ID: 1030963357

View in Genome Browser
Species Human (GRCh38)
Location 7:115955264-115955286
Sequence CCTTATTTATTTAATGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030963357_1030963364 22 Left 1030963357 7:115955264-115955286 CCTCCCACATTAAATAAATAAGG 0: 1
1: 0
2: 0
3: 22
4: 304
Right 1030963364 7:115955309-115955331 TGTTGTGGAAATGACTAGTATGG 0: 1
1: 0
2: 0
3: 7
4: 189
1030963357_1030963362 7 Left 1030963357 7:115955264-115955286 CCTCCCACATTAAATAAATAAGG 0: 1
1: 0
2: 0
3: 22
4: 304
Right 1030963362 7:115955294-115955316 GTGAAGCCACTAGCTTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030963357 Original CRISPR CCTTATTTATTTAATGTGGG AGG (reversed) Intronic
902757811 1:18560653-18560675 CCTTTTTTTTTTTATGGGGGTGG - Intergenic
908049219 1:60209521-60209543 CCCTATTTAATAAATGTTGGTGG + Intergenic
908049780 1:60216701-60216723 CCCTATTTAATAAATGTTGGTGG - Intergenic
909655702 1:78029816-78029838 ACTTATTTATTAAATGTTTGTGG - Intronic
910025561 1:82647008-82647030 CCTGATTTATATTTTGTGGGAGG - Intergenic
911421167 1:97642499-97642521 CCTTATTTAATAAATGTTGTTGG + Intronic
911726389 1:101245825-101245847 CCTTATTTATTTATTTTGGAGGG + Intergenic
912651039 1:111439821-111439843 CATCATTTTTATAATGTGGGAGG - Intergenic
913287837 1:117243198-117243220 ACTTATTTATTTATTGAGGTGGG + Intergenic
913571988 1:120129864-120129886 CCAAATTTATTTAATCAGGGAGG + Intergenic
914292908 1:146291487-146291509 CCAAATTTATTTAATCAGGGAGG + Intergenic
914553952 1:148742270-148742292 CCAAATTTATTTAATCAGGGAGG + Intergenic
914853397 1:151331938-151331960 GCTTTTACATTTAATGTGGGGGG - Intergenic
915464284 1:156087242-156087264 CCTTTTTTTTTTTTTGTGGGGGG + Intronic
916356953 1:163921907-163921929 CCTCATTTCTTAAATGTGGGAGG - Intergenic
917003196 1:170384456-170384478 CCTTATTTAGTTCATTTGGTGGG + Intergenic
917165919 1:172113051-172113073 CCTTATTTATTTACTGAATGTGG + Intronic
918091665 1:181300477-181300499 TTTTATTTCTTTAATTTGGGGGG + Intergenic
918648368 1:186928378-186928400 CCTTACTATTATAATGTGGGTGG + Intronic
918677267 1:187302936-187302958 ACTTATTTATTTAATGGGTTTGG - Intergenic
918749214 1:188250417-188250439 CCTTATTTATATTATGTTTGTGG + Intergenic
919088963 1:192955579-192955601 CCTAATTTATTTAACATGTGTGG - Intergenic
919192550 1:194242412-194242434 CCTTATTTATTAATTTTGAGAGG + Intergenic
919361214 1:196597258-196597280 CCTTTTTTTTTTAGTGTAGGTGG - Intronic
919601694 1:199631111-199631133 CCTCTTTTATTTAATGTGTTTGG + Intergenic
921037013 1:211389941-211389963 CCTTATTTATTTATTTAGGCAGG - Intergenic
921634728 1:217478290-217478312 CCTTATTTAGTTCATGTGGTGGG - Intronic
924419265 1:243892262-243892284 CCTAATCTATTTAATATGGTTGG - Intergenic
1066092499 10:32038432-32038454 TCTTGTTTATAAAATGTGGGTGG - Intronic
1066593972 10:37028222-37028244 ATTTATTTACTTAATGTTGGAGG + Intergenic
1067043789 10:42973035-42973057 CCTTATTTTTTCCTTGTGGGGGG + Intergenic
1068108305 10:52647585-52647607 ACATTTTTATTTAATGTGGCTGG - Intergenic
