAGGGAGGGGG - Intergenic
1129992996 15:79980950-79980972 GCAGGATTGAACCCGGGAGGTGG - Intergenic
1130119818 15:81038201-81038223 GGAGGGTTGACTCAGAGAGGGGG + Intronic
1130391351 15:83458438-83458460 GGAAGATGTAGCCAGGGACGGGG - Intronic
1130557808 15:84935227-84935249 AGAGGATGGCCCCAGGTGGGTGG + Intronic
1130564416 15:84981674-84981696 GGAGTCTGGAGCCGGGGAGGCGG + Intronic
1130916865 15:88312059-88312081 GGAAGGTGGAGCGAGGGAGGAGG - Intergenic
1130933195 15:88447334-88447356 GCAGTATGGAGCCAGGCAGGGGG - Intergenic
1131217416 15:90550321-90550343 GGAGGCTTGAACCCGGGAGGTGG + Intronic
1131295505 15:91145130-91145152 GGAGGATGGAGGGTGGGAGGAGG - Intronic
1131857163 15:96609848-96609870 GGAGGAAGGAAGGAGGGAGGAGG - Intergenic
1132309171 15:100844305-100844327 GTAGGATGGACCCAGTTAGTGGG + Intergenic
1132599468 16:767498-767520 GGAGGAGGGGCCCGTGGAGGAGG + Intronic
1132599702 16:768053-768075 GGAGGAGGGGCACATGGAGGGGG + Intronic
1132700139 16:1218773-1218795 GGAGGATGGGGGCAGGCAGGAGG + Intronic
1132733982 16:1376486-1376508 GGAGGATGGACGCCAGGAGGAGG - Intronic
1132760872 16:1508091-1508113 GCCGGAGGGGCCCAGGGAGGCGG - Intronic
1132888260 16:2191947-2191969 GGAGGTTGGACCGAGGGATGTGG - Intronic
1133285786 16:4690112-4690134 GCAGGACTGGCCCAGGGAGGAGG + Exonic
1133407812 16:5539512-5539534 GGAGAATTGAACCTGGGAGGTGG + Intergenic
1133483758 16:6197787-6197809 GGAGGATGGAGGGTGGGAGGAGG - Intronic
1134030529 16:10988933-10988955 GGAAGAAGGTCCCAGGTAGGAGG - Intronic
1134408253 16:13981638-13981660 GGAGGATGGACCCAGGAAAGAGG - Intergenic
1135510068 16:23074953-23074975 TCAGGATGGCCCCAGGGATGGGG + Intronic
1135621074 16:23956206-23956228 GGAGGATTGAGCCCTGGAGGTGG - Intronic
1135797727 16:25461355-25461377 GGAGGAAGGACCAAGGCAAGAGG - Intergenic
1135954115 16:26941217-26941239 GGAGGGAGGACCCAGGCAGGAGG - Intergenic
1136116446 16:28097704-28097726 GGAGGCTGGAGGCTGGGAGGGGG - Intergenic
1136417307 16:30112078-30112100 GGAGGAGGGGCCCCTGGAGGAGG + Intronic
1136517918 16:30778961-30778983 GGAGGATTGAAGCAGGGAGGTGG - Exonic
1136604385 16:31323337-31323359 GGAGAATTGAACCTGGGAGGCGG + Intronic
1137351109 16:47714583-47714605 GGAGGATGGGGACTGGGAGGTGG - Intergenic
1137463297 16:48685608-48685630 GCAGGGTGGAGCTAGGGAGGTGG + Intergenic
1137697982 16:50475185-50475207 TGTGGATGGCCCCAGAGAGGAGG - Intergenic
1137871591 16:51954997-51955019 GGAGGCTTGAACCTGGGAGGCGG + Intergenic
1137921592 16:52494378-52494400 GGAGGAGGGACCCAGGCCGGTGG - Intronic
1138281248 16:55773549-55773571 GGAGCATAGAGCCAAGGAGGTGG - Intergenic
1138287291 16:55820312-55820334 GGAGCATAGAGCCAAGGAGGTGG + Intronic
1138418051 16:56882523-56882545 GGAGGAGGCACCCAGGGGGCAGG + Intronic
1139504651 16:67392900-67392922 GGAGGTTGCACCCAGGGAAAGGG - Intronic
1139549914 16:67667400-67667422 GGAGGAAGGACCCAAGCTGGGGG + Exonic
1139655092 16:68382635-68382657 TGAGAGTGGACTCAGGGAGGTGG + Intronic
1139779682 16:69340112-69340134 GCAGCATGGACCCAGGGGAGAGG + Intronic
1140864801 16:79050565-79050587 GGGGCATGGATCCAGAGAGGAGG + Intronic
1141283916 16:82653635-82653657 GGAGGGAGCAGCCAGGGAGGGGG + Intronic
1141426743 16:83949270-83949292 GGAGGGGAGACCCAGGAAGGAGG - Exonic
1141449598 16:84089113-84089135 GGAGGATGGGCAGAGGGATGGGG + Intronic
1141881714 16:86864576-86864598 GGAGGGTGGAGGGAGGGAGGAGG - Intergenic
1142000161 16:87659875-87659897 GGGGGAGGGAACCTGGGAGGGGG - Intronic
1142073217 16:88102814-88102836 GGCGGATGGAGGCGGGGAGGCGG - Intronic
1142150238 16:88509459-88509481 GGAGGCTGGCCCCTGGAAGGCGG + Intronic
1142511199 17:394636-394658 GGAGGAAAGACCCAGGAAAGAGG + Intergenic
1142766559 17:2067683-2067705 GGAGGGTGGAGGCAGGGAGGAGG + Intronic
1142863430 17:2776857-2776879 GGGGGCTGGGCCGAGGGAGGGGG + Intergenic
1142931799 17:3291647-3291669 GGAGGATGCTCACAGGGAGGCGG - Exonic
1143118431 17:4593312-4593334 GGAGGATGGGCTAAGGGAAGGGG - Intronic
1143330476 17:6131275-6131297 GGTGGATGGACCCATAGAGGGGG - Intergenic
1143410824 17:6707371-6707393 GAAGGAGGGAGGCAGGGAGGAGG - Intronic
1143502331 17:7346796-7346818 GGAGGCAGGACCTAGGTAGGAGG - Exonic
1143557698 17:7672492-7672514 GATGGATGGAGCCTGGGAGGTGG + Intronic
1143615333 17:8046146-8046168 TGTGGGTGGACCCTGGGAGGGGG - Intronic
1143881802 17:10035554-10035576 TGCTGATGGGCCCAGGGAGGTGG + Intronic
1144541113 17:16144580-16144602 GGAGGATGGAAGGAGGGAGAGGG - Intronic
1144647824 17:16987445-16987467 GGAGGAGGGAGGGAGGGAGGTGG + Intergenic
1144657356 17:17045210-17045232 GGATACTGGGCCCAGGGAGGTGG + Intronic
1144704828 17:17361580-17361602 GGAGGACAGAGGCAGGGAGGGGG + Intergenic
1144704844 17:17361622-17361644 GGAGGACAGAGGCAGGGAGGGGG + Intergenic
1145062932 17:19743810-19743832 GGGGGATGGATCCGGGGAGGGGG + Intronic
1145302146 17:21648222-21648244 GGAGGCTGCACCCTGGGAGATGG + Intergenic
1145328487 17:21851005-21851027 GGAGGCTGCACCCTGGGAGATGG + Intergenic
1145348167 17:22055094-22055116 GGAGGCTGCACCCTGGGAGATGG - Intergenic
1145415416 17:22710292-22710314 GGAGGGTGCACCCTGGGAGATGG + Intergenic
1145695269 17:26782349-26782371 GGAGGCTGCACCCTGGGAGATGG + Intergenic
1145816370 17:27797802-27797824 GAAGGATGGGCCCGGGGAGGAGG + Intronic
1146506993 17:33414218-33414240 GGAGGCTGCACCCAAAGAGGAGG + Intronic
1146532176 17:33617497-33617519 GGAGGGTGGAGGGAGGGAGGAGG + Intronic
1146569623 17:33941340-33941362 GCAGGATGAACCCAGAGTGGTGG + Intronic
1146594127 17:34155115-34155137 GGAGGAGGGGTGCAGGGAGGGGG - Intronic
1146642228 17:34550116-34550138 GGAGGAAGGAGGGAGGGAGGTGG + Intergenic
1146670855 17:34736518-34736540 GGAGGAGGGAGAGAGGGAGGTGG + Intergenic
1146688320 17:34856598-34856620 GGAGGATTCACCCAGGATGGGGG + Intergenic
1146688374 17:34856762-34856784 GGAGGATTCACCTAGGAAGGGGG + Intergenic
1146691801 17:34882033-34882055 GGAGGATCCACCTTGGGAGGGGG + Intergenic
1146940039 17:36838088-36838110 GGAGGATGAATTAAGGGAGGAGG - Intergenic
1147168748 17:38606245-38606267 GGAGGAGGCACCCGGGGAAGCGG + Intergenic
1147190544 17:38735616-38735638 GGAGGAGAGACACAGGGAAGGGG + Intronic
1147208821 17:38858868-38858890 AGAAGATGGAGCCAGGGAAGAGG - Intergenic
1147310861 17:39595512-39595534 GGAGGAGGGATGAAGGGAGGAGG + Intergenic
1147337799 17:39737870-39737892 GGAGGAGGAAACCTGGGAGGAGG - Intergenic
1147406752 17:40217920-40217942 GGGCGATGGAGCCAGGGAGATGG - Intergenic
1147425412 17:40343816-40343838 GGAGCCTGCACCCAGGCAGGGGG - Intronic
1147427112 17:40351226-40351248 GGGGGAGGGGCTCAGGGAGGGGG - Intronic
1147818830 17:43229625-43229647 GGTGGATGGATGCTGGGAGGTGG + Intergenic
1147832113 17:43304327-43304349 GGTGGATGGATGCTGGGAGGTGG + Intergenic
