ID: 1030968814

View in Genome Browser
Species Human (GRCh38)
Location 7:116027647-116027669
Sequence CATCTAAGGAAGCTGAGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030968814 Original CRISPR CATCTAAGGAAGCTGAGCAT TGG Intronic
902553731 1:17234601-17234623 CAGATAAGGAAGCTGAGGCTTGG + Intronic
902778621 1:18690532-18690554 CAGCTAAGGAGGCTGAGCAGGGG + Intronic
903885396 1:26538060-26538082 CATCTTAGGAAGCTGAGTCAAGG - Intronic
904209509 1:28877439-28877461 CATCCCTGGAAGCTGTGCATTGG + Intergenic
904497586 1:30895811-30895833 CCTCTAGGGAAGCAGAGCAGGGG + Intronic
905006073 1:34711452-34711474 CATCCAATGAAGTTGAGCAGGGG + Intergenic
905205830 1:36342383-36342405 CATCCCAGGGAGCTCAGCATGGG - Intronic
907297559 1:53465021-53465043 CATCTAAGGGAGGTGGGAATGGG + Intronic
907660943 1:56391953-56391975 CAGCTAAGGAAGCTGTGCACTGG + Intergenic
907831921 1:58072479-58072501 CATATGAGGAAACTGAGGATTGG - Intronic
918345307 1:183602592-183602614 CATCTAAGGAAGCTAAAGCTTGG + Intergenic
918549795 1:185729251-185729273 TATCTAAGGAAACTGAGACTTGG - Intergenic
921320356 1:213932583-213932605 CCTCTGTGGGAGCTGAGCATGGG - Intergenic
922370155 1:224901824-224901846 CATCTTAATAAGCTGAACATTGG + Intronic
923386313 1:233468146-233468168 CATCTAAGGGAATTTAGCATTGG + Intergenic
1063723127 10:8604890-8604912 CAACTAGGGAAGCTCAGCTTTGG + Intergenic
1065354904 10:24830806-24830828 CATTTAAGGAATCTGAGGAATGG - Intergenic
1065810625 10:29439482-29439504 CAACTCAGGAGGCTGAGCCTGGG + Intergenic
1067660203 10:48231540-48231562 CATCTAAGGAGGTTGGGCAAGGG - Intronic
1067701340 10:48575183-48575205 CATCTCCAGAAGCTGAGCAGAGG + Intronic
1068892403 10:62161245-62161267 GATCTCAGGAAGCAGAACATGGG - Intergenic
1070240905 10:74679659-74679681 CATATAAAGAAGATGAGTATAGG + Intronic
1070512557 10:77174883-77174905 CATTAAAAGAAGCTGAGCCTAGG + Intronic
1074600533 10:114908945-114908967 CCTCTAAGGAAGCTCGGCAAGGG - Intergenic
1074772684 10:116743509-116743531 CAGATAAGGAAGCTGAGGATCGG + Intergenic
1074988319 10:118677889-118677911 TATCTAATGAAATTGAGCATAGG - Exonic
1075487634 10:122838589-122838611 GATCTAAGGAATCAGAGCATAGG + Intronic
1076823657 10:132956226-132956248 CATCTCAGCAGGCTGAGCTTAGG - Intergenic
1080389284 11:31829220-31829242 CAGCAAGGGAAGCAGAGCATAGG - Intronic
1080497372 11:32832963-32832985 AATCTAAGGAAGCAGAGCCAAGG + Intronic
1080713599 11:34774529-34774551 CATCTATAGAAGCTGAGACTTGG - Intergenic
1080884111 11:36349731-36349753 CATCTCAGCCAGCAGAGCATAGG - Intronic
1080896121 11:36450018-36450040 AATACAAGGAAGCTGAGGATGGG - Intronic
1083895845 11:65619371-65619393 CAAGTAAGGAAACTGAGCATGGG + Intronic
1086346006 11:85897469-85897491 CATCTAAGGTTGCACAGCATTGG - Intronic