1068724212 10:60282816-60282838 CCCTTTTTATTTGAAGTGGGTGG - Intronic
1070121494 10:73581613-73581635 CCCCATTTATGTAATGTGGATGG - Intronic
1073163835 10:101425962-101425984 CATTATTTATTAAATGTTGAAGG + Intronic
1073225056 10:101911308-101911330 CCTCACTTCTTTTATGTGGGAGG - Intronic
1073745758 10:106466601-106466623 TTTTATTTATTTATTTTGGGAGG - Intergenic
1073901166 10:108222581-108222603 CCTTTATTATTTTATGAGGGAGG + Intergenic
1074495314 10:113975197-113975219 CGCTATTTATTTCATGTGGAAGG + Intergenic
1074999930 10:118788388-118788410 TCTTACTGATTTAATCTGGGAGG - Intergenic
1076645412 10:131950791-131950813 GCTTATTTATTTATTGTGTGGGG - Intronic
1078279104 11:9881739-9881761 CTTTATTTGTTTAATTGGGGGGG - Intronic
1078329627 11:10408944-10408966 ACTCATGTATTTAGTGTGGGGGG + Intronic
1079116691 11:17644608-17644630 CCTGACTTATGCAATGTGGGGGG + Intronic
1080028474 11:27636413-27636435 ACTTACTAATTTCATGTGGGCGG - Intergenic
1081001094 11:37673015-37673037 ACTTATTTATTTAATCTGGAGGG - Intergenic
1081009062 11:37785029-37785051 CCTTATTTAATAAATGTTGCTGG + Intergenic
1082122592 11:48395594-48395616 CCTTACTTATTTCATTTGGTGGG + Intergenic
1082252038 11:49993100-49993122 CCTTATTTATTTCATTTGGTGGG - Intergenic
1082556302 11:54566870-54566892 CCTTATTTATTTTATTTGGTGGG + Intergenic
1082745986 11:56963678-56963700 CCTTATTTAATAAATGGTGGTGG - Intergenic
1083499665 11:63092600-63092622 CCCTATTTAATTAATGTGCTGGG + Intronic
1083908432 11:65690000-65690022 TCTTATTGATTTCATGTAGGAGG - Intergenic
1084893502 11:72249322-72249344 GCTGATTTATTTAATGTGCCAGG - Intergenic
1085371941 11:76016177-76016199 CCCTATTTATGTAATATAGGTGG - Intronic
1085894344 11:80620095-80620117 ATTTATTTACTTAATGTTGGAGG - Intergenic
1085914341 11:80867138-80867160 TCTTAATAACTTAATGTGGGAGG + Intergenic
1086557237 11:88125525-88125547 CTCTATTTATTTAATGTGAAGGG + Intronic
1086898336 11:92338849-92338871 CCTTAATTATCTGTTGTGGGTGG + Intergenic
1087189464 11:95237546-95237568 CCTTTTCTATTAAATGTGGCAGG + Intergenic
1087687907 11:101286135-101286157 CCTTATTTTTTTTGTGGGGGGGG + Intergenic
1088194011 11:107256317-107256339 CCTTATTGATTTCACTTGGGAGG - Intergenic
1090122344 11:124044479-124044501 ACTTACTTTTTTAATTTGGGTGG - Intergenic
1090480824 11:127066758-127066780 CCTTATTTACTAAGTGGGGGAGG + Intergenic
1090676750 11:129006226-129006248 CCTTATTTACTTCATTTGGTGGG + Intronic
1091498689 12:994330-994352 TCTTATTTATTTTTTGTGTGTGG + Intronic
1093655782 12:21692924-21692946 CCTTATTTAATAAATGGGGCTGG + Intronic
1097089874 12:56496556-56496578 ATTTATTTATTTGATGTGGGCGG + Intergenic
1098129632 12:67335799-67335821 CCTTATTTATTTATTTTTTGAGG + Intergenic
1098734994 12:74090419-74090441 TCTTCTTTTTTTAATGTAGGTGG + Intergenic
1101096637 12:101348655-101348677 TCTTATTTATTTGTTGTGGCAGG + Intronic
1103661439 12:122522390-122522412 TCTGATTTATTGATTGTGGGGGG - Intronic
1107079451 13:36359006-36359028 CCTTATTTGTTCATTGGGGGTGG - Intronic
1109359913 13:61282369-61282391 CCTTATGTATTTATTTTAGGAGG + Intergenic