1148046965 17:44750143-44750165 AGAGGAGGGAGCGAGGGAGGAGG - Intronic
1148332111 17:46819191-46819213 GGAGGCTGGAAGCTGGGAGGGGG - Intronic
1148386793 17:47239899-47239921 GGAGAATGGAGCCAGAGGGGTGG + Intergenic
1148466148 17:47866404-47866426 GGAAGATGGGCCCAGGTTGGGGG + Intergenic
1148759335 17:49991383-49991405 GGAGGAAGGGGCAAGGGAGGGGG + Exonic
1148765859 17:50037845-50037867 GGAGGCAGGAGCCTGGGAGGCGG - Intergenic
1148874358 17:50677952-50677974 GGAGCAGGGAGCGAGGGAGGCGG - Intronic
1148949497 17:51298110-51298132 GGAGGATCGATTCAGGAAGGGGG - Intergenic
1149566276 17:57642897-57642919 GTAGAATGGGCCCAGGGAGAAGG + Intronic
1150248069 17:63690883-63690905 GGTGGAAGGAGGCAGGGAGGTGG - Intronic
1150290354 17:63977839-63977861 GTGGTATGGACCCAGGGAGATGG - Intergenic
1150651706 17:67014604-67014626 AGAGGAGGGAGCCAGGGAGAAGG + Intronic
1150851389 17:68707064-68707086 GGAGGAGGGACAAAGAGAGGCGG + Intergenic
1150961170 17:69913974-69913996 GGAGGATGGATGGAGGAAGGAGG + Intergenic
1151223645 17:72632356-72632378 GGAGGGTGGAGGCAGGGAGGAGG - Intergenic
1151249393 17:72821914-72821936 GGGGAATGGACCCAGGGAAGAGG - Intronic
1151335580 17:73437828-73437850 GGAGGAAGGACCAGGGGAGGGGG + Intronic
1151345691 17:73500089-73500111 GGAGGATGGACGGAGGATGGAGG - Intronic
1151345732 17:73500237-73500259 GGAGGATGGACGGAGGATGGTGG - Intronic
1151345772 17:73500390-73500412 GGAGGATGGACAAAGGATGGAGG - Intronic
1151345816 17:73500580-73500602 GGAGGATGGACAGAGGATGGAGG - Intronic
1151345846 17:73500712-73500734 GGAGGATGGACAGAGGATGGAGG - Intronic
1151395557 17:73820295-73820317 GCAGGGAGGACACAGGGAGGAGG - Intergenic
1151649565 17:75457709-75457731 GGAAGATGGAAGCAGGGAGGGGG + Intronic
1151819085 17:76487670-76487692 GGTGGCTGGACCCAGGGCGCTGG - Intronic
1151823970 17:76513230-76513252 GGAGGAAGGAGCCAGGGAAGAGG - Intergenic
1152272583 17:79333755-79333777 GGAGGATGGGATCAGGGAGCTGG - Intronic
1152360107 17:79828905-79828927 GCAGGACGGACCCTGAGAGGCGG + Intergenic
1152375770 17:79918288-79918310 GGAGGGTGGACGTTGGGAGGGGG - Intergenic
1152639970 17:81445276-81445298 GCAGGATGAACCCAAGCAGGGGG + Intronic
1152641789 17:81452364-81452386 GGAGGCTGGCCGCAGGGTGGCGG + Intronic
1152699133 17:81810609-81810631 GGAGGCTGGTCCAGGGGAGGTGG + Intronic
1152813001 17:82391065-82391087 GGAGGAGGGACCGAGGCAGGAGG + Intronic
1153046163 18:857278-857300 AGAGCATGGCCCCAGGTAGGGGG + Intergenic
1153284816 18:3448257-3448279 GGAGGAGAGACGCAGGGAGGAGG - Intronic
1153980995 18:10310491-10310513 GGGGAATCAACCCAGGGAGGGGG + Intergenic
1154257690 18:12798402-12798424 GGAGGATGGAGGGTGGGAGGAGG - Intronic
1155505423 18:26528299-26528321 GGAGGATGGTCCCAGGATGGTGG + Intronic
1155560493 18:27071026-27071048 AGAGGCTGGCCACAGGGAGGTGG - Intronic
1157052530 18:44183988-44184010 GGAGGTTGGAGGGAGGGAGGAGG + Intergenic
1157207306 18:45711607-45711629 GGAGACTTGAACCAGGGAGGTGG - Intergenic
1157236380 18:45968467-45968489 GGAGAATTGAACCTGGGAGGCGG + Intergenic
1157814842 18:50722995-50723017 GGAGGGTGAGCCTAGGGAGGAGG + Intronic
1158101776 18:53837641-53837663 TGAGGATGGACGTTGGGAGGAGG + Intergenic
1158273555 18:55742325-55742347 GAAGGATGGACCCATGAAAGAGG - Intergenic
1158341465 18:56471238-56471260 GAAGGATGGGGCCAGGGAGCAGG - Intergenic
1160016493 18:75145173-75145195 GTAGGAGGAACCCAGGGTGGGGG - Intergenic
1160506011 18:79427264-79427286 GTGGAATGGACCCAGGGAAGGGG + Intronic
1160510267 18:79449657-79449679 GCAGGATGGAGCCAGGCCGGAGG + Intronic
1160698028 19:494095-494117 GTGGGATGGACACAGGAAGGAGG - Intronic
1160720584 19:595427-595449 GAGGGCTGGAGCCAGGGAGGAGG - Intronic
1160747728 19:719779-719801 GGAGGATGAACGCCGGGAGAAGG + Intronic
1160982656 19:1823427-1823449 GGCTGAGGGCCCCAGGGAGGGGG + Intronic
1160983437 19:1827043-1827065 GGAGGATGGGGCGGGGGAGGGGG + Exonic
1161068126 19:2248229-2248251 GGAGGATGGACCCCTGGGGCTGG - Exonic
1161266215 19:3366038-3366060 GGAGGAAAGAGCCAGGGGGGAGG - Intronic
1161329227 19:3678461-3678483 GGAGGATGGAGGGATGGAGGAGG + Intronic
1161396978 19:4049881-4049903 GGAGGATGGAGACAGGGCTGGGG - Intronic
1161491588 19:4565050-4565072 GGGGGAGGGAGCCGGGGAGGGGG + Intergenic
1161506901 19:4648873-4648895 GGAGGCTGGACCCAGGGGTTCGG + Intronic
1161530565 19:4786579-4786601 GGAGGTTGGAGGGAGGGAGGAGG + Intergenic
1161530582 19:4786625-4786647 GGAGGTTGGAGGGAGGGAGGAGG + Intergenic
1161535635 19:4817223-4817245 GGAGGAAGGGAACAGGGAGGAGG + Exonic
1161814517 19:6491491-6491513 GGAGGATGGACCAAGTGTGGTGG + Intergenic
1161824365 19:6552201-6552223 GCAGGGAGGGCCCAGGGAGGAGG - Intergenic
1161963100 19:7533734-7533756 GGAGGAAGGAAGCAGGGAAGAGG - Intronic
1161989033 19:7673493-7673515 GGAGGAAGGAGGGAGGGAGGAGG - Intergenic
1162387953 19:10371547-10371569 GGAGAATTGAACCTGGGAGGTGG + Intronic
1162391857 19:10394870-10394892 AGAGGGTGGGGCCAGGGAGGAGG - Intronic
1162777762 19:12990177-12990199 GGGGGATGGAGGCAGGGCGGGGG - Intergenic
1162867807 19:13562116-13562138 GGAGGAAGGACCCAGAGAGCAGG - Intronic
1162937276 19:13987452-13987474 TGACCAGGGACCCAGGGAGGTGG - Intronic
1162986333 19:14272526-14272548 GGAGATTGGACCCAGGGAGAGGG + Intergenic
1163006897 19:14402537-14402559 GGAGGATAGAGCATGGGAGGAGG + Intronic
1163617748 19:18339968-18339990 GGAGGAGGGCCCCTGGGAGGAGG + Intergenic
1163637566 19:18444496-18444518 GGAGGCTGCAGCCAGGGAGGAGG + Exonic
1164208342 19:23075823-23075845 GGAGGCTTGACCCTGGGAGACGG - Intronic
1164478349 19:28592295-28592317 GAAGGATGGAGCCTGGCAGGAGG - Intergenic
1164780269 19:30886144-30886166 GGAGGCAGGTGCCAGGGAGGAGG - Intergenic
1165043337 19:33084575-33084597 GGAAGATGGAACCAGAAAGGCGG - Intronic
1165057984 19:33190798-33190820 GGTGGCTGGGACCAGGGAGGTGG + Intronic
1165374817 19:35434272-35434294 GGAGGCTGGACCCAGGAAAAAGG + Intergenic
1165706599 19:37980601-37980623 GGAGGCTGAGGCCAGGGAGGAGG + Intronic
1165882500 19:39053728-39053750 GGTGGATGGGGCCAGGGTGGTGG - Intergenic
1166195926 19:41205972-41205994 GCAGGATGGAGCCAAGGAGGGGG - Exonic
1166512918 19:43422054-43422076 GATGGCTTGACCCAGGGAGGTGG + Intergenic
1166525454 19:43507395-43507417 GGAGGAGGGACTGGGGGAGGAGG - Intronic
1166742208 19:45121431-45121453 GGAGGATGTCACCAGGCAGGAGG + Intronic
1166784287 19:45358430-45358452 GGATGATGGGTCCAGGCAGGAGG - Intronic
1166945902 19:46396101-46396123 GGAGGCTGGGCCCACAGAGGAGG - Intergenic
1167043737 19:47038126-47038148 GGAGGATGGGTCCTGAGAGGTGG + Intronic
1167268975 19:48497733-48497755 GGAGGCTGGACCTCGGGAGTGGG - Exonic
1167269180 19:48498398-48498420 GGAGACAGGACCCAGGAAGGCGG - Exonic