1086977347 11:93149888-93149910 CATCAGAGGAAGCTGAGTAGAGG + Intronic
1087705810 11:101490780-101490802 AATCTAAGAAAGCAGAGAATGGG + Intronic
1088529140 11:110788921-110788943 CAGCTAAGGAAGCTCTTCATTGG - Intergenic
1096158159 12:49353533-49353555 CAGCTAAGGAGGCTGAGATTGGG + Exonic
1096375221 12:51103722-51103744 CACCTCAGGAAGCTCAGCAGTGG - Exonic
1097346257 12:58496602-58496624 CATTTAAGGAAGCAGAGACTTGG + Intergenic
1098251265 12:68571868-68571890 TATCTATGGAAGCTCAGCCTAGG + Intergenic
1099558363 12:84141062-84141084 CATCAAAGGATGCTAAGAATGGG + Intergenic
1101287619 12:103331753-103331775 CCTCTCAGGAGGCTGGGCATTGG + Intronic
1103052925 12:117796631-117796653 CAGCTGAGGAAACTGAGCCTTGG - Intronic
1106029992 13:25991334-25991356 CATTTAAGGAAACTGAGTAAAGG - Intronic
1106847253 13:33749411-33749433 TATATAAGGAACTTGAGCATTGG + Intergenic
1106858774 13:33882135-33882157 CATCAGGGGAAGCTGAGAATAGG - Intronic
1107295896 13:38907255-38907277 CACCTAAGGGAGGTGAGGATGGG + Intergenic
1111861405 13:93711680-93711702 CAGCTAAGGAAGCTGACTCTTGG - Intronic
1112265912 13:97923232-97923254 CATATAAGGAAACTGATGATCGG + Intergenic
1113413894 13:110113223-110113245 CACCTAGGGAGGGTGAGCATTGG + Intergenic
1114415504 14:22540348-22540370 CATCTAAGAAAGCAGAGTAGGGG - Intergenic
1116008112 14:39318852-39318874 CAACTAAGGAAACTGAGGCTAGG - Intronic
1116477446 14:45357722-45357744 CAGCTGAGGAAACTGAGGATCGG - Intergenic
1116832476 14:49735707-49735729 CACTTAAGGAAACTGAGCATTGG + Intronic
1118432681 14:65736788-65736810 CATCTAAGAAAGTTGAGAGTTGG - Intronic
1122057922 14:99117677-99117699 CAGATAAAGAAGCTGAGCTTTGG + Intergenic
1122891059 14:104732474-104732496 CAGCTCAGGACGCTGAGCCTGGG - Intronic
1126424255 15:48508848-48508870 CATCTAAGGAAGGAGAAGATGGG + Intronic
1126705071 15:51398778-51398800 CTTCAAGGGAAGCTGAGCAAAGG - Intronic
1127053090 15:55105260-55105282 CTTTTAAGAAAGCTGAGCACTGG - Intergenic
1129124460 15:73426584-73426606 CATAAAAGGAAGCTGAGAAAAGG + Intergenic
1129247392 15:74287806-74287828 AATCAAAGGAAGCTTAGGATGGG + Intronic
1132021006 15:98362502-98362524 CATTAATGGAAGCTGAGGATGGG - Intergenic
1132890024 16:2199272-2199294 CAGATGAGGCAGCTGAGCATCGG - Intergenic
1137551563 16:49440915-49440937 CATCTCAGGACGCTGAGGCTGGG - Intergenic
1138108853 16:54307347-54307369 CCTCTAAGGGAGCTGAGACTGGG + Intergenic
1139532383 16:67548774-67548796 CATCTCAGGAACCTGGGCATGGG - Intergenic
1140605619 16:76533266-76533288 CATATAAGGAAGCTAAGGAAAGG + Intronic
1141361315 16:83397492-83397514 TCTGTAAGGAAGATGAGCATGGG + Intronic
1141605248 16:85149433-85149455 CATAAAAAGAAGCTGAGCCTGGG + Intergenic
1141658377 16:85428443-85428465 CAGCTAAGCAAGCTGAGGCTTGG - Intergenic
1142037575 16:87871155-87871177 CAAATAAGGAAGCTGAGGCTTGG + Intergenic
