ID: 1030969334

View in Genome Browser
Species Human (GRCh38)
Location 7:116034941-116034963
Sequence GTTTCAGTGGGGGAAGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 453}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030969334 Original CRISPR GTTTCAGTGGGGGAAGATGG GGG (reversed) Intronic
900120068 1:1045069-1045091 GTGACAGTGGGGGTAGGTGGAGG + Intronic
900841105 1:5049304-5049326 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
900861308 1:5234397-5234419 GTGGCAGTGGGGGCAGATGATGG - Intergenic
901010970 1:6201935-6201957 GTTTGAGTGTGGGGAGGTGGGGG - Intronic
901721747 1:11204090-11204112 GTTTGACTGGGGCAGGATGGAGG - Intronic
901833162 1:11906413-11906435 GTTGCAGAGGGGGAAGCTGAAGG + Intergenic
902071898 1:13747180-13747202 ATTTCAGTGGGGGAATATATGGG + Intronic
902104908 1:14026870-14026892 GGTTCTGTGGGGGATCATGGAGG + Intergenic
902242622 1:15099098-15099120 AGTTCACTGGGGGAAGAGGGTGG + Intronic
902429541 1:16352408-16352430 GTTTGAGTGGAGGAAGATGGCGG - Exonic
902569906 1:17340611-17340633 GTTAAAGTGGGGGATGAGGGTGG + Intronic
902970055 1:20041789-20041811 GTTTCAGTGGGGGAGTAGGTGGG + Intronic
903314259 1:22488809-22488831 GTAGCAGTAGGGGAGGATGGAGG + Intronic
904757450 1:32775942-32775964 GACTCAGTGGTGGAAGAAGGGGG + Exonic
904761151 1:32805153-32805175 GTTGCAGTGAGCCAAGATGGCGG + Intronic
904836231 1:33338868-33338890 GCTTCGGTGGGGGAAGGGGGAGG + Intronic
906132746 1:43470732-43470754 ATTTCACTGGTGGATGATGGTGG + Intergenic
907145599 1:52228138-52228160 GTTGCAGTGGGCCATGATGGTGG - Intronic
907429491 1:54404009-54404031 GTTTTAGTGGGGGAGGGGGGCGG + Intronic
907438429 1:54463908-54463930 GGTGCAGTGGGGGGTGATGGAGG + Intergenic
907776847 1:57524151-57524173 CTTTCGGTGGGGGAAGGTGAAGG + Intronic
907842802 1:58173161-58173183 GTTTCAGTTGGGGAATACTGGGG - Intronic
908530739 1:65031191-65031213 TTTACAGTGGGGAAATATGGTGG + Intergenic
908790699 1:67778588-67778610 GTTTAATTGGGGTAAGATGGGGG - Intronic
910037052 1:82801168-82801190 CTTTCAGTGGGTGGAGAAGGGGG + Intergenic
910750803 1:90628019-90628041 GTTTTAGAGGGGGAACATAGGGG + Intergenic
912939211 1:114030308-114030330 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
914878846 1:151532395-151532417 GTTTCAGTTGGAGAAGATCGGGG + Exonic
914901720 1:151714719-151714741 CTTTCAGAGAGGGGAGATGGAGG - Intronic
914995969 1:152543605-152543627 AATTCAGTGGGGGCAGTTGGAGG + Intronic
915249064 1:154575886-154575908 GTCTGAGTGGAGGAAGGTGGTGG - Exonic
915646243 1:157274726-157274748 GTTTTAGTGGGGGAGTATTGAGG + Intergenic
916329114 1:163595014-163595036 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
916474044 1:165151401-165151423 GTTGCAGTGGAGAAACATGGTGG - Intergenic
916673440 1:167045498-167045520 GTTTCAGTGAGCCAAGATCGTGG + Intergenic
916800168 1:168208536-168208558 GTTGCAGTGAGCGGAGATGGCGG + Intergenic
917034337 1:170730354-170730376 TTGTCAGAGGGGGAAGAGGGTGG + Intronic
917135607 1:171785761-171785783 GTCACAGTTGGGGAAGATGCTGG + Intronic
917280338 1:173373395-173373417 GTTTCAGTTGGGGAATACTGGGG - Intergenic
917385622 1:174470703-174470725 GTTACAGTGAGCCAAGATGGCGG + Intronic
917397390 1:174608554-174608576 ATTTCAGTAGGGGAAAATGTGGG + Intronic
917418706 1:174839092-174839114 GTATCTGTGGGGGAAGAGGATGG + Intronic
917516009 1:175709046-175709068 GCCTCACTGGGGGAAGATGAAGG + Intronic
918087343 1:181256911-181256933 GTCTCAGAGGGAGAAGCTGGTGG + Intergenic
918219676 1:182425675-182425697 GTTGCAGTGAGGCAAGATAGTGG - Intergenic
919977740 1:202623582-202623604 GATTGAGTGGGGACAGATGGAGG + Intronic
920426999 1:205886351-205886373 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
921069790 1:211649448-211649470 GTGTCCTTGGGGGAAGCTGGGGG + Intergenic
922368827 1:224889894-224889916 GTTTCAGTGGGAGAATATGTGGG - Intergenic
922617575 1:226971488-226971510 GTTGCAGTGAGCCAAGATGGCGG + Intronic
922702926 1:227772283-227772305 GTTTCTGTGCAGGATGATGGTGG - Intronic
922769964 1:228176400-228176422 GTTTCATTTGGGGGAGAGGGAGG + Exonic
922873688 1:228923258-228923280 CTGTCAGTGGTGGGAGATGGTGG + Intergenic
923136489 1:231124599-231124621 GTGTCTGTGGGGGAAGGAGGAGG + Intergenic
923271341 1:232357915-232357937 GATTCAGTGGGGGCAGTTGCTGG + Intergenic
923973009 1:239226577-239226599 GTCTCAGTGGGGGATGAAGCTGG + Intergenic
924088787 1:240481646-240481668 GTTTCATCGGGGGAAGAGGGAGG + Intergenic
924823993 1:247521451-247521473 GTTGCAGTGAGCCAAGATGGCGG - Intronic
1063776904 10:9273912-9273934 GTTGCAGTGAGCGGAGATGGCGG + Intergenic