1167270251 19:48502154-48502176 GGAGGAGGAACCAGGGGAGGGGG - Intronic
1167287302 19:48605652-48605674 GGAGGCTTGAACCTGGGAGGTGG - Intronic
1167409093 19:49334511-49334533 GGAGGAAGGACCCAAAGAAGGGG + Intergenic
1167686539 19:50960108-50960130 GGAGGATGGAGAGGGGGAGGAGG + Intronic
1167857134 19:52251232-52251254 TGAGGATGGAGGCTGGGAGGAGG - Intergenic
1168268281 19:55235388-55235410 GAAGGAAGGAGACAGGGAGGCGG + Intronic
1168719780 19:58548648-58548670 GGAGAGAGGACCCAGGCAGGGGG + Intronic
925257264 2:2500706-2500728 GTGGGAGGGACCCAGGGGGGAGG - Intergenic
925454903 2:4007738-4007760 GGAGGATGGATCCAGGCATGTGG - Intergenic
925739993 2:6996815-6996837 GTAGCTGGGACCCAGGGAGGTGG - Intronic
926001873 2:9339836-9339858 GCAGGCTGGACACAGAGAGGTGG - Intronic
926010093 2:9400419-9400441 GGAGGAGGAAGGCAGGGAGGAGG - Intronic
926010101 2:9400441-9400463 GGAGGATGGCAGGAGGGAGGAGG - Intronic
926123554 2:10257615-10257637 GGAGGATGGGCCCGTGGTGGCGG + Intergenic
926298028 2:11582419-11582441 GGAGGATGGGGCCATGGGGGTGG - Intronic
926303198 2:11618543-11618565 GGAGGATGAGCCCGAGGAGGAGG - Exonic
926783611 2:16498546-16498568 GGAGGGTGGACGGTGGGAGGAGG - Intergenic
926842273 2:17094328-17094350 GGAAGAGGGACACAGGCAGGAGG - Intergenic
926878902 2:17518592-17518614 AGAGGAGGGACTGAGGGAGGCGG - Intergenic
927020666 2:19013501-19013523 GGAGGCTGGAGCCAGGGAGCAGG + Intergenic
927128230 2:20033474-20033496 GGAGGGTGGAGAGAGGGAGGTGG + Intronic
927916881 2:26942787-26942809 GGAGGATGTTCCCCGGCAGGGGG - Intronic
927954609 2:27199801-27199823 GGAGGATGGAGACAGTGAGGTGG + Exonic
928210507 2:29320210-29320232 GGAGGATGGACCCCGGAGAGGGG + Intronic
928337849 2:30413453-30413475 GGAGGAGGAAACCAGGGAGGAGG - Intergenic
929210396 2:39350720-39350742 GGAGGATGGACCTAGGGTGGAGG - Intronic
929544299 2:42845761-42845783 GGAAGAGGGATCCAGGGAGGAGG + Intergenic
929558025 2:42937540-42937562 GGAAAATGGCCCCAGGGACGGGG - Intergenic
929776294 2:44933041-44933063 GGAGGAGGGGCCAAGGGAGGCGG - Intergenic
930572724 2:53107421-53107443 GGAGGGTGGAGGGAGGGAGGAGG + Intergenic
930865916 2:56121709-56121731 CAAGGATGGAACAAGGGAGGAGG + Intergenic
930903705 2:56539984-56540006 GGAGGATGGAGGATGGGAGGAGG + Intergenic
931014672 2:57962564-57962586 TGAGGATGGAGGGAGGGAGGAGG - Intronic
931138787 2:59434177-59434199 GGAGGACGGACTGAGTGAGGAGG + Intergenic
931355798 2:61537356-61537378 GGGGGATGGAGGCGGGGAGGCGG - Intronic
931443412 2:62307233-62307255 GGGGGCTGGACACAGAGAGGAGG - Intergenic
931791450 2:65667407-65667429 GGAGAATGGCCTGAGGGAGGTGG + Intergenic
931893215 2:66698748-66698770 GGGGGATGGACGCAAGCAGGGGG - Intergenic
932094988 2:68839488-68839510 TGAGGATGGAGCCTGGGACGAGG + Intergenic
932141382 2:69281195-69281217 GGAGGATTGAGCCCAGGAGGTGG - Intergenic
932198696 2:69806840-69806862 GGAGGATGGAGGGTGGGAGGAGG + Intronic
932514782 2:72334701-72334723 GGAGGAGGGACCCAGAGTAGAGG - Intronic
932703299 2:74004948-74004970 GACAGATGGACTCAGGGAGGGGG + Intronic
932764171 2:74459769-74459791 GGAGGGTGGACACAGGGACCTGG - Intronic
932816341 2:74865169-74865191 GGAGGAGGGCTGCAGGGAGGAGG + Intronic
933165731 2:79072562-79072584 GAGGGAAGGACCCTGGGAGGAGG + Intergenic
933170358 2:79118220-79118242 GGAGGGTGGAACATGGGAGGAGG + Intergenic
933334594 2:80941070-80941092 GAAGGATGGACTGAGGGTGGCGG + Intergenic
933335130 2:80948351-80948373 GGAGGGTGGATCATGGGAGGAGG + Intergenic
933777301 2:85778938-85778960 GGAGGAGGCACCCAGGCTGGTGG - Intronic
933777320 2:85778997-85779019 GGAGGAGGTACCCAGGCTGGAGG - Intronic
933777336 2:85779047-85779069 GGAGGAGGCACCCAGGCTGGAGG - Intronic
934666239 2:96173065-96173087 GGAGGCTTGAATCAGGGAGGCGG - Intergenic
934853614 2:97716090-97716112 GGAGGATGGGACAACGGAGGAGG + Intronic
935888521 2:107649774-107649796 GGAGGATGGAAGCTGGGAGGAGG + Intergenic
936110668 2:109661910-109661932 GGAAGATGGATCTAGGGAAGAGG - Intergenic
936778403 2:116002356-116002378 TGAGGCTGGACACCGGGAGGAGG - Intergenic
936832820 2:116669787-116669809 GGAGGAAGGAGAGAGGGAGGAGG - Intergenic
937012113 2:118572124-118572146 GGAGGGTGGGCCCTGGGAGGGGG + Intergenic
937257527 2:120565584-120565606 TGAGGCTGCACCCAAGGAGGGGG - Intergenic
937677545 2:124608504-124608526 AGAGGATGGAACCATGGAGGAGG - Intronic
937725308 2:125157468-125157490 GGAGGATGGAAGTTGGGAGGAGG - Intergenic
938262471 2:129905657-129905679 GGTGAAGGCACCCAGGGAGGGGG - Intergenic
938640168 2:133269482-133269504 GGAAGATGGTCCCAGGAAGTGGG + Intronic
938763784 2:134446981-134447003 GGAGGAAGGCCCCAGGCAGCTGG + Intronic
938946893 2:136220586-136220608 GGAGGATGGGGCCAGGAAAGAGG + Intergenic
939651633 2:144769840-144769862 ACCGGATGGACCCAGGCAGGAGG - Intergenic
940453723 2:153871844-153871866 GGAGGAGGGACCACGCGAGGAGG + Intergenic
940851717 2:158693392-158693414 GGAAGTTGGCCCAAGGGAGGGGG - Intergenic
940885588 2:158986956-158986978 GGAGGAGGGAACCTGGGACGTGG + Intronic
941159090 2:162015606-162015628 GGAGGAGGGAGCCGGGAAGGTGG - Intronic
941165864 2:162082371-162082393 GGAGAATGGATAGAGGGAGGGGG + Intergenic
942107075 2:172643552-172643574 GGAAGATAGACCTAAGGAGGAGG - Intergenic
942506215 2:176644289-176644311 GGAGGATTCACCTAGGGAGGAGG + Intergenic
942750845 2:179285304-179285326 GGAGGATGTTCTCAGGGATGAGG + Intergenic
942867835 2:180697908-180697930 GGAGGTAGGACCCAGGGATGTGG + Intergenic
943434732 2:187850346-187850368 GGAGGATGGAGGGTGGGAGGAGG + Intergenic
944136558 2:196406048-196406070 GGAGGCTGAGCCCAGAGAGGAGG - Intronic
944830985 2:203534492-203534514 GGGGGGTGGACGGAGGGAGGGGG - Intronic
945275317 2:207982249-207982271 GAAGGAGGGAGCGAGGGAGGGGG - Intronic
945466635 2:210177098-210177120 GGAGGATGGAGGGTGGGAGGAGG - Intergenic
945608988 2:211974368-211974390 GAAGGATGGAAGAAGGGAGGAGG + Intronic
946181328 2:217950861-217950883 GGAGGATGGGCTCGGGGAGATGG - Intronic
946274257 2:218618814-218618836 GCAGGATGGAGTCAGGGTGGGGG + Intronic
947179428 2:227399028-227399050 GGAAGAAGGAGGCAGGGAGGGGG + Intergenic
948280074 2:236740327-236740349 GGAGCAGTGACCGAGGGAGGAGG + Intergenic
948412672 2:237776049-237776071 GGAGGCTTGAACCTGGGAGGTGG - Intronic
948609461 2:239157496-239157518 GGAGGACGGACATGGGGAGGAGG + Intronic
948655730 2:239475744-239475766 GGAGGATGTCCCAAGGGTGGGGG + Intergenic
948784043 2:240341620-240341642 GGAGGAAGCACCCAGGGAGTAGG + Intergenic
948844709 2:240677501-240677523 GGAGGGCAGGCCCAGGGAGGCGG + Intronic
948849151 2:240697378-240697400 GGAGGGCAGGCCCAGGGAGGCGG - Intronic
1168962163 20:1877148-1877170 GGGGGATGGATACAGGGGGGTGG - Intergenic
1168979368 20:1991776-1991798 GCAGGAATGACCCAAGGAGGTGG + Intronic