1142534407 17:604488-604510 CATCTGAGGCAGGTGAGCACAGG + Intronic
1145398144 17:22512064-22512086 CATCCAAGGAAGGTGAGGAGAGG - Intergenic
1145736265 17:27233977-27233999 CATATGAGGAAGCTGAGGCTTGG - Intergenic
1145884501 17:28372654-28372676 CAGATAAGGAAACTGAGCCTTGG + Intronic
1146015381 17:29228956-29228978 CATCAAAGGAAGATCAGGATGGG + Intergenic
1147571219 17:41572191-41572213 CACCAAAGGACGCTGAGCCTGGG - Intergenic
1148436683 17:47691008-47691030 CATCTGAGAAAGCTGAACATTGG - Intergenic
1149001230 17:51759712-51759734 CATCAAAGGAAGCTCAGGAGAGG - Intronic
1150980867 17:70139980-70140002 TAGCTAAGGAAACTGAGAATTGG - Intergenic
1153065626 18:1041218-1041240 CATTTGAGGAAGCTGAAGATAGG - Intergenic
1155678016 18:28453643-28453665 CATCTAGGGAAGCTTTGGATTGG + Intergenic
1160403531 18:78628992-78629014 GATGTAAGGAAGCTGAGCCGTGG + Intergenic
1161125758 19:2556347-2556369 CAGCTCAGGAAGCTGGGCCTGGG - Intronic
1161558707 19:4958607-4958629 CAACTTGGGAAGCTCAGCATCGG + Intronic
1162131211 19:8527166-8527188 CATCTAAGGATCATGAGCATAGG + Intronic
1164742390 19:30585564-30585586 CATCCAGGGAAGCTGCCCATTGG + Intronic
1167427962 19:49439271-49439293 CAACTAAGGAAACTGAGGCTCGG + Intronic
925098629 2:1227636-1227658 CAGCTGGGGAAGCTGAGCTTGGG + Intronic
925966983 2:9075478-9075500 TATCAAAAGAAGCTGAGCAGTGG + Intergenic
926863407 2:17333251-17333273 AATCAAAGGAAGATCAGCATAGG + Intergenic
927666686 2:25037793-25037815 TATATAAGGAAACTGAGCCTGGG - Intergenic
929928573 2:46234716-46234738 TAGCTAAGGAACCTGAGCCTTGG - Intergenic
930710861 2:54549960-54549982 CATCTCAGTAGCCTGAGCATGGG + Intronic
931326454 2:61230410-61230432 CAGCTAAGGAAGCTGAGGCAGGG + Intronic
932312012 2:70750458-70750480 CTTATAAGGATGCTGACCATTGG - Intronic
935218136 2:100990571-100990593 CAGCTAAGGAAGCAGAGGACAGG + Intronic
935265508 2:101390217-101390239 CTTCTCAGGAGGCTGAGGATGGG - Intergenic
936610020 2:113993230-113993252 CATCAAAGTAAGCTTATCATTGG + Intergenic
936928524 2:117762606-117762628 CAGCTGAGGAAGCTGAGCACAGG + Intergenic
938638425 2:133253686-133253708 CATATAAGGAAACTGAGACTAGG - Intronic
938772928 2:134516128-134516150 CTTCTAAGGAAACTGAGCCTTGG - Intronic
941048747 2:160706711-160706733 CTTGTAAGGGAGCTAAGCATTGG - Intergenic
941623048 2:167800276-167800298 CATACAAGGATGCTGAGCACTGG - Intergenic
942509415 2:176680915-176680937 CTGCTAAAGAAGCTGAGCCTTGG + Intergenic
942899897 2:181102919-181102941 CACCAAAGGAAGCCCAGCATGGG - Intergenic
943216447 2:185043600-185043622 CTTCTAAAGAAGCTAAGCAAAGG + Intergenic
943955755 2:194187412-194187434 CATCTGAGGAAGCTCTTCATTGG + Intergenic
945319321 2:208403723-208403745 CAACTGAGGCAGCTGAGCTTGGG + Intronic
945463386 2:210138552-210138574 TGTCTAAGGAAGCTTAACATTGG + Intronic
