ID: 1030963193

View in Genome Browser
Species Human (GRCh38)
Location 7:115953023-115953045
Sequence GACACCGATGTGCTCACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 66}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030963184_1030963193 11 Left 1030963184 7:115952989-115953011 CCTCCCTGGGTCCATCCTCCTGA 0: 1
1: 0
2: 1
3: 40
4: 308
Right 1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 66
1030963188_1030963193 -4 Left 1030963188 7:115953004-115953026 CCTCCTGAAGACAGAACATGACA 0: 1
1: 0
2: 0
3: 29
4: 200
Right 1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 66
1030963186_1030963193 7 Left 1030963186 7:115952993-115953015 CCTGGGTCCATCCTCCTGAAGAC 0: 1
1: 0
2: 1
3: 17
4: 156
Right 1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 66
1030963179_1030963193 30 Left 1030963179 7:115952970-115952992 CCAGAGCCTGTGCAGACCACCTC 0: 1
1: 0
2: 1
3: 24
4: 226
Right 1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 66
1030963187_1030963193 0 Left 1030963187 7:115953000-115953022 CCATCCTCCTGAAGACAGAACAT 0: 1
1: 0
2: 1
3: 18
4: 263
Right 1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 66
1030963189_1030963193 -7 Left 1030963189 7:115953007-115953029 CCTGAAGACAGAACATGACACCG 0: 1
1: 0
2: 0
3: 20
4: 377
Right 1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 66
1030963181_1030963193 24 Left 1030963181 7:115952976-115952998 CCTGTGCAGACCACCTCCCTGGG 0: 1
1: 0
2: 2
3: 42
4: 274
Right 1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 66
1030963185_1030963193 8 Left 1030963185 7:115952992-115953014 CCCTGGGTCCATCCTCCTGAAGA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 66
1030963183_1030963193 14 Left 1030963183 7:115952986-115953008 CCACCTCCCTGGGTCCATCCTCC 0: 1
1: 1
2: 13
3: 97
4: 945
Right 1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030963193 Original CRISPR GACACCGATGTGCTCACTGG GGG Intronic
903153858 1:21430947-21430969 CACACCAATCTGCTCTCTGGGGG - Intergenic
908070526 1:60455032-60455054 GCCACCGCTGTTGTCACTGGGGG + Intergenic
910717157 1:90244668-90244690 GAGCCCGATGTGCTCAGTGGAGG - Intergenic
916720458 1:167481652-167481674 GAGACCCTTGTGCTCACTGCTGG - Intronic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1066471584 10:35702864-35702886 GACACAGATTTGCACACTGATGG - Intergenic
1073445996 10:103580627-103580649 GACACAGCTGGGCTCACTGATGG + Intronic
1073889503 10:108082916-108082938 GACATCCAAGTGCTCACTGCAGG - Intergenic
1074338763 10:112605522-112605544 GACAGCTCTGTGCACACTGGAGG + Intronic
1077819252 11:5719825-5719847 CACAGCCATGTGCTCACAGGAGG - Intronic
1088553496 11:111038105-111038127 CACACCTATGTCCTCACAGGGGG - Intergenic
1095748963 12:45690066-45690088 AACCCCCATGTGCTCACTGAAGG + Intergenic
1101648520 12:106653696-106653718 GACACTGATCTGCTGACTGAAGG - Intronic
1101989447 12:109472981-109473003 GACACCGAGGGGCTTTCTGGAGG - Intronic
1104137483 12:125954218-125954240 GACACTGATGTGGTCCCTGGTGG + Intergenic
1106465733 13:30013052-30013074 GACACCCTTGTACTCACAGGAGG - Intergenic
1113533830 13:111048779-111048801 GACAAGGATGTGCTCACTGATGG - Intergenic
1117046635 14:51819070-51819092 GACACAGATCTGCTCACTGCAGG - Intergenic
1118321822 14:64757857-64757879 GACACCGATGAGCTCTCAGACGG + Intronic
1118695754 14:68383469-68383491 AACACAGATGTACACACTGGAGG + Intronic
1121537938 14:94704023-94704045 GACACTCATGCGCTCACTGCAGG + Intergenic
1122244276 14:100390726-100390748 GGCACAGATCTGCACACTGGTGG - Intronic
1122297883 14:100715432-100715454 GACACCACTGTCCTCACAGGAGG - Intergenic