1169009842 20:2241357-2241379 GGAGGAGGGAGGGAGGGAGGAGG - Intergenic
1169140315 20:3224043-3224065 GCAGCATGGATCCAGGGTGGAGG - Intergenic
1169245237 20:4019705-4019727 GGAGGATGGACAGAGGAATGGGG - Intergenic
1169354786 20:4897364-4897386 GGAGGATGGAAGCAGGGGTGGGG + Intronic
1169415815 20:5415250-5415272 GGAGGATGGCCCCAGACATGAGG + Intergenic
1169501637 20:6166189-6166211 GGATGCTGGAACCCGGGAGGGGG + Intergenic
1170060174 20:12250661-12250683 GGAGGATGGAAGGTGGGAGGAGG - Intergenic
1171209911 20:23309258-23309280 GGAGGAGGGAGACAGAGAGGAGG - Intergenic
1171233855 20:23508971-23508993 CCAGGATGCAGCCAGGGAGGTGG - Intergenic
1171337175 20:24395091-24395113 GGAGGATGATCCCAGGAAGCAGG + Intergenic
1171518733 20:25759649-25759671 GGAGGCTGCACCCTGGGAGATGG + Intergenic
1171558120 20:26096561-26096583 GGAGGCTGCACCCTGGGAGATGG - Intergenic
1172442300 20:34974475-34974497 GGAAGATGCACCCTGGGTGGTGG + Intergenic
1172462279 20:35128477-35128499 GGAGAATTGAACCTGGGAGGCGG + Intronic
1172486138 20:35298821-35298843 GTAGACTGGACCCAGGGAAGAGG - Intergenic
1172522712 20:35578805-35578827 AGAGAAGGGTCCCAGGGAGGGGG - Intergenic
1173669730 20:44790387-44790409 GGAGGAGGTAGCCTGGGAGGAGG - Intronic
1173670195 20:44793557-44793579 GGAGAATGAAGCCAGGGAAGGGG + Intronic
1174049681 20:47759011-47759033 GGAGGATGGGGGCAGGGAAGAGG - Intronic
1174377132 20:50133540-50133562 GGAGGGTGGACCCAGGCCAGGGG + Intronic
1175172015 20:57087277-57087299 GGAGCAAGGCCGCAGGGAGGCGG - Intergenic
1175780392 20:61678770-61678792 GGAGGCTGGAGGCAGGGATGGGG - Intronic
1175793388 20:61756555-61756577 GGGGGAGGGACCCGGGGATGAGG - Intronic
1175797004 20:61778071-61778093 GGAGGGTGGAGGGAGGGAGGTGG - Intronic
1175799911 20:61795712-61795734 GGAGTGTGGACTCAGGAAGGAGG + Intronic
1175975207 20:62707560-62707582 GGAGGAGGGAGCAGGGGAGGGGG + Intergenic
1176053878 20:63134651-63134673 GGAGGCAGGGCCCAGAGAGGAGG + Intergenic
1176053944 20:63134793-63134815 GGAGGCAGGGCCCAGAGAGGAGG + Intergenic
1176054141 20:63135252-63135274 GGAGGCAGGGCCCAGAGAGGAGG + Intergenic
1177235277 21:18381825-18381847 GGAGGATGGGCGGTGGGAGGAGG + Intronic
1178605951 21:34036660-34036682 GGAGGATGCGCCCAAGGGGGAGG + Intergenic
1178892440 21:36531369-36531391 GGAGGCTGGAACCCAGGAGGTGG - Intronic
1179124177 21:38576888-38576910 GGAGGCTGGAGCCTGGAAGGAGG - Intronic
1179354494 21:40646322-40646344 GGAGGCTTGACCCCAGGAGGTGG + Intronic
1179411764 21:41168101-41168123 GGAGGAGGGCCCAGGGGAGGAGG - Exonic
1179534914 21:42045218-42045240 CTAGGATGAGCCCAGGGAGGTGG + Intergenic
1179725310 21:43338579-43338601 AGGGGATGGAGGCAGGGAGGCGG - Intergenic
1179791895 21:43760575-43760597 GGGGGATGGACGCAGGGACCTGG - Exonic
1180017756 21:45098317-45098339 GGAGAGTGGTCCAAGGGAGGAGG - Intronic
1180286434 22:10748890-10748912 GGAGGCTGGAAGAAGGGAGGAGG + Intergenic
1180709595 22:17830853-17830875 GGATGTTGGCCCCAGTGAGGTGG - Intronic
1180944918 22:19687618-19687640 GGGGGAGGAACCCAGGGAAGGGG - Intergenic
1181460483 22:23083256-23083278 GGAGGGTAGACCCAGGCAGAGGG + Intronic
1181474619 22:23160650-23160672 GGAGGCTGGAGCCAGGTGGGAGG + Intronic
1181946923 22:26525315-26525337 GGAGGCTTGAACCTGGGAGGCGG - Intergenic
1182045928 22:27274052-27274074 GGAGGTGGGGGCCAGGGAGGGGG + Intergenic
1182083190 22:27543544-27543566 GGAAGAGGGAGACAGGGAGGAGG - Intergenic
1182251386 22:29003747-29003769 GGAGGCTTGAGCCTGGGAGGTGG + Intronic
1182266511 22:29120043-29120065 TGATGATGGAAACAGGGAGGAGG + Intronic
1182266530 22:29120126-29120148 TGATGATGGAAACAGGGAGGAGG + Intronic
1182266569 22:29120294-29120316 TGATGATGGAAACAGGGAGGAGG + Intronic
1182266576 22:29120323-29120345 TGATGATGGAAACAGGGAGGAGG + Intronic
1182266603 22:29120437-29120459 TGATGATGGAAACAGGGAGGAGG + Intronic
1182266627 22:29120549-29120571 TGACGATGGAAACAGGGAGGAGG + Intronic
1182456210 22:30452333-30452355 GGAGAATCGAACCCGGGAGGCGG - Intronic
1182508149 22:30800269-30800291 GGGGCAGGGACCCAGGGAAGAGG + Intronic
1182518242 22:30871062-30871084 GGGGAGTGAACCCAGGGAGGAGG - Intronic
1182549055 22:31091259-31091281 GGAGGAGGGCCCCAGGGGGCGGG + Exonic
1182638646 22:31749821-31749843 GGCGGAACGACCCAGGGAGAGGG - Intronic
1182664169 22:31945000-31945022 TGAGGCTGGGCCCAGGGTGGGGG + Intronic
1183219730 22:36504850-36504872 GGCGGTTGGAGCCAGGCAGGTGG - Intronic
1183270741 22:36861146-36861168 GGGCGATGGTCCCAGGGAGCAGG - Exonic
1183290259 22:36997647-36997669 GGAGAATGGACATAGGGAGATGG - Intronic
1183291188 22:37002897-37002919 GGAGGAGAGAGCCTGGGAGGTGG - Intronic
1183340474 22:37277837-37277859 GGAAGCTGGATCCAGGAAGGAGG - Intergenic
1183456276 22:37924905-37924927 GGAGCAGGGACCTGGGGAGGGGG - Intronic
1183483004 22:38075170-38075192 GGAGGACGGAGCCTGGGAGCGGG + Exonic
1184332028 22:43833398-43833420 GGCTGAGGGACCCAGGAAGGCGG - Intronic
1184470299 22:44692253-44692275 GGAGGAGGAGCCCCGGGAGGAGG - Intronic
1184470321 22:44692312-44692334 GGAGGAGGAGCCCCGGGAGGAGG - Intronic
1184470339 22:44692355-44692377 GGAGGAGGAGCCCTGGGAGGAGG - Intronic
1184470426 22:44692574-44692596 GGAGGAGGAGCCCCGGGAGGAGG - Intronic
1184585157 22:45442809-45442831 CGAGGATGGGGCCAGGGAGTGGG - Intergenic
1184615294 22:45633940-45633962 GGAGGCTTGAACCCGGGAGGCGG - Intergenic
1184636495 22:45836406-45836428 GGAGGCAGGAGACAGGGAGGGGG - Intronic
1185021425 22:48378858-48378880 GGAGCATCGTCCCAGGGCGGTGG - Intergenic
1185072878 22:48666922-48666944 GGAGGAGGGACTGAGGGAGTGGG + Intronic
1185299277 22:50071193-50071215 GGAGGCTTGAACCTGGGAGGTGG - Intronic
1185345457 22:50308677-50308699 GGAGGGGTGACCCAGGGTGGGGG - Intergenic
1185418888 22:50724256-50724278 GGAGGATGAACTCAGAGAAGGGG - Intergenic
949244525 3:1910456-1910478 GGAGTCTGGACCCAGGGCTGGGG - Intergenic
949931963 3:9085808-9085830 GGAGGATGGATGGTGGGAGGAGG + Intronic
950135907 3:10580636-10580658 GGAGCAGGGAGACAGGGAGGGGG - Intronic
950248672 3:11445526-11445548 GGAGGATGGAGGGTGGGAGGAGG + Intronic
950590737 3:13934474-13934496 GGAGGACGAACCCAAGGACGGGG + Intergenic
950644225 3:14367527-14367549 GGAGGAAGGAGCAAGGGAGGAGG + Intergenic
950711927 3:14819293-14819315 GGAGGATGAACCCAAGGACGAGG + Exonic
952092918 3:29912053-29912075 GAAGGATGGATGCAGGGATGCGG + Intronic
952165102 3:30739323-30739345 GGAGGATGGGCACAGGAAGGAGG - Intronic
952342778 3:32459616-32459638 GAAGGATGCACCCATGGGGGAGG + Intronic
952659650 3:35830139-35830161 GAAGGAGGGAGCAAGGGAGGTGG - Intergenic
952693411 3:36237099-36237121 AGAGGAGGGAGACAGGGAGGGGG + Intergenic
952881972 3:37991095-37991117 GGAGGATGGGGCCAGGGTTGGGG - Intronic