946655666 2:221943819-221943841 TAGGTGAGGAAGCTGAGCATTGG + Intergenic
948834795 2:240620683-240620705 CATCACAGGAGGCTGAGCACAGG + Intronic
1169188852 20:3644306-3644328 CATGTGAGGGAGCTAAGCATGGG + Intronic
1175121470 20:56719283-56719305 CAGATGAGGAAGCTGAGCCTTGG + Intergenic
1177404936 21:20654348-20654370 GATGTAAGGATGCTGAACATTGG - Intergenic
1178898315 21:36578859-36578881 CATCAAATGAAACTAAGCATGGG + Intergenic
1180022802 21:45139573-45139595 CAGAGGAGGAAGCTGAGCATGGG - Intronic
1181623944 22:24109615-24109637 CTTTTAAGGTAGCTGAGCAAAGG + Intronic
1181828375 22:25538375-25538397 TATCTATGGGAGCTAAGCATTGG + Intergenic
1182902029 22:33906480-33906502 CAGCTAAGGAAACTGAGGCTTGG - Intronic
1183127026 22:35792639-35792661 CAGATAAGGAAAATGAGCATTGG + Intronic
1183515222 22:38261646-38261668 CAGCTAAAGAGGCTGAGCGTTGG - Intronic
949465925 3:4343621-4343643 CAGCCAAGGTAGCTCAGCATAGG - Intronic
949723588 3:7018575-7018597 CATCAAAGAAGGCTGAGCGTAGG + Intronic
950015894 3:9754721-9754743 CATCTCAGGAAGCTGGGCCTGGG + Exonic
950692582 3:14671941-14671963 AATGTGAGGAAGCCGAGCATGGG - Exonic
951669093 3:25160612-25160634 CCTCTAAGGAGGCTCAGCATGGG + Intergenic
953718425 3:45335296-45335318 GAGCTGAGGAAGCTGATCATGGG + Intergenic
954320170 3:49827187-49827209 CAGATAAAGAAGCTGAGCACAGG + Intergenic
954622687 3:52005013-52005035 CAGATGAGGAAGCTGAGCCTTGG - Intergenic
955559811 3:60176709-60176731 CATCTTACAAAGCTGAGTATTGG + Intronic
960953303 3:123013509-123013531 CATATGAGGAAACTGAGCCTTGG + Intronic
965697786 3:171427469-171427491 CAGCTGAGGAAACTGAGCATTGG - Intronic
966107147 3:176349937-176349959 CATCTACTAAAGCTGAACATAGG + Intergenic
971359800 4:25926641-25926663 CATCAAAGGAAGCTGACTTTTGG - Intronic
971726889 4:30326196-30326218 TACCTAAGGATGCTGAACATAGG + Intergenic
972913586 4:43848561-43848583 CAGATTAGGAAGCTGAGCCTGGG + Intergenic
975183001 4:71368858-71368880 CATCTAAGGGTGCAGGGCATGGG + Intronic
976045382 4:80940425-80940447 CATCTAAGGCAGCATAGCCTAGG - Intronic
978200810 4:106021977-106021999 CATCTATGGATGCTGTGCAGAGG + Intergenic
978448908 4:108807714-108807736 AATATAAGAAAGGTGAGCATTGG + Intergenic
981729982 4:147887055-147887077 CAACTAAGGAAACATAGCATGGG - Intronic
981819537 4:148869627-148869649 CATTTAAGCAATCTGAGGATTGG + Intergenic
982449097 4:155531080-155531102 AAGCTAAGGAAGCTGAACACAGG + Intergenic
982724679 4:158893112-158893134 CAACTAAGAAAGCTGAGGTTCGG - Exonic
984494976 4:180485506-180485528 AATGTGAGGAAGCAGAGCATAGG + Intergenic
987710282 5:21495515-21495537 AATTTAAGGAGGCTGGGCATAGG + Intergenic
988749331 5:34178658-34178680 AATCCAAGGAGGCTGGGCATAGG - Intergenic
989455606 5:41639939-41639961 CCTCCAAGGAAGGTGAGCATGGG + Intergenic