1109533416 13:63683974-63683996 CCTTATTTAATTAATGGTGCTGG - Intergenic
1111389077 13:87567866-87567888 CATTAATGATTTAATGAGGGTGG - Intergenic
1112579369 13:100664957-100664979 CCTTATTTAATAGATGTGAGAGG - Intronic
1113257898 13:108527731-108527753 ACTTATTTATTTAATTTGTAAGG + Intergenic
1115324507 14:32124314-32124336 CCTTAGTTTTTTACTATGGGAGG + Intronic
1115343106 14:32313047-32313069 CCTGATTCATTTAATATGTGAGG - Intergenic
1115466305 14:33718181-33718203 CCTTATTTCCTTAATGTGCCTGG + Intronic
1115828624 14:37309130-37309152 ATTTATTTATTTAGTGTGTGTGG + Intronic
1116116975 14:40666174-40666196 CCTTTTTTAAGTAATGTGTGAGG + Intergenic
1116944135 14:50820119-50820141 GCATATTGATTTCATGTGGGAGG - Intronic
1117036407 14:51734193-51734215 TTTTAATTATTTAAGGTGGGAGG - Intergenic
1117656894 14:57964634-57964656 CCTTTTTTATTCTCTGTGGGAGG + Intronic
1118119722 14:62826310-62826332 CCTTATTTATTTCATTTGCCTGG + Intronic
1118648146 14:67860199-67860221 CTTAAATTATTTAATGTGAGAGG + Intronic
1120028954 14:79618163-79618185 CATTATTTATTTATTATGGATGG + Intronic
1120558549 14:85960745-85960767 CTTTATTTATTTAACATGGCTGG + Intergenic
1121904246 14:97725016-97725038 CCCTATTTATAAAATGTGGATGG + Intergenic
1123477803 15:20603231-20603253 ACTTATTAATTTCATGTGAGAGG + Intergenic
1123640212 15:22397151-22397173 ACTTATTAATTTCATGTGAGAGG - Intergenic
1125148135 15:36497088-36497110 CCTTTTTTATTTTTTGGGGGGGG + Intergenic
1125778329 15:42239339-42239361 CCTCATTTAGTTAATGTAAGTGG + Intronic
1125923572 15:43542281-43542303 TCTTATTTACTTAATTTTGGCGG + Intronic
1126457995 15:48885313-48885335 CCTTTTATATAAAATGTGGGGGG + Intronic
1128531457 15:68451297-68451319 ATTTATTTATTTATTGTGGATGG + Intergenic
1129469859 15:75746555-75746577 CATTATTTATTTATGGTGTGAGG + Intergenic
1130450897 15:84050754-84050776 CCTTCATAATTTAATGGGGGTGG - Intergenic
1131389913 15:92039007-92039029 CCTTATTTAATAAATGTTGCTGG + Intronic
1132555561 16:570467-570489 CATTATTTATTTATTTTGAGAGG + Intronic
1134356625 16:13488196-13488218 CCATATATATTTAATCTGGGGGG - Intergenic
1136056655 16:27694784-27694806 ATTTATTTATTTATTGTGGTAGG - Intronic
1139907044 16:70373225-70373247 CCTTATTTATTTATTGAGTCGGG - Exonic
1144855144 17:18263365-18263387 CCTCAGATATTTAATGGGGGTGG + Intronic
1146443730 17:32918975-32918997 ACTTATTTATTTAATTTATGAGG - Intergenic
1146781330 17:35675632-35675654 CCTTTTTTTTTTTTTGTGGGGGG + Intronic
1148243819 17:46017276-46017298 CCTTATTTATTTATTTAGAGAGG + Intronic
1149488147 17:57060828-57060850 CTTTATTTATTTATTGAGAGAGG + Intergenic
1150357504 17:64499482-64499504 TCCTTTTTATTTAATTTGGGAGG - Intergenic
1150414523 17:64976040-64976062 CCTTCTTTATTTGTTGGGGGCGG + Intergenic
1152023808 17:77796062-77796084 CCTCATTAATTTCATGTGAGAGG + Intergenic
1152787574 17:82257502-82257524 CCTTAGTTACTTAAGGTGTGAGG - Intronic
1153157930 18:2169961-2169983 CCTTAATGATGGAATGTGGGTGG + Intergenic
1153614225 18:6919928-6919950 TTTTTTTTTTTTAATGTGGGTGG - Intergenic