952998877 3:38912245-38912267 AGAGGGTGCACCCAGAGAGGAGG - Intronic
953039493 3:39242692-39242714 GGAGGATGGAGGGTGGGAGGAGG + Intergenic
953325969 3:42013186-42013208 GGAGGATGGAGCCGGGGACGGGG - Intergenic
953618137 3:44510454-44510476 GGAGGCTGCACCCGGGGCGGGGG - Intronic
953907240 3:46874516-46874538 GGAGGAGGGGGCCAGGAAGGAGG - Intronic
954103745 3:48398070-48398092 GGAGGCTGAACCCAGGGAGATGG - Intronic
954462972 3:50638218-50638240 GGAGGAGAGAACCAGGCAGGGGG + Intronic
956587173 3:70877133-70877155 GTGGGATGGGCCCACGGAGGAGG + Intergenic
956659605 3:71584188-71584210 GGGGGAGGGATCCAGGGAGGGGG + Intergenic
958551495 3:95619521-95619543 TGAGGATGGAGGGAGGGAGGAGG + Intergenic
958756143 3:98251384-98251406 GGAGGATGGAGGGTGGGAGGAGG + Intergenic
959425643 3:106184625-106184647 GGAGGCTAGACCCAGTGAGATGG - Intergenic
959591311 3:108084893-108084915 TGAGGATGGAGGCAGGGAGCTGG - Intronic
959922654 3:111885376-111885398 GGAGGAAAGACTCAGGGAGCAGG + Exonic
960224031 3:115148157-115148179 GGAGGCTGGATCCCGGGCGGTGG + Intergenic
960595119 3:119401333-119401355 GGCAGATGGACCCAGACAGGGGG - Intronic
961329335 3:126129474-126129496 TGAGGGTGGACCCAGGGCTGGGG + Intronic
961381727 3:126500000-126500022 AGAGGCTGGGCCCAGGGTGGTGG + Intronic
961404989 3:126672397-126672419 GGAGGATGGACCCCTGGGGCTGG + Intergenic
961432295 3:126891670-126891692 GGAGGCTGGAACCAGGGTTGAGG + Intronic
961656840 3:128447338-128447360 GGAGGAGGGAGCCAGTGAAGGGG - Intergenic
961695006 3:128698462-128698484 GGGGGAGGGTCCCAGGCAGGTGG - Intergenic
961997513 3:131261585-131261607 GGAAGTGAGACCCAGGGAGGTGG + Intronic
962612486 3:137091298-137091320 AGAGGATGGAGGCTGGGAGGAGG - Intergenic
962905187 3:139794867-139794889 GAAGGATGGGACCAGGGAGGGGG + Intergenic
964097216 3:152946371-152946393 GGAGAATTGAACCTGGGAGGTGG - Intergenic
964397749 3:156265404-156265426 GCAGCATTGACCCAGGGATGGGG - Intronic
964431103 3:156606485-156606507 GGAGGAGAGACCCAGGGCAGAGG + Intergenic
965401490 3:168218153-168218175 GGAGGTGGGACCCAAGGAAGAGG + Intergenic
966793649 3:183694997-183695019 GGAGGCTTGAACCTGGGAGGTGG - Intergenic
966893954 3:184428334-184428356 GCAGGCTGGTCCCAGTGAGGTGG - Intronic
967199833 3:187063237-187063259 GGAGGATGAACCCCAGCAGGCGG + Intronic
967271640 3:187737970-187737992 CGGGGATTCACCCAGGGAGGCGG + Intronic
967574707 3:191076752-191076774 GGAGGTTGCACCCAGTGATGAGG - Intergenic
967768942 3:193312931-193312953 GGTGGAGGGACCCAGAGAGGAGG + Intronic
967833673 3:193943239-193943261 GGAGGAGGGACCAAGGGCCGAGG - Intergenic
967847826 3:194058181-194058203 GAAGGACCCACCCAGGGAGGAGG + Intergenic
967959061 3:194904996-194905018 GGAGGGTGGACGGTGGGAGGAGG - Intergenic
968242452 3:197102769-197102791 GGAGGCTTGAACCTGGGAGGCGG + Intronic
968318998 3:197749457-197749479 GGAGGAGCGTGCCAGGGAGGGGG + Intronic
968473408 4:792053-792075 GGAGTGAGGACTCAGGGAGGGGG - Intronic
968479212 4:826301-826323 GGGGGGTGGACCCGGGGCGGGGG + Intergenic
968479267 4:826387-826409 GGGGGGTGGACCCGGGGCGGGGG + Intergenic
968479310 4:826454-826476 GGGGGGTGGACCCGGGGCGGGGG + Intergenic
968661389 4:1800186-1800208 GGTGGATGGACCCGGGGTGAGGG + Intronic
968678416 4:1898571-1898593 GGAGAATTGAACCCGGGAGGTGG + Intronic
968705915 4:2077435-2077457 GCAGGCTGCCCCCAGGGAGGGGG + Intronic
968743023 4:2340802-2340824 GCAGGGTGGACACAGGGACGGGG + Intronic
968746198 4:2361892-2361914 GGAGGATGGGAGCAGGCAGGTGG + Intronic
968973197 4:3807086-3807108 GGAGGAGGGAGGGAGGGAGGAGG - Intergenic
969090159 4:4688067-4688089 GGAGCGTGGAGCCAGGGAGGAGG - Intergenic
969243148 4:5915167-5915189 GGCAGGTGGACCCAGGAAGGGGG - Intronic
969455584 4:7298036-7298058 GGAGGACGGACCTGGGGAAGAGG - Intronic
970522402 4:16898816-16898838 GGAGGAGGGAGGGAGGGAGGGGG + Intergenic
970628161 4:17912655-17912677 GGAGAATGGCCTGAGGGAGGTGG + Intronic
971588979 4:28442541-28442563 GGAGGATGGAGGGTGGGAGGAGG + Intergenic
971683027 4:29726106-29726128 GGAGGCTCGAACCTGGGAGGCGG - Intergenic
971800635 4:31285702-31285724 TGAGGATGGACTCAAAGAGGAGG + Intergenic
972246860 4:37254048-37254070 GGAGGGTGGAGACTGGGAGGAGG + Intronic
972368268 4:38396123-38396145 GGAGGAAGGACTCAGGCAAGAGG - Intergenic
972642508 4:40938399-40938421 TGAGGCTGGACCCAGTAAGGAGG + Intronic
973093181 4:46163973-46163995 GGAGGGTGGAGGCTGGGAGGAGG + Intergenic
973710853 4:53629257-53629279 GGTGGCTGGAGACAGGGAGGAGG - Intronic
975094525 4:70442562-70442584 GTAGGATGAACCCAAGGAAGAGG + Intronic
976092550 4:81472924-81472946 GGGGGAGGGACCCATGGAGCAGG - Intronic
977248463 4:94661304-94661326 GGAGGCTTGAGCCAAGGAGGTGG + Intronic
977734307 4:100394444-100394466 GGAGAATGGAACCAGGGAGGAGG - Intergenic
978400913 4:108329670-108329692 GGAGGAGGGAGGGAGGGAGGGGG + Intergenic
978760833 4:112355563-112355585 GGTGGCTGGGCCTAGGGAGGTGG + Intronic
979152776 4:117341492-117341514 GGAGGTCAGACCCAGTGAGGAGG + Intergenic
980453612 4:133009623-133009645 GGGGAATTGAACCAGGGAGGTGG - Intergenic
981117655 4:141010777-141010799 AGAAGATGGACCCAGGGAGGAGG + Intronic
982148440 4:152425265-152425287 GGAAGATGGACTCAGAGATGAGG - Intronic
982327280 4:154141349-154141371 GCATGATAGACCCAGGGAAGAGG + Intergenic
982358251 4:154491832-154491854 GGAGGAGGGAGAGAGGGAGGGGG + Intergenic
982426176 4:155264123-155264145 GGAGGATGGAGAATGGGAGGAGG - Intergenic
983248091 4:165311779-165311801 GGAGGAGGGATAAAGGGAGGGGG - Intronic
983746412 4:171205541-171205563 GGAGGATGGAGTGTGGGAGGAGG + Intergenic
983753219 4:171302133-171302155 GGAGGATGGAGAGTGGGAGGAGG - Intergenic
984702227 4:182825763-182825785 GGAGGAGGGAAACAAGGAGGTGG - Intergenic
984888976 4:184474635-184474657 GGAGGAAGGGCGGAGGGAGGAGG - Intergenic
985092400 4:186377811-186377833 GGAGGGTGGAGGGAGGGAGGAGG - Intergenic
985714586 5:1448227-1448249 GGAGGCAGCACCCAAGGAGGGGG - Intergenic
985993783 5:3584942-3584964 GGAGGAAGGAAGGAGGGAGGAGG + Intergenic
985993827 5:3585117-3585139 GGAGGAAGGAAAGAGGGAGGCGG + Intergenic
985993841 5:3585167-3585189 GGAGGAAGGAAGGAGGGAGGAGG + Intergenic
986078461 5:4363266-4363288 GGAGGAGGGAGGGAGGGAGGAGG - Intergenic
986197917 5:5554941-5554963 GGAGGATGGAAGTTGGGAGGAGG - Intergenic
986367197 5:7044239-7044261 CAAGCATGGACCCAGGAAGGAGG - Intergenic
986418935 5:7557518-7557540 GGAGGATGGAGGGTGGGAGGAGG - Intronic
987256507 5:16158891-16158913 CATGGATGGACACAGGGAGGGGG - Intronic
987806490 5:22775841-22775863 GTGGGAGGGACCCAGGGGGGAGG + Intronic
988653529 5:33181148-33181170 GGGGGAAGGGCCCAGGAAGGTGG + Intergenic
988736830 5:34030931-34030953 GGAGGATGGAAGGTGGGAGGAGG + Intronic