990315956 5:54583612-54583634 TACATAAGGAAGCTAAGCATTGG - Intergenic
990338112 5:54794795-54794817 CATCAAAGGAAGCTGGGTGTGGG + Intergenic
990807161 5:59677454-59677476 CATCTAGGGCAGATGAGCAATGG + Intronic
991737586 5:69641850-69641872 AATCCAAGGAGGCTGGGCATAGG - Intergenic
991760608 5:69914575-69914597 AATCCAAGGAGGCTGGGCATAGG + Intergenic
991786724 5:70203526-70203548 AATCCAAGGAGGCTGGGCATAGG - Intergenic
991789162 5:70221576-70221598 AATCCAAGGAGGCTGGGCATAGG - Intergenic
991813912 5:70496682-70496704 AATCCAAGGAGGCTGGGCATAGG - Intergenic
991817043 5:70517966-70517988 AATCCAAGGAGGCTGGGCATAGG - Intergenic
991839839 5:70789625-70789647 AATCCAAGGAGGCTGGGCATAGG + Intergenic
991879169 5:71203911-71203933 AATCCAAGGAGGCTGGGCATAGG - Intergenic
991881609 5:71221940-71221962 AATCCAAGGAGGCTGGGCATAGG - Intergenic
992638484 5:78748155-78748177 CACCAATGGAAGCTGAGCAAGGG + Intronic
994460136 5:100061920-100061942 AATCCAAGGAGGCTGGGCATAGG - Intergenic
994484284 5:100375345-100375367 AATCCAAGGAGGCTGGGCATAGG - Intergenic
994719657 5:103366139-103366161 CATATTAGGAGGCTGAGCTTTGG - Intergenic
995123333 5:108558130-108558152 CGTTTTAGGAGGCTGAGCATGGG - Intergenic
995517430 5:112968054-112968076 CATTTAAGGAAGCTGAGGTTGGG - Intergenic
996546381 5:124683158-124683180 CATGTAAGGAAGCTTAGAAGTGG + Intronic
996870908 5:128192468-128192490 CATAGAAGGCAGCTGAGCTTAGG + Intergenic
997464810 5:134080118-134080140 CATCAAAGCCGGCTGAGCATTGG + Intergenic
999275583 5:150327795-150327817 CATCTAAGGAAACTGAGGCACGG + Intronic
1001267245 5:170282748-170282770 CAGATAAGGAAGCTGAGGCTCGG + Intronic
1002308975 5:178302811-178302833 GTTCTAAGCAAGCTGTGCATAGG + Intronic
1003185161 6:3824083-3824105 CAACTAAGAAAGGTGAGCACAGG - Intergenic
1005314828 6:24594836-24594858 GATCAGAGGAAGCTGAGTATAGG - Intronic
1005384339 6:25271133-25271155 CATCTGAGGCAGCTGTGCAGGGG + Intergenic
1005547405 6:26885004-26885026 AATCCAAGGAGGCTGGGCATAGG - Intergenic
1006856828 6:37139536-37139558 CTCCTAAGGATGCTGAGCCTTGG - Intergenic
1007025918 6:38573869-38573891 CATCTAAGAAAGCTGTGGAAAGG + Intronic
1007689538 6:43690810-43690832 CTTCTACTAAAGCTGAGCATAGG - Intergenic
1007695262 6:43728198-43728220 CTACTCAGGAAGCTGAGCCTGGG + Intergenic
1008258077 6:49329309-49329331 CATCTAAGAAAGATTAGCTTAGG - Intergenic
1008779146 6:55081201-55081223 AATCAAAGAAAGCTGAGCTTTGG + Intergenic
1008824974 6:55683080-55683102 GATCTAAGGAGGCAGAGCTTAGG - Intergenic
1009995518 6:70891129-70891151 CACCTCAGGAATCTGAGGATTGG - Intronic
1010396956 6:75403902-75403924 CATCTAACGAATATGAGCATTGG - Intronic
1010743377 6:79533846-79533868 TATCTAAAGAAGCTGAGCACAGG - Intronic
1012269959 6:97196938-97196960 CATCTAATAAAAGTGAGCATGGG + Intronic
