ID: 1030969434

View in Genome Browser
Species Human (GRCh38)
Location 7:116036490-116036512
Sequence ATTCACATGCTGATGGTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 1, 2: 18, 3: 75, 4: 503}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030969434 Original CRISPR ATTCACATGCTGATGGTATT TGG (reversed) Intronic
900819438 1:4874832-4874854 ATTCCCAACATGATGGTATTGGG - Intergenic
901316249 1:8311453-8311475 ATTCCCAATGTGATGGTATTTGG + Intergenic
903640237 1:24854621-24854643 ATTCATATGTTGATGGCATTTGG + Intergenic
903709249 1:25310235-25310257 ATTCATATGTTGATGGTTTTTGG + Intronic
903717870 1:25382190-25382212 ATTCATATGTTGATGCTATTTGG - Intronic
904079594 1:27863628-27863650 ATTCTTATGTTGATGGCATTTGG + Intergenic
904977831 1:34472207-34472229 GTGCACATGGTGAGGGTATTGGG - Intergenic
904985520 1:34545134-34545156 ATTCATATGTTGATGGCATTTGG + Intergenic
906081243 1:43089914-43089936 TTTCTCATGCTCTTGGTATTCGG + Intergenic
906162384 1:43659908-43659930 CTTCACATGCTGCTGGGTTTTGG + Intronic
906308451 1:44736389-44736411 ATTCACATATTGATGGCATTTGG - Intergenic
907709492 1:56865517-56865539 ATCCCCAATCTGATGGTATTAGG - Intronic
907976336 1:59434797-59434819 ATCCTCAAGGTGATGGTATTTGG - Intronic
908051559 1:60238156-60238178 ATTCACCTGGTGATGATATTTGG - Intergenic
908612705 1:65880478-65880500 ATCCTCAAGGTGATGGTATTAGG + Intronic
909038151 1:70618534-70618556 ATTCCCAAGATGATGGTATTAGG - Intergenic
909353109 1:74676653-74676675 ATTCATATGTTGATAGTATTTGG - Intergenic
909989826 1:82210144-82210166 ATTCACAAGCAGTTGGGATTAGG + Intergenic
910445855 1:87298512-87298534 ATTCTCAATGTGATGGTATTAGG + Intergenic
910469877 1:87540383-87540405 ATTCATATGTTGATGGCATTTGG + Intergenic
910556545 1:88540921-88540943 ATTCACATCCTGATATTCTTTGG + Intergenic
911186275 1:94908183-94908205 CTTCACATGTTGATTGTATCTGG - Intronic
911392567 1:97265153-97265175 ATTCCCAAGCTCATGGTAGTAGG + Intronic
912218982 1:107650489-107650511 ATTCCCAACATGATGGTATTAGG + Intronic
912405957 1:109437827-109437849 ATTCATATGTTGATGGCATCTGG - Intergenic
912486552 1:110033702-110033724 GTTCATATGTTGATGGTATTTGG - Intronic
913261777 1:117005106-117005128 ATTTCCAAGGTGATGGTATTAGG - Intronic
913353453 1:117889475-117889497 TATCAAATGCTGGTGGTATTGGG - Intronic
913457148 1:119044802-119044824 ACTCCCAAGATGATGGTATTAGG - Intronic
913465464 1:119137631-119137653 GTTTAAATGTTGATGGTATTAGG - Intronic
914354680 1:146873973-146873995 ATTGCCATTGTGATGGTATTGGG - Intergenic
914667895 1:149847278-149847300 ATTCACAGGCTGTAGGGATTAGG + Intronic
915759479 1:158296050-158296072 ACTCACATGCTGGTGGTGGTGGG - Intergenic
916734192 1:167592583-167592605 ATTCTCCTGTTGATGGAATTTGG - Intergenic
917241716 1:172955953-172955975 ATGCCCAGGATGATGGTATTAGG + Intergenic
917610383 1:176683408-176683430 ATGTACAAGTTGATGGTATTGGG + Intronic
918182717 1:182098444-182098466 ATGAACATGATGATGGTAATGGG + Intergenic
918712437 1:187748274-187748296 ATTCATATGTTGATGGCATTTGG + Intergenic
919046375 1:192457665-192457687 ATCCCCAGGGTGATGGTATTCGG - Intergenic
919343336 1:196342887-196342909 AATCCCATTATGATGGTATTTGG + Intronic
919509663 1:198446452-198446474 ATTTAAATGACGATGGTATTTGG + Intergenic
920047578 1:203143383-203143405 ATTCTTATGCTGATGGCATTTGG - Intronic