1154113733 18:11592695-11592717 TGTTATTTATTTCATGTTGGTGG - Intergenic
1154379678 18:13837877-13837899 GCTTATTTATCTAATTTGTGAGG - Intergenic
1156305918 18:35878006-35878028 CCATCTTTATTTAATCTGGGAGG + Intergenic
1157001154 18:43527220-43527242 CCTAATTTATGTAATGTTTGGGG - Intergenic
1159446466 18:68546378-68546400 CCTTATTTAGTTCATTTGGTGGG - Intergenic
1159727788 18:71984036-71984058 CCTTTTCTATTTCTTGTGGGAGG + Intergenic
1160433691 18:78830082-78830104 CCCTATTTAATAAATGTGAGAGG + Intergenic
1160517373 18:79486093-79486115 CCTTTTTTTTTTAATGGGGTGGG + Intronic
1160685157 19:431185-431207 CCGTATTTATTTAGTGTCTGAGG + Intronic
1161882387 19:6965267-6965289 ATTTAGTTGTTTAATGTGGGAGG - Intergenic
1162189486 19:8933549-8933571 CATCATTTATTTAATGAAGGTGG - Intronic
1165045197 19:33099214-33099236 CATTATTTATTAAAAGTGGTGGG + Intronic
1165259717 19:34602409-34602431 CCTGATTCATTTAATGAGGCTGG - Intronic
1167159800 19:47759915-47759937 ACCTTTTTATTTAATATGGGAGG - Intergenic
1168446679 19:56423709-56423731 CCTTATGTGTGTAATGTGTGTGG + Exonic
926886203 2:17601210-17601232 CCTTATTTGTAAAATGGGGGAGG - Intronic
927296130 2:21455237-21455259 TCTTTTTTCTTTAAGGTGGGAGG - Intergenic
927421272 2:22933689-22933711 ATTTATTTATTTATTTTGGGAGG - Intergenic
927590215 2:24349367-24349389 CCTGAATTATTTAATTTGAGTGG + Intronic
929375572 2:41282703-41282725 CCTTATTCTTTTAATGTGTGTGG + Intergenic
930321091 2:49855748-49855770 CCTTAGTTTTTTAATGTGATTGG + Intergenic
930442164 2:51422640-51422662 CCTGATCTATATAATATGGGTGG - Intergenic
932365919 2:71153577-71153599 GTTTATTTATTTGATGAGGGAGG - Intergenic
932859730 2:75277617-75277639 CATTGTTTATTTAGTGAGGGAGG - Intergenic
934541413 2:95178376-95178398 CCTGATTAAGTTAATCTGGGGGG - Intronic
934909544 2:98238387-98238409 CCTAATTTATTTCTTGTAGGAGG + Intronic
935141218 2:100354570-100354592 CCTTATTTTTTTTTTGCGGGGGG - Intergenic
935892045 2:107689086-107689108 CCAAATTTATTTTATGTGTGTGG - Intergenic
936231971 2:110710730-110710752 CTTTATTTTGTTACTGTGGGAGG + Intergenic
937112483 2:119377324-119377346 CCATGTCTATTTAATTTGGGTGG - Intergenic
939057031 2:137378483-137378505 ACTTATATATTTATTTTGGGTGG + Intronic
940056903 2:149523032-149523054 CCTTATTTATTAAATGGTGCTGG - Intergenic
940162700 2:150730495-150730517 CCTTAATTTTTTAATTTAGGTGG - Intergenic
940250545 2:151670934-151670956 CCTTCTTAATTCAATGTGTGAGG - Intronic
940730674 2:157386673-157386695 CCTTATTTAGTTCATTTGGTAGG - Intergenic
941902790 2:170694179-170694201 TCTGATTTAATTAGTGTGGGTGG + Intergenic
942030021 2:171950134-171950156 ACATATTTCTTTAATGTGTGGGG + Intronic
942145233 2:173020118-173020140 ACTAATTTTTTTAATGTGGGAGG + Intronic
942547999 2:177084430-177084452 CCTTTTATATTTTAGGTGGGGGG + Intergenic
942789154 2:179738706-179738728 TCTAATTTATTTAGTGTGGGAGG + Intronic
944051656 2:195476771-195476793 ATTTATTTATTTATTTTGGGTGG + Intergenic
944673219 2:202013809-202013831 CCTTAAAAATTTTATGTGGGGGG - Intergenic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