1015680522 6:135802686-135802708 CAGCGAAGGAAGCTATGCATGGG - Intergenic
1015827128 6:137326020-137326042 CAGATAAGGAAGCTGAGGATAGG - Intergenic
1016550509 6:145274531-145274553 TATCTGAGGAAGCTGAGGCTTGG - Intergenic
1017191491 6:151658804-151658826 CAGATAAGGAAGCTGAGGCTTGG + Intronic
1018704975 6:166457417-166457439 TTTCTAAGGAAGCTGAGAATGGG + Intronic
1018836555 6:167488634-167488656 CATCTAAGGAAACTGAAGCTTGG - Intergenic
1020760259 7:12260623-12260645 CAACTGAGGTAGCTAAGCATAGG + Intergenic
1022423036 7:30242046-30242068 TATCTAAGTCAGCTTAGCATTGG + Intergenic
1023295276 7:38708317-38708339 CATCCAAGGAGGCTCTGCATAGG - Intergenic
1025927228 7:65969921-65969943 AATCCAAGGAGGCTGGGCATAGG - Intronic
1026426320 7:70297957-70297979 GCTCTAAGAAAGCTGAGCAAAGG - Intronic
1030968814 7:116027647-116027669 CATCTAAGGAAGCTGAGCATTGG + Intronic
1031001749 7:116423752-116423774 AATCAAAGGTAGCTGAGCACAGG + Intronic
1032661969 7:133994041-133994063 CACGAAAGGAAGCTGAACATTGG - Intronic
1033937917 7:146611195-146611217 CTACTCAGGAAGCTGAGCAAGGG - Intronic
1034006558 7:147478562-147478584 TATCTAAGTAATCTGAGCTTTGG - Intronic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1034161369 7:148996309-148996331 CTTTTAAGGAAACTGAGAATTGG - Intergenic
1038772848 8:30499929-30499951 CATCTAAGAAATCTGTGCAAAGG + Intronic
1041183263 8:55270990-55271012 GAGCTAGGGAGGCTGAGCATGGG + Intronic
1042577517 8:70236829-70236851 CATATAAGGGACTTGAGCATTGG + Intronic
1042612101 8:70610283-70610305 TATATAAGGCACCTGAGCATGGG + Intronic
1043062619 8:75524365-75524387 TTTCTAAGGAAGATGAGCTTGGG - Intronic
1045918737 8:107504765-107504787 CAGATAAGGAAGCTGAGCTTAGG - Intergenic
1047898058 8:129388831-129388853 CAACTGAGGCAGCTGAGCAGGGG + Intergenic
1048503874 8:135003341-135003363 CATATGAGGAAACTGAGCCTTGG - Intergenic
1049195443 8:141313212-141313234 TCTCTAAGGAAGCTGGGCAGGGG - Intergenic
1050246723 9:3697736-3697758 CATCAAAAGCATCTGAGCATGGG + Intergenic
1050373400 9:4945849-4945871 CAGCTAAGGAAGCTCTTCATTGG - Intergenic
1050775899 9:9259868-9259890 CATCTAGGGAAGATGAACTTAGG + Intronic
1053397144 9:37785376-37785398 GATCTCTGGAAGCTGAGCAGAGG + Intronic
1056267270 9:84910485-84910507 CATCTAAGGATGCTCGTCATTGG + Intronic
1058110576 9:101028075-101028097 CATCAAAGGAGGCTTAGTATGGG + Intergenic
1185930319 X:4195651-4195673 AATCAAAGGAAGATGAACATCGG + Intergenic
1188028466 X:25236390-25236412 CAAGTAAGGAAGCAAAGCATGGG + Intergenic
1192342800 X:70277991-70278013 CATCTAAGGACACTGAGCTGGGG + Intronic
1195719177 X:107849555-107849577 CATCTGAGAAAGCTGGGCACAGG - Intronic
1199673400 X:150165199-150165221 CATCTAAACAAGATGAGCCTCGG - Intergenic
1201710139 Y:16982274-16982296 AATCAAAGGAAGATGAACATTGG + Intergenic