1064516492 10:16154891-16154913 GTTGCAGTGGGCCAAGATTGTGG - Intergenic
1065377177 10:25055137-25055159 ATTTTAGTGGGGGGAAATGGTGG - Intronic
1065437969 10:25721119-25721141 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1065952765 10:30667156-30667178 GTTTCACTTTGGGAAGTTGGTGG + Intergenic
1067360669 10:45575281-45575303 GTTTCAGTGGGGGAGTAGGTGGG - Intronic
1068500756 10:57838209-57838231 GTTTCAGTTGGGGAATACTGGGG - Intergenic
1070556602 10:77532661-77532683 GTTTCCATGGGGGAAGAGGGTGG + Intronic
1070893780 10:79964466-79964488 GTTTCAGTGGGGGAGTAGGTGGG - Intronic
1071228599 10:83560644-83560666 CTTTCAGTGAGGTCAGATGGTGG + Intergenic
1072615396 10:97046269-97046291 GATTCAGTGGGTGTAGATAGGGG - Intronic
1073444856 10:103574563-103574585 AGGTCAGTGGGGGAGGATGGAGG + Intronic
1073481559 10:103789160-103789182 TCGTCAGTGGGGGAGGATGGGGG + Intronic
1073767362 10:106697521-106697543 ATTTCAGTATGGGAAGATGTAGG + Intronic
1076324972 10:129614056-129614078 GTTTCCCTGTGGGAAGATGAGGG - Intronic
1077118654 11:896822-896844 GTTTCTGTGGTGGAGGCTGGGGG - Intronic
1077329473 11:1977611-1977633 GCTTCAGTTTGGGAAGAGGGAGG + Intronic
1077493695 11:2874632-2874654 CTTTCAGTGAGGGAAAATTGAGG + Intergenic
1077924096 11:6663282-6663304 GTGGTAGTGGGGGAAGAAGGTGG + Intergenic
1078832935 11:14993424-14993446 TATCCAGTGGGGGAAGAGGGGGG + Intronic
1079982136 11:27162537-27162559 GTTCCTGTGGTGGAAGAGGGTGG - Intergenic
1081567648 11:44269889-44269911 TTTTCTGTGGGGGAAGCTGGGGG + Intronic
1081844740 11:46231833-46231855 GTTGCAGTGGGGAGAGAGGGAGG + Intergenic
1082008541 11:47435135-47435157 GTTGCAGTGAGCCAAGATGGAGG + Intergenic
1082166605 11:48956451-48956473 GTTGCAGTGAGCCAAGATGGCGG + Intergenic
1082197430 11:49322693-49322715 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1083296174 11:61716850-61716872 GTGTGGGTGGGGGAAGAAGGAGG + Intronic
1083333334 11:61909218-61909240 ATATCAGTGAGGGAAGTTGGGGG + Intronic
1083764963 11:64837278-64837300 GTTTCCCCAGGGGAAGATGGTGG + Intronic
1085332620 11:75666899-75666921 GTTCCAGCGGTGGAAGGTGGGGG + Intronic
1086550552 11:88047830-88047852 GTTTCAGTGGGGGAGTATGTGGG - Intergenic
1086658386 11:89385431-89385453 GTTTCAGTGGGGGAGTAGGTGGG - Intronic
1087197230 11:95313963-95313985 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1087487138 11:98770680-98770702 GTTGCAGTGAGCCAAGATGGTGG + Intergenic
1087774802 11:102247494-102247516 GTTTCAGTGAGACAAGATCGTGG - Intergenic
1088050401 11:105507542-105507564 GTTTCAGTGAGCCAAGATTGTGG - Intergenic
1088209134 11:107433728-107433750 GTTTCAGTGGTAGAAGATGGTGG - Exonic
1090131650 11:124148401-124148423 GTTAGAGTTGGGGAAGACGGAGG - Intergenic
1090521934 11:127488907-127488929 ATTTGGGTGGGGGAAGATGGAGG + Intergenic
1202812453 11_KI270721v1_random:32790-32812 GCTTCAGTTTGGGAAGAGGGAGG + Intergenic
1091418879 12:317382-317404 GATTCAGAGGGGGAAGATCATGG - Intronic
1091686962 12:2569459-2569481 GTTGCTGGGAGGGAAGATGGGGG - Intronic
1092389917 12:8067718-8067740 GTTGCAGTGAGCCAAGATGGTGG - Intergenic
1092805828 12:12221421-12221443 GTGTCAGAGAGGGAAGAGGGGGG - Intronic
1095444586 12:42271480-42271502 GTTGCAGTGAGCCAAGATGGTGG - Intronic
1096906944 12:54944660-54944682 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1096916137 12:55035458-55035480 GTTTCAGTAAGTGAAGATAGAGG - Intergenic
1097592681 12:61591318-61591340 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1098803262 12:74988139-74988161 GTTGCAGTGAGCCAAGATGGTGG + Intergenic
1098920264 12:76296280-76296302 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1098956636 12:76695558-76695580 ACTTCAGTGGGGCCAGATGGAGG + Intergenic
1100135021 12:91544263-91544285 ATACCAGTGGGGGAAGCTGGAGG - Intergenic
1100335613 12:93626333-93626355 GTTGCAGTGGGGGTAGAGGGAGG - Intergenic
1100411652 12:94325231-94325253 GTTGCAGTGAGCGGAGATGGTGG - Intronic
1101662305 12:106776496-106776518 GTTTCTGTAGGGGAGGAAGGAGG + Intronic
1102157520 12:110742860-110742882 GTTCCAGTGGGGAGAGAAGGAGG - Exonic
1102172317 12:110851713-110851735 GTTTCAGAGGGCGAAGGTGCAGG - Intronic
1102298555 12:111755483-111755505 GTTTGAGTCTGGGAAGTTGGGGG - Intronic
1103456882 12:121075408-121075430 GTTTCAGTGAGCCGAGATGGCGG - Intergenic
1103486720 12:121288133-121288155 GATGCAGTGGGGGAAGAGGAAGG - Intronic
1105265090 13:18808592-18808614 CTTTGAGTGGGGGAGGTTGGTGG + Intergenic
1105458859 13:20565982-20566004 GTTGCAGTGAGCCAAGATGGTGG - Intergenic
1105840272 13:24248072-24248094 GGTTCAGGGGTGGAAGACGGAGG + Intronic