947506507 2:230712324-230712346 ACTTTTTTTTTTAATGTGTGAGG + Intergenic
1168735978 20:136946-136968 TCTTTTTGATTTAATGTTGGTGG + Intergenic
1169880899 20:10345054-10345076 CGTTATTGATTTAAATTGGGTGG - Intergenic
1170742735 20:19072446-19072468 CCTAATTCAATTAATCTGGGGGG + Intergenic
1172209978 20:33190544-33190566 CCTTGTGTATTTTCTGTGGGAGG - Intergenic
1173778518 20:45733374-45733396 CCTCATTCATTTCATGTGGTGGG - Intergenic
1174278665 20:49422266-49422288 CCTGTTTTATTTATTGTGTGGGG + Intronic
1174334242 20:49846518-49846540 CTTCATTTATTTAGTGTGGTGGG - Intronic
1174644825 20:52076732-52076754 TTTTTTTTTTTTAATGTGGGGGG + Intronic
1174663971 20:52240133-52240155 GCCTATTTATTAAATATGGGAGG + Intergenic
1177284601 21:19033383-19033405 CCCTATTTATTTAATGTATTGGG - Intergenic
1177314910 21:19446759-19446781 ATTTATTTATTTATTGTCGGGGG + Intergenic
1177538250 21:22457986-22458008 AATTATTTATTTAAAGTGGTTGG - Intergenic
1177635890 21:23785847-23785869 GTTTATTTATTTATTGAGGGAGG - Intergenic
1178807527 21:35851872-35851894 TCTTTTTTATTTATTTTGGGAGG + Intronic
1180592443 22:16952714-16952736 CCCTATTTGTTTATTGTGTGTGG + Intergenic
1182258824 22:29058103-29058125 CCTTATTTTTATAAAGTGGATGG - Intergenic
1183458310 22:37934556-37934578 ATTTATTTATTTATTTTGGGGGG + Intronic
1203239802 22_KI270733v1_random:5168-5190 CCTTATTTAATAAATGTTGCTGG + Intergenic
949289444 3:2446902-2446924 CCTTATTTACTTTATTTGTGAGG + Intronic
949435134 3:4020927-4020949 ATTTATTTATTTATTTTGGGTGG - Intronic
949448675 3:4162896-4162918 CCTTTTTTTTTTTATGAGGGAGG - Intronic
949580170 3:5379857-5379879 CCTTATTTAATTAATGGTGTTGG - Intergenic
949658421 3:6248784-6248806 TGTTATTTTTTTAAGGTGGGTGG + Intergenic
951376520 3:21924796-21924818 CCTTTTTAATTTTGTGTGGGAGG - Intronic
951637498 3:24795630-24795652 CATTATTTATTTCCTGTGGATGG + Intergenic
953872063 3:46635218-46635240 ACTTATTTATTTATTTTGGGGGG + Intergenic
956456791 3:69429626-69429648 CCTGTTTTATTTCATGTGTGTGG - Intronic
956472568 3:69582834-69582856 TCATATTTATTTATTGTGGATGG + Intergenic
957159842 3:76596540-76596562 CCTCATTTGTTAAATGTAGGTGG + Intronic
957868386 3:86054916-86054938 ATTTATTTATTTTATGTGTGTGG + Intronic
958700890 3:97587693-97587715 CCTTATTTTCATAATGTGGTTGG + Intronic
959865719 3:111267776-111267798 CCTTTTTTATTTTTTGGGGGGGG - Intronic
960070996 3:113430834-113430856 CCTTATTTAATAATTTTGGGAGG - Intronic
960270192 3:115665477-115665499 CCTTATTTTTTTAAAGGGGATGG + Intronic
960428111 3:117534054-117534076 CATTTTTTATTTATTGTGGTTGG + Intergenic
961773400 3:129266807-129266829 CCTTATCTATTTAATGGAGAAGG - Intronic
962239824 3:133743038-133743060 CTTTATTTATTTAGTGGGGGAGG - Intergenic
962490718 3:135891419-135891441 CTTTATTTGTTTAAGGTTGGTGG - Intergenic
963062672 3:141237505-141237527 CCTTATTTGTAAAATTTGGGTGG + Intronic
963201610 3:142591861-142591883 CCATATTTATTTCATTTGGCTGG - Intergenic
963250524 3:143098817-143098839 CCTTATTTTTTTAAAGGAGGGGG - Intergenic