988925981 5:35991413-35991435 GGAGCATGCACCCAGGGAGGAGG - Exonic
989123442 5:38027561-38027583 GGAGGTTGGAGACGGGGAGGTGG - Intergenic
989206968 5:38819165-38819187 GGAGGATGGAAGGTGGGAGGAGG + Intergenic
989260633 5:39416106-39416128 GGAGGAGGAACTCAGGGTGGCGG - Intronic
990024275 5:51166237-51166259 GGAGGATGGATGGTGGGAGGAGG + Intergenic
991134273 5:63163087-63163109 GGAGGGTGGAACGTGGGAGGAGG - Intergenic
991186083 5:63809584-63809606 GGAGGCTGGAGGCTGGGAGGAGG - Intergenic
991970149 5:72133048-72133070 GGACCATGGACCCAGGGTGGAGG - Intronic
992071204 5:73151048-73151070 GGAGGGTGGAGCCAGTGAAGGGG + Intergenic
992152083 5:73914810-73914832 GGTGGATGGAGCCCAGGAGGTGG - Intronic
992436304 5:76759025-76759047 GGAGGACGGAACCAGAGAGAGGG - Intergenic
992444893 5:76824416-76824438 GGAGGCTTGAACCTGGGAGGCGG - Intronic
992757276 5:79919725-79919747 GGAGGATGGAGAGTGGGAGGAGG + Intergenic
992971256 5:82060772-82060794 GGAGAATTGAGCCTGGGAGGTGG + Intronic
993095416 5:83473610-83473632 GGAGGGAGGAGCGAGGGAGGCGG + Intronic
993347060 5:86797486-86797508 GGAGGATGGAGTGTGGGAGGAGG - Intergenic
993924268 5:93846214-93846236 GGAGGCTGGGCCCAGTGTGGTGG + Intronic
994721676 5:103387516-103387538 TGAGGATGGAGGCTGGGAGGAGG - Intergenic
994804633 5:104428494-104428516 GGGGGTTGTACCCAGGGAGAGGG + Intergenic
994842614 5:104946087-104946109 GGAGGGTGGACAGTGGGAGGAGG - Intergenic
995708876 5:115014629-115014651 AGAGGATGGACACAGGGAAGAGG - Intergenic
997271397 5:132541241-132541263 GGAGCAGGGACACAGGCAGGAGG - Intergenic
997585151 5:135039537-135039559 GGTGGAGGGGCGCAGGGAGGTGG - Intronic
998049484 5:139020073-139020095 GGAGGTGAGACCAAGGGAGGTGG + Intronic
998388245 5:141770806-141770828 GTAGGAGGGTGCCAGGGAGGAGG - Intergenic
998706849 5:144771894-144771916 GGAGGATGGAGGCAGGGTGAAGG + Intergenic
999145561 5:149391055-149391077 GGAGGCTTGAACCTGGGAGGTGG - Intronic
999383039 5:151135062-151135084 GGAGGATGCACAAAGGGAAGAGG + Intronic
999410627 5:151346847-151346869 GCAGGAAGGAGGCAGGGAGGAGG + Intronic
999538678 5:152548081-152548103 GGAGAATGGGCCCAGGGTGTGGG - Intergenic
999672400 5:153969179-153969201 GGAGGATGCAACCACGGAGAAGG - Intergenic
999731589 5:154479579-154479601 GAATGAGGGACCCAGGTAGGTGG - Intergenic
1000160267 5:158590549-158590571 GGAGTATGGACCAAGTTAGGGGG - Intergenic
1000509675 5:162165451-162165473 GGAGGACCTACCCAGTGAGGAGG - Intergenic
1001460450 5:171908269-171908291 GAGGGAGGGATCCAGGGAGGGGG - Intronic
1001793580 5:174483004-174483026 GGAGGAAGGAACCATGGAGATGG - Intergenic
1001858359 5:175032227-175032249 GGAGGAGAGTGCCAGGGAGGGGG - Intergenic
1001898897 5:175406174-175406196 GGAGGGTGGACGGTGGGAGGAGG - Intergenic
1002276436 5:178107132-178107154 GGTGGGGGGACCCAGGGAAGAGG + Intergenic
1002468471 5:179420515-179420537 GGACAATGGCACCAGGGAGGGGG - Intergenic
1002599672 5:180347052-180347074 AGGGGATGGACCCAGCCAGGTGG + Intronic
1002924842 6:1599357-1599379 GGAGAAGGGACAGAGGGAGGAGG - Intergenic
1003065435 6:2900971-2900993 GGAGAATGGGGTCAGGGAGGAGG + Intronic
1003071985 6:2951989-2952011 GGGCGATGATCCCAGGGAGGCGG - Intronic
1003102035 6:3184022-3184044 GGAGGACTGACCCAGGGAGAAGG - Intergenic
1003869654 6:10391369-10391391 GCAGGTGGGACCCAGTGAGGGGG + Intergenic
1005286742 6:24335868-24335890 GGAGGGTGGGACCAGGTAGGAGG - Intronic
1006014701 6:31070989-31071011 GGAAGAAGCACCCAAGGAGGAGG + Intergenic
1006057225 6:31394200-31394222 AGAGGATGGCCCTGGGGAGGAGG + Intergenic
1006098453 6:31670879-31670901 GGAGCATGGTCACAGGAAGGTGG + Exonic
1006525035 6:34597003-34597025 GGAGGATGTATGGAGGGAGGAGG - Intronic
1006579286 6:35067305-35067327 GGTGCATGGGCCCAGAGAGGAGG - Intronic
1007013781 6:38442381-38442403 GGAGGCTTGAACCTGGGAGGCGG + Intronic
1007340952 6:41191384-41191406 GGAGGACTGGCCCAGGCAGGGGG - Exonic
1007384736 6:41512957-41512979 GGAGGTTGAACCTGGGGAGGTGG + Intergenic
1008223880 6:48887868-48887890 GGAGGGTAGAAGCAGGGAGGAGG + Intergenic
1008323976 6:50154303-50154325 GGAGGGTGGATGGAGGGAGGAGG - Intergenic
1008331892 6:50255284-50255306 GGAGGATGGAGGGTGGGAGGAGG - Intergenic
1009593675 6:65708610-65708632 AGAGGAGGGACACAGGGAGGGGG - Intergenic
1011527216 6:88277879-88277901 GGAGCATGATCCCAGGGAGAGGG + Intergenic
1011569573 6:88720454-88720476 GGAGAATGTTCCCAGAGAGGTGG - Intronic
1011715875 6:90104665-90104687 GGAGGAAGGACCGAGGGAAAGGG - Intronic
1012429926 6:99153585-99153607 GGAGAATGGAAGCAGGCAGGTGG + Intergenic
1012556912 6:100524784-100524806 GGAGGAAGGATAAAGGGAGGAGG - Intronic
1012741156 6:103018251-103018273 GGAGGACCCACCCAGTGAGGAGG + Intergenic
1012901627 6:105013100-105013122 GGAGAATCGAACCTGGGAGGTGG - Intronic
1013176872 6:107685340-107685362 GGAGGATGGACAGAGGAAGGTGG + Intergenic
1013208729 6:107967961-107967983 GGAGGAAGGAACCAGGAAGCAGG - Intergenic
1013832086 6:114285289-114285311 GGAGGATGGAGGGTGGGAGGAGG + Intronic
1013915148 6:115328387-115328409 GGAGGCTGGAGCATGGGAGGAGG - Intergenic
1014350917 6:120344326-120344348 GGAAGCTGGAAGCAGGGAGGGGG + Intergenic
1014928016 6:127297908-127297930 GGAGCATGGACGCAAGGGGGAGG - Intronic
1014946577 6:127505516-127505538 AGAGGATGGAGCGTGGGAGGAGG + Intronic
1015909905 6:138160565-138160587 GGAGCAAGGGCCCAGGGAGGAGG - Intergenic
1017019813 6:150130981-150131003 GGAGTATGCACCTGGGGAGGTGG + Intergenic
1017074141 6:150601650-150601672 TGAGGATGAAGCCAGGGAGGTGG - Intronic
1017151945 6:151288423-151288445 GCAGGTTGAACCCCGGGAGGCGG + Intronic
1017280769 6:152622411-152622433 GGAGGGTGGAGGCTGGGAGGAGG - Intronic
1017726324 6:157278464-157278486 AGAGGATGGACCCAGGGCAAAGG - Intergenic
1017944968 6:159088939-159088961 TGAGGATTGAACCCGGGAGGCGG - Intergenic
1018089604 6:160334229-160334251 GGATGGTGGAGCCAGGCAGGAGG - Intergenic
1018367082 6:163131412-163131434 TGAAGATGGACGCAGAGAGGGGG + Intronic
1018378975 6:163240539-163240561 GGAGGAGGGGACCAAGGAGGTGG - Intronic
1018960958 6:168448317-168448339 GGAGGATGGCACTGGGGAGGAGG + Intronic
1018960964 6:168448335-168448357 GGAGGATGGCGCTGGGGAGGAGG + Intronic
1018960970 6:168448353-168448375 GGAGGATGGAGATGGGGAGGAGG + Intronic
1019327607 7:446007-446029 GGAGGAGGGAGAGAGGGAGGAGG + Intergenic
1019366020 7:633370-633392 GGAGACGGGACCCAGGAAGGCGG + Intronic
1019374481 7:682047-682069 GGAGGAAGGAAGAAGGGAGGAGG + Intronic
1019404923 7:877953-877975 GGAGGAGGGAGGCAGGGAGGTGG - Intronic
1019625243 7:2012598-2012620 GGAGGATGGACAGAGGGGGCAGG + Intronic
1020103258 7:5407363-5407385 GGGGGCTGGCCCCAGGGAGGAGG + Intronic
1020702221 7:11498401-11498423 GGAGGTTCCACCCAGTGAGGAGG - Intronic