1125760774 15:42094172-42094194 GACACTGCTGTGGTCGCTGGTGG + Intronic
1126911960 15:53427046-53427068 GACACAAAGGTGCTCAGTGGGGG + Intergenic
1128183043 15:65621782-65621804 GACACAGAGGGGCTCACTGTGGG - Intronic
1131511169 15:93050338-93050360 GCCACCGACGTTCTCACCGGGGG + Intronic
1139176490 16:64695609-64695631 GACACTGATGTGATCTCTTGAGG - Intergenic
1147549066 17:41425710-41425732 GACACCGTTGTTCTCACCGGGGG - Intergenic
1149658371 17:58322109-58322131 GACACTGATGAGCACAGTGGTGG - Intronic
1162818417 19:13209308-13209330 TACACCGATGTGGACACAGGTGG - Exonic
1165750321 19:38255706-38255728 GACACAGATGTGCACAGTGAAGG - Intronic
925588529 2:5487340-5487362 GACTCAGATGTGCTCACTTCAGG + Intergenic
929673028 2:43893901-43893923 CCCACTGATTTGCTCACTGGAGG - Intronic
930393750 2:50793900-50793922 GACAGCAATGTTTTCACTGGGGG + Intronic
946178798 2:217937806-217937828 GACTCAGATCTGCTCACTTGAGG + Intronic
948839949 2:240643967-240643989 AACACCGCTGTCCTCACGGGTGG + Intergenic
1169779309 20:9292485-9292507 GGCACCTAGGTCCTCACTGGTGG - Intronic
1169889136 20:10433989-10434011 GTCACCGGTGTCCTCACTGAAGG - Intronic
1173263033 20:41453228-41453250 GACACCACTTTGGTCACTGGGGG - Intronic
1184378212 22:44128440-44128462 GACATCACTGTGCCCACTGGCGG - Intronic
1185068431 22:48643475-48643497 CACACCAAAGTGCACACTGGAGG - Intronic
950129124 3:10529839-10529861 GACACAGAGGCACTCACTGGGGG + Intronic
950245736 3:11416312-11416334 GGCCCAGATGGGCTCACTGGGGG - Intronic
951497245 3:23343647-23343669 TACACAGATGTGTTCACTTGAGG - Intronic
952802001 3:37302456-37302478 GACACCCATCTGCTCATTAGAGG + Intronic
961620107 3:128217356-128217378 GTCCACCATGTGCTCACTGGTGG + Intronic
961828666 3:129612100-129612122 GAGCCCCGTGTGCTCACTGGGGG + Intergenic
963065632 3:141261389-141261411 AACACCTATGTTCTCACTTGAGG - Intronic
964662578 3:159136631-159136653 GACAGCGGGGTTCTCACTGGTGG + Intronic
978800734 4:112753122-112753144 GGCACCAATGTGCTCTCTGAAGG - Intergenic
984656505 4:182324423-182324445 GGCACCAATGTGCCCACCGGTGG - Intronic
985781840 5:1875697-1875719 GCCACCCATGCGCGCACTGGGGG + Intergenic
989129789 5:38095485-38095507 GACACCAGTGTGCGCAGTGGTGG + Intergenic
1006259375 6:32854888-32854910 CACTCCCATGTGCCCACTGGGGG + Intronic
1007932191 6:45701741-45701763 GAGGCAGCTGTGCTCACTGGAGG - Intergenic
1009474265 6:64068817-64068839 GACACCCATGTACTAATTGGTGG + Intronic
1013177594 6:107690681-107690703 CACAGAGATGTTCTCACTGGGGG + Intergenic
1026734219 7:72939038-72939060 GACACAGATGTGATCCCTGAGGG - Intronic
1026784552 7:73293944-73293966 GACACAGATGTGATCCCTGAGGG - Intergenic
1027109519 7:75425984-75426006 GACACAGATGTGATCCCTGAGGG + Intronic
1029220899 7:98989412-98989434 GTCACCCACGTGCTCACTGAAGG + Intronic
1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG + Intronic
1032151232 7:129431952-129431974 GACACCTATGTGCTCACTATAGG - Intergenic
1038235513 8:25749629-25749651 GACCACGATGTGCCTACTGGTGG - Intergenic
1046829222 8:118725725-118725747 GACACAGATGACCTCACTGATGG - Intergenic
1049028488 8:140014403-140014425 GAGACCTATGTACTCCCTGGTGG + Intronic
1056046897 9:82727904-82727926 GACGCAGATTTCCTCACTGGAGG - Intergenic
1057422744 9:94925673-94925695 GACACTGATGTGCACACTGCTGG - Intronic
1057818975 9:98316735-98316757 GACAATGATGTGCTCACTGCTGG + Intronic
1186513698 X:10150204-10150226 GACATTGATTTTCTCACTGGAGG + Intergenic
1188932929 X:36136351-36136373 GACAAGGATGTGCTATCTGGTGG + Intronic
1194448375 X:94013601-94013623 GACCCTTATGTGCTCTCTGGTGG + Intergenic
1199607486 X:149587446-149587468 GTCACTGACGTGCGCACTGGGGG - Exonic
1199631637 X:149781921-149781943 GTCACTGACGTGCGCACTGGGGG + Exonic