1106716473 13:32393919-32393941 GTGTGAGTGGGGGAAAAAGGAGG - Intronic
1106782150 13:33070017-33070039 GTGCCTTTGGGGGAAGATGGCGG + Intergenic
1107319874 13:39174952-39174974 GTTTTATTGGTGGAACATGGTGG - Intergenic
1108702958 13:52959198-52959220 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1109555297 13:63966358-63966380 TTTTAATTGGGGGAAGACGGAGG + Intergenic
1109862285 13:68216030-68216052 ATTTTTGTGGGGGAGGATGGTGG - Intergenic
1110299275 13:73907296-73907318 GGCTCAGTGAGGGAAGAAGGGGG - Intronic
1110506574 13:76294760-76294782 GTTGCAGTGGGTTGAGATGGCGG - Intergenic
1110638806 13:77797540-77797562 GATTCAGAGGGGAAAGATGCAGG - Intergenic
1111230762 13:85341431-85341453 GTTGCAGTGAGCCAAGATGGAGG + Intergenic
1112070701 13:95846350-95846372 GTTGCAGTGAGCCAAGATGGCGG + Intronic
1112077430 13:95929119-95929141 GTTGCAGTGAGCCAAGATGGAGG + Intronic
1113551023 13:111193245-111193267 GTTTCAGTTGGGGAATACTGGGG + Intronic
1114061162 14:19016729-19016751 CTTTCAGTGGGTGAGGTTGGTGG - Intergenic
1114101092 14:19383250-19383272 CTTTCAGTGGGTGAGGTTGGTGG + Intergenic
1115271108 14:31554224-31554246 GTTTTTGTGGGGGAACATGCTGG - Intronic
1115292669 14:31790520-31790542 GTTTCAGTTTGAGAAGATGAAGG - Intronic
1115648063 14:35384026-35384048 GTTTCAGGAGAGGAAGAGGGTGG + Intergenic
1115901667 14:38158039-38158061 GTCTCAGTGGGGGGCGGTGGTGG - Intergenic
1116457318 14:45134450-45134472 GAGGCAGCGGGGGAAGATGGCGG - Exonic
1116544121 14:46141480-46141502 GTTTCACAGGGGGAAAATGAGGG - Intergenic
1116697816 14:48199998-48200020 GTTTCAGTCGGGGAATACTGGGG - Intergenic
1116959779 14:50957157-50957179 GTTGCAGTGAGCGGAGATGGCGG + Intergenic
1117010776 14:51468216-51468238 GTTGCAGTGAGCGGAGATGGTGG + Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119159874 14:72443927-72443949 GCCTCAGTGCAGGAAGATGGAGG - Intronic
1119542736 14:75451305-75451327 GTGACAGTGGGGGTGGATGGGGG + Intronic
1119722178 14:76898793-76898815 GTTGCAGTGAGCCAAGATGGCGG + Intergenic
1120189076 14:81423625-81423647 GTTTTGTTGGGGGAAGAGGGAGG - Intronic
1120505937 14:85353395-85353417 GTTGCAGTGAGCCAAGATGGCGG + Intergenic
1121231429 14:92361747-92361769 GTTTGGGTGGGGCAGGATGGTGG + Intronic
1122332813 14:100936199-100936221 CTGTCAGTGTTGGAAGATGGTGG + Intergenic
1202906498 14_GL000194v1_random:76632-76654 CTTTCAGTGGGTGAGGTTGGTGG - Intergenic
1124493386 15:30171946-30171968 GATTGAGTGGGGACAGATGGAGG + Intergenic
1124750148 15:32366379-32366401 GATTGAGTGGGGACAGATGGAGG - Intergenic
1125600038 15:40910513-40910535 GGTGCAGTGGGGGATGCTGGGGG - Intergenic
1125915750 15:43485779-43485801 GTTGCAGTGAGCCAAGATGGTGG + Intronic
1126532327 15:49724916-49724938 GTTTTAGTGGGGGATGCTGGGGG - Intergenic
1126573031 15:50172213-50172235 GTTGCAGTGAGCGGAGATGGCGG - Intronic
1126704947 15:51397873-51397895 GTTTCAGGGGGGAGGGATGGCGG - Intronic
1126815795 15:52452120-52452142 TTTTCAGTGGGGGGAGGGGGTGG - Intronic
1128020697 15:64387848-64387870 GTTCCGGCTGGGGAAGATGGCGG + Exonic
1128336808 15:66791941-66791963 GTTTCAGTGGGGAGGGATTGAGG - Intergenic
1129592869 15:76932300-76932322 CTATCAGTGGGGCAAAATGGTGG - Intronic
1129946620 15:79543943-79543965 GTTTTAGTGAGGGAGGATGGGGG - Intergenic
1130284494 15:82543619-82543641 TTTTCGGTGGGGGCAGATGAAGG - Intronic
1130849166 15:87777188-87777210 GCTTCAGCAGGGCAAGATGGGGG - Intergenic
1131778778 15:95831470-95831492 GTTGCAGTGAGCCAAGATGGTGG - Intergenic
1132050383 15:98602774-98602796 GTTGCAGTGAGCCAAGATGGTGG + Intergenic
1132380029 15:101359983-101360005 ATTGCAGGGGGGGAAGATGCTGG - Intronic
1132424758 15:101706023-101706045 GTTGCAGTGAGCCAAGATGGTGG - Intronic
1133028299 16:2998046-2998068 GTCTCAGTGGGGGAAGGGGTGGG + Intergenic
1133937640 16:10282094-10282116 GTTTCTATGGGGGAAAATGAGGG - Intergenic
1134911712 16:18033055-18033077 TTTCCAGGGGAGGAAGATGGAGG - Intergenic
1135092297 16:19527866-19527888 GTGTGACTGTGGGAAGATGGAGG + Exonic
1136384464 16:29914498-29914520 TTTTCAGTGAGGTGAGATGGTGG - Intronic
1136716733 16:32288165-32288187 GTGTCAGTGTGGGAAGCTGAGGG + Intergenic
1136835109 16:33494410-33494432 GTGTCAGTGTGGGAAGCTGAGGG + Intergenic
1137398828 16:48136424-48136446 TATTCTATGGGGGAAGATGGAGG - Intronic
1137584991 16:49658899-49658921 GTTCCAGTGGGAGGAGGTGGTGG - Intronic
1139294480 16:65888305-65888327 GTCTGAGTGGGTGGAGATGGTGG + Intergenic
1140081292 16:71749853-71749875 GGTTAAGTGGGGGAAAATAGTGG - Intronic
1140171542 16:72610103-72610125 GTTTCAGTGGAGAAAGGTTGGGG + Intergenic
1140227510 16:73090329-73090351 GTTGCAGTGGGCTGAGATGGTGG + Intergenic