1022286432 7:28958683-28958705 GGAGGACAGACCCCGGCAGGGGG + Intergenic
1022599048 7:31739060-31739082 TGAGGATGGAAACAGGCAGGTGG - Intergenic
1023241385 7:38151362-38151384 GGAGGAGGGCTCCAGTGAGGTGG + Intergenic
1023758842 7:43444960-43444982 GAAGGATGGGCTCAGCGAGGTGG + Exonic
1023845082 7:44116026-44116048 GGAGGGAGGGCCCAGGAAGGTGG - Intronic
1023873438 7:44274749-44274771 GCAGGAAGGACCAGGGGAGGGGG + Intronic
1024629695 7:51236854-51236876 GGAGGATGGAGACAGGGCAGAGG - Intronic
1024795323 7:53012719-53012741 GGAGGCACGACCCAGTGAGGAGG + Intergenic
1025299656 7:57808399-57808421 GGAAAAGGGACCCAGGGAGATGG - Intergenic
1026010145 7:66629508-66629530 GGAGGGTGGGCCGTGGGAGGGGG + Intronic
1027141635 7:75661804-75661826 GGAGGATGGGCAGTGGGAGGTGG + Intronic
1027490022 7:78812005-78812027 GGAGAATGGAGGCAGGGATGAGG + Intronic
1027576290 7:79934902-79934924 GCTGGAAGGACCCAGTGAGGAGG + Intergenic
1027679882 7:81206529-81206551 GGAGGAATTAGCCAGGGAGGAGG + Intergenic
1029374119 7:100167732-100167754 GGTGTATGAACCCAGGCAGGAGG + Intronic
1029409444 7:100399403-100399425 GGGGCACGGACCCAGGTAGGGGG - Intronic
1029448847 7:100629413-100629435 GGAGGATGCCCCCAGGGTGCAGG - Intronic
1029526022 7:101094560-101094582 AGAGGCAGGAGCCAGGGAGGAGG + Intergenic
1030326728 7:108227580-108227602 GGATGAAGGATGCAGGGAGGTGG + Intronic
1030963183 7:115952986-115953008 GGAGGATGGACCCAGGGAGGTGG - Intronic
1031036836 7:116796720-116796742 GGAGGCTTGAGCCTGGGAGGTGG - Intronic
1031523672 7:122797712-122797734 GCAGGGTGGAGGCAGGGAGGAGG + Intronic
1032076582 7:128838898-128838920 GGATGGAGGACTCAGGGAGGGGG - Intronic
1032406781 7:131661804-131661826 GGAGGCTCGAAGCAGGGAGGGGG + Intergenic
1032845149 7:135745750-135745772 GGAGGATGGACACGGGGTAGTGG + Intronic
1033030830 7:137824701-137824723 GGAGGGTGGAGGCGGGGAGGAGG - Intronic
1033150857 7:138913940-138913962 GGAGGAGGGAGACAGGAAGGAGG + Intronic
1033227422 7:139572872-139572894 AGAGAATGGCCCGAGGGAGGAGG - Exonic
1033815136 7:145061798-145061820 GGAGGATGAACAAAGGGAAGAGG - Intergenic
1034264179 7:149773313-149773335 GGAGGAGGGACCGAGGGAGCGGG + Exonic
1034531296 7:151697719-151697741 GGGGTGTGGACGCAGGGAGGAGG + Intronic
1034570460 7:151951602-151951624 TGAGGATGGACCCATGCTGGTGG + Intergenic
1034972701 7:155428929-155428951 GGTGGGGGGACCCAGAGAGGAGG + Intergenic
1035004414 7:155644622-155644644 GGATGATGGAGGCCGGGAGGCGG - Intronic
1035260665 7:157659450-157659472 GGAGGATGGTCACAGGGATGGGG + Intronic
1035479920 7:159173746-159173768 GGAGGAAGGAACCAGAGATGTGG - Intergenic
1035673066 8:1434840-1434862 GGAGGAAGGATGAAGGGAGGAGG - Intergenic
1035675453 8:1452587-1452609 GGAGGCAGGACACAGGGAAGAGG + Intergenic
1036215589 8:6877403-6877425 GGAGGCTGCACCCAGTGACGTGG + Intronic
1036571136 8:9980559-9980581 GGAGGAGGGATTGAGGGAGGAGG - Intergenic
1036648221 8:10625401-10625423 GGAGGAAAGACACAGGGAAGAGG + Intronic
1037226000 8:16590692-16590714 GGAGGATGGAGGGTGGGAGGAGG + Intergenic
1037899507 8:22679204-22679226 GGAGGATGGAGCGAGAGAGCTGG + Intergenic
1037946994 8:22995946-22995968 GGAGGATGGACTGAGCCAGGCGG + Intronic
1037952505 8:23028205-23028227 GGAGGATAGAGCCAGGCTGGAGG + Intronic
1038177623 8:25195427-25195449 GGAAGGTGGAAGCAGGGAGGTGG - Intronic
1038532446 8:28329315-28329337 GGAGGAGGTAGTCAGGGAGGAGG - Intronic
1039025381 8:33252738-33252760 GGAGGCTCCACCCAGTGAGGAGG + Intergenic
1039138119 8:34350506-34350528 GGAGGTTGCAACCTGGGAGGCGG + Intergenic
1039568163 8:38565582-38565604 GCAGGAAGGAGGCAGGGAGGAGG - Intergenic
1040385795 8:46914235-46914257 TGAGGCTGGCCTCAGGGAGGAGG + Intergenic
1040549686 8:48428544-48428566 GGAGGGTGAACCAAGGAAGGAGG + Intergenic
1042020853 8:64370446-64370468 GGAGGAAGGACACAAAGAGGAGG + Intergenic
1042777159 8:72445419-72445441 GGAGGATTGAGCCAAGGAGTTGG + Intergenic
1042866688 8:73362776-73362798 GGAAAATGGAGCCAGGTAGGGGG + Intergenic
1044588416 8:93890071-93890093 GGAGGAAGGACCAGGGGAGGAGG - Intronic
1044915347 8:97107526-97107548 GGAAGATGGACCCAGAGAAGAGG + Intronic
1045052613 8:98340775-98340797 GGAGGACAGACCCATGGAGGAGG + Intergenic
1045344096 8:101279236-101279258 GGAGGAGGGAGGAAGGGAGGGGG + Intergenic
1045430978 8:102114801-102114823 GGAGAAGGGAGCCAGGGATGTGG + Intronic
1046388059 8:113529185-113529207 GGAGGTGGGACCCAGTGAGGAGG - Intergenic
1047673292 8:127172158-127172180 GGAGGATAGACACAGGGTTGAGG + Intergenic
1048292742 8:133192897-133192919 TGTGGAGGGACCCAGGGAGCAGG + Intronic
1048325256 8:133434213-133434235 AGAGGCTGGGACCAGGGAGGAGG + Intergenic
1048436082 8:134419163-134419185 GGAGGATGGACAGTGGGAGGAGG + Intergenic
1048783549 8:138026744-138026766 GGAGCAAGGACCCAGGCATGGGG - Intergenic
1049048748 8:140174220-140174242 GGAGGATGGAGGGTGGGAGGAGG + Intronic
1049125558 8:140784076-140784098 GGAGGCTTGAACCTGGGAGGCGG + Intronic
1049300389 8:141866615-141866637 GGGGGATCGTCCCTGGGAGGAGG + Intergenic
1049311788 8:141937404-141937426 GGAGGAGGGAGGGAGGGAGGTGG - Intergenic
1049443685 8:142620401-142620423 GGAGGCATGACCCTGGGAGGGGG + Intergenic
1049452010 8:142666984-142667006 GGTGGAGGGATGCAGGGAGGAGG + Intronic
1049482919 8:142835270-142835292 GGAGGGGGGCCCCAGGGAAGCGG - Intronic
1049720263 8:144112348-144112370 GGGTGAGGGACCCAGGCAGGTGG + Exonic
1050003567 9:1103782-1103804 GGAGGATGGAGGGTGGGAGGAGG - Intergenic
1050311253 9:4355042-4355064 GGAGGCTTGAACCCGGGAGGCGG + Intergenic
1050394232 9:5178204-5178226 GGAGGTCTCACCCAGGGAGGAGG - Intronic
1050507001 9:6358771-6358793 GGGGGTTGGACCTAGGGAAGAGG - Intergenic
1051325573 9:15963970-15963992 GGAGGATGGAGCAAAGAAGGAGG - Intronic
1051711210 9:19933059-19933081 GGAGGATGGACTTGGGGAAGAGG + Intergenic
1052109494 9:24563445-24563467 AGAGGATGGACAGTGGGAGGAGG - Intergenic
1053139562 9:35674163-35674185 AGAGGATTCACCCAGAGAGGAGG + Exonic
1053139567 9:35674181-35674203 GGAGGATCCACCCGGAGAGGAGG + Exonic
1053149308 9:35732599-35732621 GGAGAATTGAGCCTGGGAGGCGG + Exonic
1053280842 9:36819087-36819109 GGAGGGGGGACGCGGGGAGGGGG - Intergenic
1055278634 9:74648690-74648712 GGAGGATGGACGGAGAGAAGAGG - Intronic
1055517670 9:77049512-77049534 GGAGGCTTGAACCCGGGAGGTGG + Intergenic
1055611385 9:78029506-78029528 GGGGAATGAAGCCAGGGAGGAGG - Intronic
1055720792 9:79171895-79171917 GGAGGATGGCCCCTTGGTGGAGG + Intergenic
1056197258 9:84240626-84240648 GCAGGCTGGCCCCAGGGTGGAGG + Intergenic
1056591198 9:87967378-87967400 GGAGGGTGAAGCCAGGCAGGTGG + Exonic
1056612279 9:88132932-88132954 GTAGGAAGGACGCAGGGAAGGGG + Intergenic
1056691637 9:88813214-88813236 GGAGGAGGGACCACAGGAGGAGG + Intergenic