964224973 3:154387960-154387982 GCTTATTTTTTTAATGTGTGGGG + Intronic
965212191 3:165806128-165806150 ACTTTTTTTTTTAATGTGAGGGG - Intronic
965869333 3:173247816-173247838 ACTTATTAATTTTATGTGGAGGG - Intergenic
966929592 3:184667349-184667371 TATTCTTAATTTAATGTGGGAGG + Intronic
968069038 3:195774463-195774485 CCACATGCATTTAATGTGGGTGG - Intronic
970290312 4:14564308-14564330 ACTTATTTATTTATTGAAGGAGG + Intergenic
971410967 4:26371906-26371928 CCTTATTTGTTTTATATGTGGGG + Intronic
972827871 4:42782348-42782370 CATTATTTACTTACTCTGGGTGG + Intergenic
973327290 4:48876852-48876874 CCTTATTTAGTTCATTTGGATGG + Intergenic
973796563 4:54433234-54433256 CCATAATTATAAAATGTGGGAGG + Intergenic
974131179 4:57757762-57757784 CTTTCTTTCTTTAATGTGAGTGG + Intergenic
974577444 4:63745278-63745300 ACTTTCTTATTTAATTTGGGGGG - Intergenic
974656621 4:64832003-64832025 CCTGATATATTTAGTGTGTGGGG - Intergenic
974816261 4:67007891-67007913 TCTTATTTATTAAATATTGGGGG + Intergenic
974930949 4:68360329-68360351 CATTATTTATTAAATGGTGGTGG - Intergenic
976660600 4:87536450-87536472 ATTTATTTATTTAATGAGGCAGG + Intergenic
977063502 4:92285017-92285039 CCTTACTTATTACATGTAGGAGG - Intergenic
977067791 4:92341150-92341172 CCTTTTTTATTTAATATATGTGG + Intronic
977957619 4:103048449-103048471 TCTTATTTATTTACTTTGTGTGG + Intronic
978112965 4:104985094-104985116 TCTGATTTAATTAATGTGGGGGG - Intergenic
979161699 4:117469737-117469759 GCTTAAATATGTAATGTGGGTGG + Intergenic
980559221 4:134450833-134450855 CCTTATTTAATTGAAGTAGGTGG - Intergenic
982837411 4:160137863-160137885 CCTTAATTAGTTTAAGTGGGTGG - Intergenic
982838006 4:160147088-160147110 CCTGATTTTTTTAATATAGGAGG + Intergenic
983132360 4:164037011-164037033 CATGATTAATTTAATATGGGGGG + Intronic
983188370 4:164727153-164727175 CATTATTTTTTCTATGTGGGAGG + Intergenic
984403948 4:179302862-179302884 CCCTATTTATTAAATGTTGTTGG + Intergenic
989571488 5:42950361-42950383 ATTTATTTATTTAATTTGGTAGG - Intergenic
991547578 5:67800470-67800492 TCTTATTTCTTTCATCTGGGTGG - Intergenic
992617949 5:78563368-78563390 CCGTATTTATTTAGTGGAGGTGG - Intronic
995970218 5:117960134-117960156 GATTATTTATTTATTTTGGGGGG + Intergenic
996690374 5:126333947-126333969 CCTTAGTTCTTTAATGGGGAAGG + Intergenic
998078250 5:139253753-139253775 ATTTATTTATTTATTTTGGGGGG - Intronic
999121797 5:149215513-149215535 TCTTTTTTTTTTTATGTGGGGGG - Intronic
1000317462 5:160106525-160106547 TCTTGTTTTTTTAATGTGTGAGG - Intronic
1000984622 5:167853416-167853438 CCTTATTTATTTAAATTAGCTGG - Intronic
1001228753 5:169967857-169967879 TGTGATTTATTGAATGTGGGAGG + Intronic
1001681227 5:173558399-173558421 ACTTAATTCTTTATTGTGGGGGG + Intergenic
1002669023 5:180850131-180850153 CCTTATGTATGTGATGTGTGTGG - Exonic
1003917730 6:10803227-10803249 CCTTATTTTTTTAATCGGAGTGG - Intronic
1004143571 6:13044481-13044503 CCTGAATTAATTACTGTGGGTGG + Intronic
1005051004 6:21683762-21683784 ATTTATCTATTTAATTTGGGGGG - Intergenic