1141109395 16:81259577-81259599 GTTTTACTGGGAGAAGAAGGTGG - Intronic
1141417182 16:83884784-83884806 GTGGCAGTGGGACAAGATGGTGG - Intergenic
1142318129 16:89362196-89362218 GTTTCAGAAGGGGAAGAAGAAGG - Intronic
1203009694 16_KI270728v1_random:229622-229644 GTGTCAGTGTGGGAAGCTGAGGG - Intergenic
1203145282 16_KI270728v1_random:1794731-1794753 GTGTCAGTGTGGGAAGCTGAGGG + Intergenic
1143371153 17:6440257-6440279 TTCTGAGTGAGGGAAGATGGTGG + Intergenic
1143601968 17:7952898-7952920 GTTTCACAGGGTGTAGATGGGGG + Intergenic
1145841890 17:28002022-28002044 TTTTAAGTGGGTGCAGATGGAGG + Intergenic
1145938405 17:28728115-28728137 CTTCCCATGGGGGAAGATGGGGG - Intronic
1146045149 17:29499291-29499313 GTTGCAGTGGGTCAAGATTGTGG - Intronic
1146310957 17:31767993-31768015 GTTTCAGTTGGGGAATACTGGGG - Intergenic
1147292033 17:39451239-39451261 AGTTCCGTTGGGGAAGATGGCGG - Exonic
1149359865 17:55883769-55883791 GTTGCAGTGAGCTAAGATGGCGG - Intergenic
1149449108 17:56735662-56735684 GCTTCAGTGGAGGCAGATGGGGG + Intergenic
1150586621 17:66524105-66524127 GTGTGAGTGGGAGGAGATGGGGG + Intronic
1150780428 17:68116905-68116927 GTTGCAGTGAGCCAAGATGGCGG + Intergenic
1203165134 17_GL000205v2_random:86943-86965 GTATCACTGGGGGAAGAGGCGGG - Intergenic
1153751091 18:8231368-8231390 GTTTCAGAGCGGGAAACTGGAGG + Intronic
1154134307 18:11762267-11762289 TTTTCAGTGGGGCCACATGGAGG + Intronic
1154205379 18:12331730-12331752 GTTGCAGTGAGCCAAGATGGAGG + Intronic
1155748276 18:29388690-29388712 ATTTTGGTGGGGGAGGATGGGGG - Intergenic
1155838877 18:30623272-30623294 GTTTCAGTGAGGGGAGATACAGG + Intergenic
1156302603 18:35848582-35848604 GTTTCAGTGGGGGACTAGGTGGG - Intergenic
1157245988 18:46055718-46055740 CTTTCACTGGGGGAAGGTGCAGG - Intronic
1158162833 18:54505613-54505635 CTTCTAGTGGGGAAAGATGGGGG + Intergenic
1158278562 18:55795293-55795315 GTTTTAGAGGTGGAAGAAGGAGG - Intergenic
1160436212 18:78854632-78854654 TCTTCAGTGGGTGATGATGGGGG - Intergenic
1160436301 18:78855295-78855317 TTTCCAGTGGGTGATGATGGGGG - Intergenic
1161171089 19:2812844-2812866 ATTTCAGTGGGGGCTGATGGCGG + Intronic
1161200978 19:3014609-3014631 GCTTTCCTGGGGGAAGATGGGGG + Exonic
1162783757 19:13021497-13021519 GTTTCAGTTGGGGAAGAAAGGGG + Intronic
1163944137 19:20520309-20520331 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1164153291 19:22572695-22572717 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1164168692 19:22703780-22703802 GTTGCAGTGAGCGGAGATGGCGG + Intergenic
1164202165 19:23027899-23027921 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1165865095 19:38932072-38932094 GTTGCAGTGGGCCAAGATTGAGG + Intronic
1165894890 19:39135787-39135809 GGGTCACTGTGGGAAGATGGGGG - Intronic
1165898594 19:39157544-39157566 ACTTCAGTGGGAGAAGGTGGGGG - Intronic
1166055824 19:40287924-40287946 GTTTCAGTGAGCCGAGATGGCGG - Intergenic
1168006704 19:53495747-53495769 GTTGCAGTGAGCCAAGATGGGGG + Exonic
1168211803 19:54896087-54896109 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1168248575 19:55127474-55127496 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
926290614 2:11526615-11526637 GTTGCAGTGAGCCAAGATGGCGG - Intergenic
926681113 2:15664959-15664981 GTCTCAGAGGGGGAAGAGAGAGG + Intergenic
926933250 2:18061742-18061764 GTTTCAGTAGAGTAACATGGAGG + Intronic
927086565 2:19678515-19678537 GCTGGAGTGGGGGAACATGGAGG - Intergenic
927134465 2:20086673-20086695 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
929887972 2:45895338-45895360 GTTTCAGTCGGGGAAGAAAGTGG + Intronic
931344511 2:61433763-61433785 GTTTCACTGGGGGTAGGTGGGGG - Intronic
931433965 2:62231515-62231537 ATTTGAGTGGGGGAATGTGGGGG - Intergenic
931434604 2:62235715-62235737 GTTTCAGGGTGGGAATCTGGAGG - Intergenic
932441151 2:71736478-71736500 GTTTCTGCTGGGGAAGATGGTGG - Intergenic
932533315 2:72562483-72562505 GTTTCAGCTGGGGCAGAGGGAGG + Intronic
932682121 2:73835290-73835312 GTTTCAGTGAGCCAAGATCGCGG + Intronic
936506601 2:113112651-113112673 GGGTCAGAGGAGGAAGATGGAGG - Intronic
936802506 2:116285496-116285518 GTTTCAGTCGGGGAATACTGGGG - Intergenic
937713029 2:124999353-124999375 GTTTTGGTGGGGACAGATGGTGG + Intergenic
938093526 2:128447911-128447933 GTTACAGTGGGGGCAGGTGGGGG + Intergenic
938093566 2:128448023-128448045 GTTACAGTGGGGGCAGGTGGGGG + Intergenic
938093593 2:128448097-128448119 GTTACAGTGGGGGCAGGTGGTGG + Intergenic
938331741 2:130452992-130453014 CCTTCAGTGGGTGAAGCTGGTGG + Intergenic