1056965259 9:91159840-91159862 GGAGGACGGACGCAGTGGGGAGG - Intergenic
1057476297 9:95405755-95405777 TGAGGATGAACCCAGGGATTTGG - Intergenic
1057554711 9:96078466-96078488 AGAAGATGGATCCAGGGAAGCGG - Intergenic
1057798159 9:98172721-98172743 GGAGGCTGGAAGCAGAGAGGAGG - Exonic
1057831368 9:98409652-98409674 GCAGGTTGCCCCCAGGGAGGGGG - Intronic
1058193783 9:101950539-101950561 GGAGAAAGGACTCAGGGAAGAGG - Intergenic
1058985874 9:110207926-110207948 GGAAGATGGAGACAGGCAGGAGG + Exonic
1059018127 9:110544016-110544038 GATGGTTGGACCCAGGAAGGGGG + Intronic
1059123446 9:111662029-111662051 GGAGGGTGGACCCAGGGCTGGGG + Intronic
1059462584 9:114443498-114443520 GAAGGAGGGAACCAGAGAGGTGG - Intronic
1059769930 9:117415134-117415156 GGCGGCTGGGCCCCGGGAGGCGG - Intergenic
1060027886 9:120188327-120188349 GGAGCAAGAGCCCAGGGAGGAGG - Intergenic
1060549028 9:124476550-124476572 GGCTGAAGGGCCCAGGGAGGGGG + Intronic
1060822433 9:126669244-126669266 GGAGGGTGGAGACAGGGATGAGG + Intronic
1060852476 9:126889119-126889141 GGACGCTTGAACCAGGGAGGCGG + Intergenic
1060868832 9:127022707-127022729 GGAGGAGGGTCCCAGGCAGAAGG - Intronic
1060967654 9:127720834-127720856 GGAGGAGGGAGGAAGGGAGGAGG - Intronic
1060978679 9:127780001-127780023 GGAGAATTGAACCAGGGAGGCGG + Intergenic
1061000314 9:127899080-127899102 GGAGGAGGGCTCCAGGGAGAAGG + Intronic
1061097177 9:128465129-128465151 GGTGGAAGGTCCCAGAGAGGTGG + Intronic
1061103387 9:128510142-128510164 GGTGGATTGAGCCTGGGAGGTGG - Intronic
1061242581 9:129383129-129383151 GGAGGGTGGGGGCAGGGAGGCGG + Intergenic
1061243919 9:129391482-129391504 GGAGAAGGGATCCTGGGAGGAGG - Intergenic
1061303766 9:129721213-129721235 GGAGGGTGGACACAGGGCGCTGG - Intronic
1061360005 9:130135347-130135369 GGAGGGCGGGCACAGGGAGGAGG + Exonic
1061546933 9:131309800-131309822 GGTGGAGGGAGCCAGGAAGGAGG + Intergenic
1061603649 9:131690703-131690725 AGAGGTGGGACCCTGGGAGGTGG + Intronic
1061864334 9:133484801-133484823 CGAGGAAGGCCCCAGGGGGGTGG + Intergenic
1061900832 9:133671170-133671192 GAAGAATGGAGCCAGGGAGCAGG - Intronic
1061994587 9:134177160-134177182 AGAGGAGGGACACAGGGAGGAGG - Intergenic
1061994655 9:134177391-134177413 AGAGGAGGGACACGGGGAGGAGG - Intergenic
1061994701 9:134177523-134177545 GGAGGAGAGACACGGGGAGGAGG - Intergenic
1062050649 9:134444795-134444817 GGAGGAAGGAGGGAGGGAGGGGG - Intergenic
1062109449 9:134773960-134773982 AGAGGCTGTGCCCAGGGAGGAGG - Intronic
1062137696 9:134938375-134938397 GGCCTACGGACCCAGGGAGGGGG + Intergenic
1062179573 9:135184050-135184072 GGAGGAGGGGCCCAGGGCAGAGG + Intergenic
1062233781 9:135498463-135498485 GAGGGGTGCACCCAGGGAGGAGG - Intronic
1062278266 9:135740724-135740746 GGTGGGTGGGCCCAGGGATGAGG + Intronic
1062284870 9:135768417-135768439 GGAGGATGGAAGGCGGGAGGAGG - Intronic
1062291762 9:135798495-135798517 GGAGGGTGTCCTCAGGGAGGAGG - Intergenic
1062375063 9:136258351-136258373 CGAGGATGGACACTGGGTGGGGG + Intergenic
1062440751 9:136568232-136568254 AGCGGATGGGACCAGGGAGGGGG + Intergenic
1062500000 9:136848217-136848239 AGAGGAAGGACCAAGGGACGGGG + Exonic
1062576727 9:137212317-137212339 GGATGATGGGCACCGGGAGGAGG - Intronic
1062609896 9:137369049-137369071 GGACGCAGGACCCGGGGAGGGGG + Intronic
1203732793 Un_GL000216v2:106055-106077 GGAGGCTGGAAGAAGGGAGGAGG + Intergenic
1185470915 X:382507-382529 GGGGGCAGGACCAAGGGAGGCGG - Intronic
1185500483 X:593362-593384 AGAGGATGGACCGGGGGCGGTGG - Intergenic
1185612789 X:1402426-1402448 GGAGGCTGCATTCAGGGAGGAGG - Intergenic
1185681381 X:1891266-1891288 GGAGACTGGAAGCAGGGAGGGGG + Intergenic
1185913780 X:4011611-4011633 GGAGGAAGGAAGGAGGGAGGAGG - Intergenic
1186237610 X:7530515-7530537 GGAGGATGGAGGGTGGGAGGAGG + Intergenic
1187393978 X:18904197-18904219 GGAGGACAGACCCAGGAAAGTGG + Intronic
1187455785 X:19440158-19440180 GCTGGAGGGACCCAGGGAAGAGG - Intronic
1188495625 X:30780131-30780153 GGAGGAGGTATCCAAGGAGGAGG + Intergenic
1188880319 X:35484419-35484441 GGAGGGTGGAGTCTGGGAGGAGG - Intergenic
1189110619 X:38286154-38286176 GGAGGATGGAGAAGGGGAGGGGG - Exonic
1189323116 X:40097988-40098010 AGAGGAGGGAACCAGGGAGGGGG - Intronic
1189323127 X:40098018-40098040 GGAGGACGGGCGGAGGGAGGGGG - Intronic
1189435026 X:40984970-40984992 GGAGGATGGAGAGTGGGAGGAGG - Intergenic
1189685662 X:43561301-43561323 GGAGGATGGAAGGTGGGAGGAGG - Intergenic
1190063373 X:47224557-47224579 GGGGGTTGGACCTGGGGAGGTGG + Intronic
1190133669 X:47774270-47774292 AGGGTATGGACACAGGGAGGAGG - Intergenic
1190429941 X:50369538-50369560 GAAGGAGGGAGGCAGGGAGGGGG - Intronic
1190931389 X:54951794-54951816 GGTGGAATGACCCAGGGATGGGG - Intronic
1192363099 X:70451695-70451717 GGAGGAGGAACCCTGGGTGGCGG + Intronic
1192774036 X:74223389-74223411 GGAGGCTGGAACCTCGGAGGCGG - Intergenic
1192813856 X:74571391-74571413 GGAGGCTTGAACCTGGGAGGTGG + Intergenic
1193403285 X:81070913-81070935 GGAGGATGGAGGGTGGGAGGAGG + Intergenic
1193598462 X:83478314-83478336 TGAGGGTGGACAAAGGGAGGAGG + Intergenic
1193698751 X:84739437-84739459 GGAGGAGACACCCAGGGGGGTGG - Intergenic
1193712298 X:84894356-84894378 GGAGGTTTCACCCAGAGAGGTGG + Intergenic
1194248606 X:91544919-91544941 GGAGGATGGAGGGTGGGAGGTGG + Intergenic
1195576790 X:106460596-106460618 GGAGCACAGACCCAGTGAGGTGG + Intergenic
1195615254 X:106906734-106906756 GGAGGAAGGGCCCAGGAAGGAGG - Intronic
1195966650 X:110435112-110435134 GGAGGAAGGAGGGAGGGAGGGGG + Intronic
1196187998 X:112764845-112764867 TGGGGGAGGACCCAGGGAGGAGG + Intergenic
1196267106 X:113662847-113662869 GGAGGATGGAAGGTGGGAGGAGG + Intergenic
1197796280 X:130301878-130301900 GGAGGATGGAAGGTGGGAGGAGG + Intergenic
1198153196 X:133931486-133931508 GAAAGAAGGACCCAGGAAGGAGG + Intronic
1199208686 X:145180398-145180420 GTGGGAGGGACCCAGGGGGGAGG + Intergenic
1199263979 X:145808748-145808770 GGAGAAGGGAGGCAGGGAGGAGG + Intergenic
1199629273 X:149764892-149764914 GTGGGAGGGACCCAGGGGGGAGG + Intergenic
1199673539 X:150166040-150166062 GCAGGAGGAACCCAGGTAGGTGG + Intergenic
1199791377 X:151158440-151158462 GGAGGGTGGAGGGAGGGAGGAGG - Intergenic
1200180161 X:154145123-154145145 GGAGGAGGGACCTGGGGAGAGGG - Intronic
1200185989 X:154183517-154183539 GGAGGAGGGACCTGGGGAGAGGG - Intergenic
1200191641 X:154220655-154220677 GGAGGAGGGACCTGGGGAGAGGG - Intronic
1200197396 X:154258459-154258481 GGAGGAGGGACCTGGGGAGAGGG - Intronic
1200273866 X:154713374-154713396 AGAGGATGGCTGCAGGGAGGAGG + Exonic
1200567615 Y:4786433-4786455 GGAGGATGGAGGGTGGGAGGTGG + Intergenic
1202628154 Y:56881617-56881639 GGAGGCTGGAAGAAGGGAGGAGG - Intergenic