1006696913 6:35939146-35939168 CCTTATTTGATTACTTTGGGAGG + Intergenic
1007823236 6:44577742-44577764 CCATTTTTCCTTAATGTGGGGGG - Intergenic
1008018014 6:46542638-46542660 CCTTATTTAGTTCATTTGGTGGG - Intergenic
1008381144 6:50840987-50841009 GCTCATTTATTTAGTGTTGGAGG + Intronic
1009686071 6:66959385-66959407 CCTTATTTAATAAATGGTGGTGG + Intergenic
1010029676 6:71259948-71259970 CCTTAATTATTGATTGTGGATGG - Intergenic
1010148844 6:72705773-72705795 CCTTATTACTTTAATCTGGGAGG + Intronic
1010276061 6:73969926-73969948 CCCTTTTTATTTAATGTGCTTGG + Intergenic
1010907119 6:81504168-81504190 CATTATTTATAAAAGGTGGGTGG + Intronic
1011741488 6:90364929-90364951 CCTTAATTATTTCCTCTGGGAGG - Intergenic
1011985263 6:93435812-93435834 CCTTATTTAGTAAATGTTGTTGG + Intergenic
1012715445 6:102662221-102662243 CATTATTTATTTCATTTGGTGGG - Intergenic
1013060467 6:106629284-106629306 CCTTTTTTTTTTAAAGTGGAGGG - Exonic
1013064714 6:106672440-106672462 CCCTTTTTATTTAATGTGAATGG - Intergenic
1013714993 6:112949432-112949454 CCATTTTTGTTTGATGTGGGTGG - Intergenic
1015143732 6:129963095-129963117 TTCTAGTTATTTAATGTGGGAGG + Intergenic
1015384459 6:132606275-132606297 ATTTATTTATTTAATTTGGAGGG - Intergenic
1015566851 6:134581781-134581803 ATTTATTTATTTATTTTGGGGGG - Intergenic
1015703440 6:136061513-136061535 CCTTATTTCTTATATGGGGGTGG - Intronic
1017252791 6:152299687-152299709 CTTTTTTTTTTTAATGAGGGGGG + Intronic
1017445011 6:154499620-154499642 CCGGGTTTTTTTAATGTGGGGGG + Intronic
1017613839 6:156222460-156222482 CCTTATTTAGTTCATTTGGTGGG - Intergenic
1018659129 6:166068759-166068781 CCTTATTTAATAAGTGAGGGAGG - Intergenic
1019199103 6:170299627-170299649 TTTTAGTTATTTAAAGTGGGAGG + Intronic
1019312549 7:369768-369790 CCTTATCTGTTTAATGGGAGCGG - Intergenic
1021103223 7:16607559-16607581 TTTTATTTATTTATTGAGGGGGG - Intronic
1021287697 7:18802056-18802078 TATTATTTATTTTATTTGGGGGG + Intronic
1022423362 7:30245401-30245423 CCTCTTTTTTTTAATGTGGGAGG + Intergenic
1022910845 7:34898546-34898568 CCTTACTTCTTCAAGGTGGGAGG + Intergenic
1024440522 7:49411223-49411245 CTTTATTTTCTTAATGTGGAAGG - Intergenic
1024912665 7:54463856-54463878 CCTTCTTTTTCTAATGTGAGTGG + Intergenic
1027756341 7:82217860-82217882 TTTTTTTTTTTTAATGTGGGAGG + Intronic
1030612137 7:111701181-111701203 CCTTATTTAATCAATGGGGTTGG - Intergenic
1030686718 7:112494368-112494390 CCTGATGTAATTGATGTGGGTGG - Intergenic
1030963357 7:115955264-115955286 CCTTATTTATTTAATGTGGGAGG - Intronic
1031313856 7:120232736-120232758 ACAAATTTATTTAATGTGGAAGG - Intergenic
1031439910 7:121781286-121781308 CATTATATATATTATGTGGGAGG - Intergenic
1033008649 7:137595120-137595142 ACTAATTTTTTTAATGTGGTAGG - Intronic
1033388251 7:140900434-140900456 CTTCATTTATTTAATATGGTAGG + Intronic
1034809042 7:154114459-154114481 CTTTATTTAATTATTGAGGGTGG + Intronic
1036075976 8:5500356-5500378 CCTTAGTTGTTTGATGTGGACGG - Intergenic
1036436768 8:8742271-8742293 ACTTATTTATTTATTTTGAGAGG + Intergenic