938332182 2:130455620-130455642 CCTTCAGTGGGTGAAGCTGGTGG + Intergenic
938358617 2:130670960-130670982 CCTTCAGTGGGTGAAGCTGGTGG - Intergenic
938435004 2:131277626-131277648 CCTTCAGTGGGTGAAGCTGGTGG - Intronic
939889824 2:147723321-147723343 GTCTCAGCGGGGGTGGATGGAGG + Intergenic
940058311 2:149536641-149536663 GATAGAGTGGGGGAAGATGGGGG + Intergenic
940508506 2:154584723-154584745 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
941455821 2:165711377-165711399 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
941496194 2:166207500-166207522 GTTGCAGTGAGCCAAGATGGTGG - Intronic
943061869 2:183048228-183048250 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
943412615 2:187561740-187561762 GTTTCAGTGGGGGAATAGGTGGG + Intronic
943436672 2:187872524-187872546 GTTTCAGATGAGGAAGATGGGGG + Intergenic
943952326 2:194146807-194146829 GTGTCAGTGGAGGCAGAAGGGGG + Intergenic
944265271 2:197717658-197717680 GTTGCAGTGAGCCAAGATGGCGG + Intronic
944502072 2:200372234-200372256 CTTACAGTTCGGGAAGATGGGGG - Intronic
944986974 2:205188444-205188466 GTTTCAGTGATGGAGGGTGGAGG + Intronic
947101623 2:226627332-226627354 CTTTCAGTGGTGGAGGAGGGAGG + Intergenic
947842474 2:233216904-233216926 GTTTCAGTGGGGGAGTAGGTGGG + Intronic
1171032832 20:21692391-21692413 GCTTCAGTGGGGGAGGACTGTGG - Intergenic
1171059241 20:21940290-21940312 GTTTCAGTGAGCCAAGATTGCGG - Intergenic
1172321240 20:33996738-33996760 ATTTCAGTTGGGGAAGATAATGG - Intronic
1173749564 20:45466796-45466818 GTTGCAGAGAGGGAGGATGGTGG + Intergenic
1173841776 20:46162116-46162138 CTTTCAGTGGGGGAGGCTGTGGG - Intergenic
1174021545 20:47534100-47534122 GTTTCAGTGGGGGGGGCGGGGGG + Intronic
1174530052 20:51204467-51204489 GATGCAGTCGGGGAAGATGTTGG + Intergenic
1174588980 20:51630238-51630260 GAATCATTGGGGGAAAATGGGGG - Intronic
1175261639 20:57678274-57678296 GTACCATTGGGGGAAGCTGGAGG + Intronic
1176406616 21:6372148-6372170 GTATCACTGGGGGAAGAGGCGGG + Intergenic
1176625846 21:9091431-9091453 CTTTCAGTGGGTGAGGTTGGTGG - Intergenic
1176850170 21:13907057-13907079 CTTTAAGTGGGGGAGGTTGGTGG + Intergenic
1178357568 21:31921441-31921463 GCTTGAGTGGGGGAAGGGGGTGG + Intronic
1179520189 21:41938504-41938526 GTTTCAGTTTGGGAAGATGCAGG - Intronic
1180479647 22:15739341-15739363 CTTTCAGTGGGTGAGGTTGGTGG - Intergenic
1181503515 22:23334354-23334376 CTTTCAGTGGCCGAAGAGGGTGG - Intergenic
1182590141 22:31373033-31373055 GTTGCAGTGAGTGAAGATCGCGG - Intergenic
1183228503 22:36566201-36566223 GTTGCAGGGGAGGAAGGTGGTGG - Intronic
1183738505 22:39657136-39657158 GGGGCAGTGGGGGAAGTTGGAGG - Intronic
1184729737 22:46365883-46365905 GGTTGGGTGGGGGAAGGTGGTGG + Intronic
1184729751 22:46365913-46365935 GGTTGGGTGGGGGAAGGTGGTGG + Intronic
1185050849 22:48553310-48553332 GTGTCTGTGGGGGCACATGGAGG - Intronic
1185056183 22:48579458-48579480 GTTAAAGTGGGGGACGAGGGCGG + Intronic
950894938 3:16440264-16440286 GTTTCAGTGAGCCAAGATTGTGG - Intronic
951768890 3:26232413-26232435 GTTTCATTAGAGGAAGATGAGGG - Intergenic
951894930 3:27601588-27601610 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
952467876 3:33610351-33610373 GTTTCAGTGGGAAAAGAAGGTGG - Intronic
953409929 3:42685143-42685165 TATTCCGGGGGGGAAGATGGAGG + Intergenic
953440279 3:42910277-42910299 GTTGCAGTGAGTCAAGATGGCGG + Intronic
953441368 3:42920857-42920879 GTTGCAGTGAGCCAAGATGGTGG + Intronic
954231901 3:49224201-49224223 GTTTCAGTCGGGGAATACTGGGG + Intronic
955067340 3:55544497-55544519 ATATCAGTGGGGGAGGATGACGG + Intronic
955181844 3:56679542-56679564 AATTTTGTGGGGGAAGATGGAGG + Intronic
956233203 3:67040038-67040060 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
957451764 3:80389319-80389341 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
957831637 3:85529645-85529667 GCTTCAGTGGTGGCAGCTGGAGG - Intronic
957904482 3:86539260-86539282 GTTTCAGTTGGGGAGTATGTGGG + Intergenic
958422311 3:93942581-93942603 GTTTCAGTGGGGGAATAGGTGGG - Intronic
958751348 3:98195805-98195827 GTTTCAGTGGGGGAGTAAGTGGG - Intronic
959610216 3:108285454-108285476 GCTTCAGCAGGGGAAAATGGGGG - Intergenic
960233049 3:115251471-115251493 GTTTCAGAGGTGGTAGTTGGTGG - Intergenic
960535249 3:118808385-118808407 GTTCCATTGAGGGCAGATGGCGG + Intergenic
961211702 3:125130775-125130797 GTGTGAGTGGGGGAAGGGGGCGG - Intronic
961570978 3:127798636-127798658 ATTTGAGTGGGGGAAACTGGGGG - Intronic
962235128 3:133700757-133700779 GTGTCTGAGGGTGAAGATGGTGG - Intergenic
963887770 3:150600961-150600983 GTTTCAGTGGGGGAGTAGGTGGG - Intronic
963925266 3:150944467-150944489 TTTTCAGAGGGGAGAGATGGGGG + Intronic
963935379 3:151046913-151046935 GTTCCAGAGCTGGAAGATGGAGG - Intergenic
963945733 3:151144124-151144146 GTAGCTGTGGGGGAAGCTGGTGG + Intronic
964916546 3:161848247-161848269 GTTTCAGTTGGGGAATAATGGGG + Intergenic
965335473 3:167427430-167427452 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
965836050 3:172854177-172854199 ATTTCAGAGGGGGAAGAGGAAGG - Intergenic
966397300 3:179516771-179516793 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
966622856 3:181984522-181984544 GTTTCAGAGGGGAAAGACAGAGG + Intergenic
967487863 3:190055093-190055115 GTTTCTATTGGGGAAGACGGGGG - Intronic
967724792 3:192851554-192851576 GTTTCAGTGAGCCAAGATCGTGG - Intronic
967877504 3:194277163-194277185 GTTTCAGTGGCTGCTGATGGCGG + Intergenic
968385182 4:130010-130032 TTTACAGAGGCGGAAGATGGTGG - Intronic
968654489 4:1772677-1772699 GTTTGACTGGGGGATGAGGGAGG + Intergenic
969506366 4:7590575-7590597 GGTTCTGTGGGTGAGGATGGAGG + Intronic
970342097 4:15118190-15118212 GTGTAAGTGGGGGAAGAGAGTGG + Intergenic
971230764 4:24799109-24799131 ATGTCTGTGGGGGAGGATGGAGG + Intronic
971303235 4:25458908-25458930 GTTGCAGTGAGCCAAGATGGTGG - Intergenic
971810266 4:31416328-31416350 ATTTCAGTGGGCTGAGATGGAGG + Intergenic
972306241 4:37832874-37832896 GACTCAGTGGGGGAAGAGGGAGG - Intronic
974526987 4:63058363-63058385 GTTTCAGTCGGGGAATACTGGGG - Intergenic
974941757 4:68477972-68477994 ATTTCAGTAGGGGAGAATGGTGG - Intronic
976224254 4:82782644-82782666 GTTTTCTTGGGGGAGGATGGGGG - Intronic
976615159 4:87068983-87069005 GGTTCAGGTGGGGAGGATGGAGG + Intronic
976719251 4:88154100-88154122 GTTTCAGTGGGGGAGTAGGTGGG + Intronic
977204528 4:94154336-94154358 GTTTCAGTAGGGGCTTATGGAGG + Intergenic
977323713 4:95549276-95549298 GTTGAAGTGGGGGGAGTTGGAGG + Intergenic
977550695 4:98439944-98439966 GTTTCAGTTTGGGAAAATGAAGG - Intronic
977782139 4:100993126-100993148 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
978224765 4:106320817-106320839 GTTGCAGTGAGTCAAGATGGTGG - Intronic
978895157 4:113878081-113878103 GTTACAGAGGAGGAAGATGCTGG - Intergenic
979780756 4:124648868-124648890 CTTACAGTGGGGCAAGATGTTGG - Intergenic
981094076 4:140760697-140760719 GTTGCAGTGAGCCAAGATGGCGG - Intergenic
981393504 4:144219007-144219029 CTTTCAGTGGGGAATGATGAAGG - Intergenic
983056306 4:163102127-163102149 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
983918316 4:173315972-173315994 GTCTCAGTGAGAGATGATGGTGG - Intronic
983990216 4:174109001-174109023 TTTCCAGTGGTGGAAGATAGCGG - Intergenic
984412077 4:179407817-179407839 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
986179403 5:5379322-5379344 GTTTCAGGGTGGGCAGAGGGAGG - Intergenic
986429807 5:7670215-7670237 CTTTCAGTGGTGAAAGATGGTGG + Intronic
987202030 5:15586990-15587012 ATTGCAGTGGGAGATGATGGTGG - Intronic
988182579 5:27816487-27816509 GGTTCAGGGGGGGAAGGGGGCGG - Intergenic
988199447 5:28050310-28050332 GTTTCAGTGGGGGAGTAAGTGGG - Intergenic
991490475 5:67177936-67177958 GTTGCAGTGAGCCAAGATGGTGG + Intergenic
992167146 5:74065465-74065487 ATTTAAGTGTGGGAAGATGGAGG + Intergenic
992467200 5:77018344-77018366 GAGTCAGTGGGGGAGGATGCTGG + Intergenic
993224776 5:85154107-85154129 CCTTCAGTGGGGCAAGATGTGGG - Intergenic
993672839 5:90783117-90783139 ATTACAGTGGAGGAAGATGTTGG + Exonic
994125786 5:96168144-96168166 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
994231301 5:97312759-97312781 GTTTCAGTTGGGGAATACTGGGG + Intergenic
994621981 5:102174621-102174643 ATTTTAGTTTGGGAAGATGGAGG + Intergenic
995339822 5:111045700-111045722 ATTTCACTGGGGGAGTATGGTGG + Intergenic
995369309 5:111400994-111401016 GTATCAGTGGGGGATAATGTAGG - Intronic
997088984 5:130834147-130834169 GTTGCAGTGAGCCAAGATGGTGG - Intergenic
997157679 5:131576692-131576714 GTTTCAGTGGGAGAATAGGTGGG - Intronic
997582549 5:135026935-135026957 GCTGCAGTGGGGGAGGAAGGAGG - Intergenic
997678488 5:135732779-135732801 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
998012748 5:138708545-138708567 GCTTCGGAGGGGGCAGATGGAGG - Intronic
998111902 5:139508849-139508871 GTTTCAGTCGGGGAATACTGGGG - Intergenic
998151012 5:139757522-139757544 TTTTCTTTGGGGGAAGAAGGGGG - Intergenic
998313165 5:141155169-141155191 GTTGCAGTGGGCCAAGATTGAGG + Intergenic
998713418 5:144851320-144851342 GTTTCAGTCGGGGAATACTGAGG + Intergenic
999052038 5:148533387-148533409 GCTGCAGTGGGAGAAGCTGGTGG - Intronic
999532806 5:152480735-152480757 GTTGCAGTGAGCAAAGATGGCGG + Intergenic