1039342596 8:36667634-36667656 CCTTATTTATTAAATGGTGCTGG - Intergenic
1039678063 8:39692968-39692990 CCTTAATTATTAAATGTGTGTGG - Intronic
1039715767 8:40107081-40107103 GTTTATTTATTTATTTTGGGGGG - Intergenic
1040611220 8:48984060-48984082 CTTCATTTATTTAGTGTGGATGG - Intergenic
1041580161 8:59449473-59449495 CCTTATTTAATAAATGTTGTTGG + Intergenic
1041583521 8:59490366-59490388 CCTTATTTATTAAATGGTGTTGG - Intergenic
1041930018 8:63276537-63276559 CCATTTTTTTTTAATCTGGGTGG - Intergenic
1043934827 8:86131191-86131213 ATTTATTTATTTTGTGTGGGAGG + Intronic
1044303466 8:90611143-90611165 GATTATTAATTTTATGTGGGAGG + Intergenic
1047581890 8:126224816-126224838 ACATATTCTTTTAATGTGGGAGG + Intergenic
1048021520 8:130543680-130543702 CCATTTTTATCCAATGTGGGTGG - Intergenic
1048555685 8:135473677-135473699 ACTTATTTATTTATTTTGAGTGG + Intronic
1052103983 9:24488560-24488582 CCTTATTTTTTTCTTGTGGGTGG - Intergenic
1052137561 9:24933288-24933310 TTTTATTTATTTAATTTGGAAGG + Intergenic
1054861991 9:69963477-69963499 CCTGATTTTTTTAATGTGTCAGG - Intergenic
1055984138 9:82038747-82038769 CATTATTTATTTACTATGGAAGG + Intergenic
1058217361 9:102251801-102251823 ACTTATTTATTTAAAGTGCCAGG - Intergenic
1058765485 9:108178977-108178999 CCTAATTCACTTAATGCGGGTGG + Intergenic
1059378590 9:113906026-113906048 TCTTAGTTGTTTAAGGTGGGTGG + Intronic
1060166540 9:121422027-121422049 CCTTATTTAGTTCACTTGGGAGG + Intergenic
1186506253 X:10095173-10095195 TTTTATTTATTTAATTTCGGGGG - Intronic
1186961413 X:14740629-14740651 ACTTGTTTATTTAATGTCTGTGG - Intergenic
1189626925 X:42908548-42908570 CCTTATTTAATAAATGATGGTGG - Intergenic
1190136319 X:47802481-47802503 GCTTATTGATTTCATGTAGGAGG - Intergenic
1190540971 X:51478672-51478694 GCTTATTGATTTCATGTAGGAGG - Intergenic
1190577720 X:51857985-51858007 TCTTATTAATGTAATGTGTGTGG + Intronic
1192129216 X:68532080-68532102 CCTTATTTGTCTAATTTTGGAGG + Exonic
1193081109 X:77407059-77407081 CCTTATTTAATAAATGTTGTTGG - Intergenic
1194375641 X:93129802-93129824 CCTTATGTATTTATTTTTGGTGG - Intergenic
1194632484 X:96302520-96302542 CCTAATTTATTTTATGAGGCTGG + Intergenic
1194722658 X:97358408-97358430 GAATATTTATTTATTGTGGGAGG - Intronic
1195448923 X:104987526-104987548 CCTTACTTATTTAATCAGTGAGG + Intronic
1195849002 X:109263315-109263337 GCTTATTTAGTTCATTTGGGAGG + Intergenic
1196027588 X:111057346-111057368 CCTTAATTATTGAATCTAGGTGG - Intronic
1196724197 X:118881319-118881341 GCTTTTTTATTTAATGTGTATGG + Intergenic
1196860322 X:120021002-120021024 CCTTATTTATTTATTTTGAGAGG + Intergenic
1197025449 X:121743224-121743246 TCTTATTTATTTTATCAGGGAGG + Intergenic
1198140800 X:133801052-133801074 CCTAATTCATTTACTGGGGGTGG - Intronic
1199487422 X:148363177-148363199 CCTTATTTATAAAATGAGAGGGG + Intergenic
1200582006 Y:4962370-4962392 CCTTTTTTTTTTTTTGTGGGGGG + Intergenic
1201369796 Y:13251184-13251206 ATTTATTTATTTAATATAGGTGG - Exonic
1201520305 Y:14865979-14866001 CCCTATTTAATAAATGTGTGGGG + Intergenic