999646404 5:153721313-153721335 GTGTCAAAGGGGGAAGATGTGGG - Intronic
1002003479 5:176213137-176213159 GTTTCTCTGGGGGAAGATGAGGG - Intergenic
1002222977 5:177697779-177697801 GTTTCTCTGGGGGAAGATCAGGG + Intergenic
1003560415 6:7175355-7175377 GTTTCAGTGGGGTGGGATGGGGG + Intronic
1004582883 6:16971529-16971551 TTTACAGTGGTGGAAGCTGGAGG + Intergenic
1005083443 6:21980514-21980536 GTTTCAGAGCAGGAAGAAGGAGG - Intergenic
1007545136 6:42687409-42687431 GTTGCAGTGAGCCAAGATGGCGG + Intronic
1010679379 6:78781544-78781566 GTTTCAGTGGAGGTGGCTGGGGG - Intergenic
1011979070 6:93348879-93348901 GCTTCATTAGGGGAAAATGGCGG - Intronic
1013850335 6:114505884-114505906 GTTGCAGTGAGGCAAGATTGCGG - Intergenic
1016751184 6:147632049-147632071 GTTTCAGTGGGGGAGTAGGTGGG + Intronic
1017012913 6:150075195-150075217 GTTTCTCTGGGGTAATATGGGGG + Intergenic
1017041246 6:150310138-150310160 GGGGCAGTGGGGGAAGGTGGAGG - Intergenic
1017441176 6:154465602-154465624 GTTTCTGTGTTGGAGGATGGGGG - Intronic
1018061874 6:160096508-160096530 GTCACAGTGGAAGAAGATGGTGG - Exonic
1018239510 6:161759290-161759312 GTTACTGAGGGGGAAGATGCAGG - Intronic
1018876621 6:167827173-167827195 GTTCCAGTGGTGGATGATGTCGG - Exonic
1019061962 6:169263210-169263232 GATCCAGAGGGAGAAGATGGTGG - Intergenic
1019526588 7:1483183-1483205 CTGTCAGTGGGGGAAGGGGGCGG - Intronic
1020008717 7:4796630-4796652 TTTGCAGTGGGAGAAGCTGGTGG + Intergenic
1020318817 7:6925736-6925758 GTTTGATTGGGGGATGGTGGAGG + Intergenic
1020846136 7:13286015-13286037 GTTTCAGTGAGCCAAGATGGCGG + Intergenic
1021203729 7:17754273-17754295 GTTGCAGTAGAGCAAGATGGTGG - Intergenic
1021660906 7:22917177-22917199 GTTTCAGTGGGGGAGTAAGTGGG - Intergenic
1021926403 7:25538574-25538596 GTTTTAGTTGGGGCAGGTGGTGG - Intergenic
1021935076 7:25622487-25622509 TTTCCAGTGAGAGAAGATGGTGG - Intergenic
1022043056 7:26598742-26598764 GTTGCAGTTGGAGAGGATGGTGG + Intergenic
1022177861 7:27889281-27889303 GGTTCAATGGGGAAATATGGGGG + Intronic
1023326830 7:39069861-39069883 GTTTCAGGGGTGGCAGATGCAGG + Intronic
1024722602 7:52154354-52154376 GGTTCTGGGGGAGAAGATGGAGG + Intergenic
1024870362 7:53957182-53957204 GTTTCAGTCGGGGAATACTGGGG + Intergenic
1026006767 7:66606210-66606232 GTTGCAGTGAGTGAAGATCGGGG - Intergenic
1026121931 7:67545318-67545340 CCTTCAGTGGTGGAAGAGGGAGG + Intergenic
1026458402 7:70592909-70592931 GTTGCAGTGAGTCAAGATGGTGG - Intronic
1026606389 7:71819587-71819609 GTTTCAGTCTGGGAAGATGAAGG - Intronic
1026673058 7:72406297-72406319 GTTAAATTGGGGGAAGATGGAGG - Intronic
1027791404 7:82641678-82641700 GTTTCAGTTGGGGAATACTGGGG - Intergenic
1028028275 7:85874952-85874974 GTTTTCTTGGGGGAAAATGGTGG + Intergenic
1030163260 7:106529489-106529511 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1030706484 7:112697953-112697975 GTTGCAGTGAGCGGAGATGGCGG + Intergenic
1030969334 7:116034941-116034963 GTTTCAGTGGGGGAAGATGGGGG - Intronic
1033311365 7:140264408-140264430 GTTTCTGTGTGGGAGGAAGGAGG - Intergenic
1033427711 7:141260287-141260309 GTTTCATTGGAGGAAGAGGTGGG + Intronic
1033480925 7:141739575-141739597 TCTTCAGTGTGGAAAGATGGGGG - Intronic
1034422508 7:150996904-150996926 GATCCAGTGGGGGAAGCTGCAGG + Exonic
1035819809 8:2579273-2579295 GTTTTAGATGGGGAAGATGGGGG - Intergenic
1038168133 8:25104345-25104367 GTTTCCGTGGGGGAAAAAAGGGG + Intergenic
1038262930 8:26013324-26013346 GTGTCAGTGGGAGAAGCAGGAGG - Intronic
1038475934 8:27868129-27868151 GTTGTAGTCGGGGGAGATGGTGG + Intergenic
1038699312 8:29835289-29835311 GTTACAGTAGAGGGAGATGGGGG + Intergenic
1039344326 8:36687336-36687358 GTTGGACTGGGGGAAGATGGAGG + Intergenic
1039692756 8:39879968-39879990 GTTTCAGTTGGGGAATACTGGGG + Intergenic
1040649367 8:49431684-49431706 GTTTCAGTTGGGGAATACTGGGG - Intergenic
1040971055 8:53138057-53138079 GTTTCAGTCGGGGAATACTGGGG + Intergenic
1041321704 8:56620514-56620536 ATTTCAGAGGGGGCAGATAGAGG + Intergenic
1041651496 8:60307540-60307562 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1041917177 8:63149385-63149407 GTTTCAGTGGGGGCAGTAGGTGG + Intergenic
1042430175 8:68697638-68697660 GTTTTAGTAAGGGCAGATGGAGG + Intronic
1043599206 8:81918116-81918138 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1043733647 8:83717506-83717528 TTATCAGTGTGGGAAAATGGGGG + Intergenic
1044665568 8:94631451-94631473 GTTGCAGTGAGCCAAGATGGCGG - Intergenic
1044723619 8:95174264-95174286 TTCATAGTGGGGGAAGATGGGGG - Intergenic
1047450523 8:124961341-124961363 GTAGGGGTGGGGGAAGATGGGGG + Intergenic
1048206741 8:132421563-132421585 GATTCACTTGGGGCAGATGGTGG + Intronic
1048231978 8:132651378-132651400 GTGACAGAGGAGGAAGATGGGGG - Intronic
1048780235 8:137991499-137991521 ACTTCAGTGGGGCCAGATGGAGG - Intergenic
1049000574 8:139823304-139823326 TTTTAAGTGGGGGAAGCAGGTGG + Intronic
1050278480 9:4025188-4025210 GTTGCAGTGAGCCAAGATGGCGG + Intronic
1050816443 9:9818852-9818874 GTTTCAGTGAGCCAAGATTGTGG + Intronic
1052057361 9:23920345-23920367 GTTTCAGTTGGGGAATACTGGGG + Intergenic
1053059665 9:35021061-35021083 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1055382157 9:75719499-75719521 GTTTCAGTGCGTGAATCTGGAGG + Intergenic
1055686772 9:78783363-78783385 GTTTCAGTGAGCTGAGATGGTGG + Intergenic
1056097659 9:83272174-83272196 GTTGCAGTGAGCCAAGATGGCGG - Intronic
1056324205 9:85463102-85463124 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1057298550 9:93863219-93863241 CCTTCAGTGGGGGACGAAGGGGG + Intergenic
1057917453 9:99067777-99067799 ATTTCAGTGGGTGAAGGTGCTGG - Intronic
1058025886 9:100141962-100141984 GTTTCAGTGGGGGAGTAGGTGGG + Intronic
1058637406 9:107049811-107049833 GCTTAAGTGGGGGCAGATAGTGG + Intergenic
1058743103 9:107964047-107964069 GTGGCAGTGGGGAAAGATGATGG + Intergenic
1058808551 9:108617012-108617034 GTTTAAGTGAGAGAAGAAGGTGG - Intergenic
1058838117 9:108877688-108877710 GTTGGAGTGGGGAGAGATGGGGG - Intronic
1059332965 9:113548118-113548140 ATCTCAGTGGGGGAAGGAGGAGG - Intronic
1059386117 9:113965775-113965797 AGTCCAGTGGCGGAAGATGGTGG + Intronic
1059544148 9:115159487-115159509 GTCTCTGTGGGAAAAGATGGAGG + Intronic
1059718972 9:116940429-116940451 CTTCCAGTGGGACAAGATGGAGG + Intronic
1060505807 9:124197730-124197752 CTGGCAGTGGGGGAAGATGGTGG - Intergenic
1061272284 9:129550250-129550272 GTTCGGGTGGGGGAAGATAGGGG - Intergenic
1061347889 9:130042192-130042214 TTTCCAGTGGGGAAAGTTGGCGG - Intronic
1061414893 9:130442301-130442323 GTCTCAGTAAGAGAAGATGGTGG + Intergenic
1203749019 Un_GL000218v1:61852-61874 CTTTCAGTGGGTGAGGTTGGTGG - Intergenic
1187614251 X:20975961-20975983 GCTTCAGTGGGGGAAGAAAGGGG - Intergenic
1187772251 X:22713074-22713096 GTTCCAGTGGGGAGAGAAGGAGG + Intergenic
1187918920 X:24182146-24182168 GGTTTGGTGGGGGAAGGTGGGGG + Intronic
1188200578 X:27290022-27290044 GTTTCAGTGGGAGAACAGGCGGG + Intergenic
1190023780 X:46903740-46903762 GTTCCCATGGGGGAAGAAGGCGG - Intergenic
1191805465 X:65130779-65130801 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1192178799 X:68902632-68902654 GTGTCTCTGGGGGAGGATGGTGG + Intergenic
1192706480 X:73532199-73532221 GTTTCAGTGGGGGAATAGGTGGG - Intergenic
1192764149 X:74125370-74125392 GTTTCAGTGGGAGAATAGGTGGG + Intergenic
1193038278 X:76977305-76977327 GATTGAGTGGTGGAAGGTGGTGG - Intergenic
1193179415 X:78436130-78436152 GTTGCAGAGGAGGAAGGTGGTGG + Intergenic
1193401929 X:81055365-81055387 GCATCAGTGGGAGAATATGGTGG - Intergenic
1193537427 X:82731501-82731523 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1193890138 X:87033898-87033920 GTTGCAGTGAGTCAAGATGGTGG + Intergenic
1193915008 X:87353360-87353382 GTTTCCTTGGGGAAGGATGGGGG + Intergenic
1194933738 X:99921499-99921521 GTTTATGTAGTGGAAGATGGAGG + Intergenic
1195166925 X:102229559-102229581 GTTTCAGTGGGTGAAAATCAGGG + Intergenic
1195191935 X:102457529-102457551 GTTTCAGTGGGTGAAAATCAGGG - Intronic
1195237917 X:102919617-102919639 GCTTCAGTGGGGGAATGGGGAGG + Intergenic
1196661923 X:118279188-118279210 GTTTCAGTCGGGGAATACTGGGG + Intergenic
1196685025 X:118503627-118503649 GTTTCAGTTAAGCAAGATGGTGG + Intronic
1197341896 X:125285362-125285384 GTTTCAGTGAGCCAAGATCGCGG - Intergenic
1197513812 X:127400542-127400564 GTTTCAGTTGGGGAATACTGGGG - Intergenic
1197822264 X:130553241-130553263 GTTTCAGTGTGGGAATATTAGGG + Intergenic
1198045097 X:132893667-132893689 GTGGCAGTGGGGGAGGATGAGGG + Intronic
1199073471 X:143504338-143504360 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1199703891 X:150406896-150406918 CTCTCAGTGGGGAAAAATGGTGG + Intronic
1200228015 X:154429912-154429934 GTTGCTGTGTGGGCAGATGGTGG + Intronic
1200714078 Y:6517873-6517895 GCTGCAGTGTGTGAAGATGGTGG + Intergenic
1201162376 Y:11176866-11176888 CTTTCAGTGGGTGAGGTTGGTGG - Intergenic
1201407158 Y:13660849-13660871 GTTTCAGTCGGGGAATATTGGGG + Intergenic
1201631634 Y:16076754-16076776 GTTTCAGTAGGGGAATACAGAGG - Intergenic
1201640316 Y:16170673-16170695 ACTTCAGTGGGGCAGGATGGAGG + Intergenic
1201662498 Y:16414652-16414674 ACTTCAGTGGGGCAGGATGGAGG - Intergenic