920205906 1:204291991-204292013 TTTCACATGGTGATGGAATGAGG + Intronic
921282693 1:213583153-213583175 ATTCACCTGCTGATGGACTTTGG + Intergenic
921331838 1:214046772-214046794 ATTCACCTGCTGATGACATTTGG - Intergenic
922015958 1:221647195-221647217 ATTCATATGCTGATGGTATTTGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923454081 1:234147914-234147936 ATGCAGATGCTGTTGGTCTTGGG + Intronic
924173590 1:241366593-241366615 ATTCCCAAAGTGATGGTATTAGG + Intergenic
924604794 1:245523728-245523750 ACCCACAAGATGATGGTATTTGG - Intronic
924798618 1:247310798-247310820 ATCCCCAAGATGATGGTATTAGG - Intronic
1063813200 10:9738456-9738478 ATTAATATGTTGATAGTATTTGG - Intergenic
1063897527 10:10697759-10697781 ATCTCCATGGTGATGGTATTGGG - Intergenic
1064189349 10:13192203-13192225 ATTCACATTCAGATGGTTTGAGG - Intronic
1064679455 10:17795322-17795344 ATTCAAATGCAGTTAGTATTGGG - Intronic
1065146053 10:22769336-22769358 ATTCATATGTTGGTGGTATTTGG - Intergenic
1065209459 10:23388864-23388886 ACTCCCAAGGTGATGGTATTAGG - Intergenic
1065508466 10:26453958-26453980 ATTCACCTGTTGATGGAATTTGG - Intronic
1065635122 10:27724377-27724399 CTTCACAGGCTCATGGTTTTGGG - Intronic
1065714800 10:28555689-28555711 ATTCATATATTGATCGTATTTGG + Intronic
1065847303 10:29756439-29756461 ATTCACCTGCTGATGAAATTAGG - Intergenic
1065856818 10:29837993-29838015 ATTCACCTGCTCATGGCATGGGG + Intergenic
1065857623 10:29842987-29843009 ATCCTCAAGGTGATGGTATTAGG - Intergenic
1066177659 10:32926265-32926287 ATTCCCAACATGATGGTATTAGG + Intronic
1066593007 10:37016262-37016284 ATTCCTATTGTGATGGTATTTGG - Intergenic
1068100751 10:52550015-52550037 ATCCTCAATCTGATGGTATTAGG + Intergenic
1068121311 10:52784686-52784708 ATTCCCAAGGTGATAGTATTAGG - Intergenic
1068248855 10:54409712-54409734 ACTCATATGTTGATGATATTTGG + Intronic
1068800894 10:61138575-61138597 ATTCTGATGCTGCTGGTCTTGGG + Intergenic
1068933414 10:62613866-62613888 ATCCAAATCCTGATTGTATTTGG + Intronic
1069302133 10:66921291-66921313 ATTCCCAATGTGATGGTATTTGG - Intronic
1070028944 10:72658184-72658206 CTTCCCATTGTGATGGTATTAGG - Intergenic
1070534637 10:77366556-77366578 ATTGAGATGATGATGGTATGAGG + Intronic
1071773632 10:88759505-88759527 ATTCACATGCCAAAGGGATTTGG - Intergenic
1071880339 10:89890231-89890253 ATTCCCAATGTGATGGTATTTGG - Intergenic
1071936716 10:90540049-90540071 ATTCACATGTTCCTGGAATTAGG - Intergenic
1072596407 10:96876359-96876381 ATTCATATGTTTATGGTATTTGG - Intronic
1073710275 10:106028809-106028831 ATTCACAAGGTGATAGTATTAGG + Intergenic
1074250106 10:111736506-111736528 ACTCCCATTGTGATGGTATTTGG - Intergenic
1074562044 10:114543527-114543549 ATTCACCTGCTGATGGACATTGG + Intronic
1074908379 10:117884748-117884770 ATACAAATGCTGTTTGTATTTGG - Intergenic
1075613595 10:123874409-123874431 ACCCACAAGGTGATGGTATTTGG - Intronic
1075657250 10:124170122-124170144 ATCCTCAAGGTGATGGTATTAGG + Intergenic
1075969822 10:126642953-126642975 ATTTACATGCTGTTGGGATAAGG - Intronic
1077909243 11:6559528-6559550 CTTCACATGATCATGGTACTAGG - Intronic
1078739235 11:14051147-14051169 ATCCCCATCGTGATGGTATTTGG + Intronic
1079075525 11:17383293-17383315 ATGCCCAAGGTGATGGTATTTGG + Intergenic
1079340666 11:19609120-19609142 ATTCACAGGTTGAGGGGATTGGG + Intronic
1079358745 11:19752888-19752910 ATCCCCAATCTGATGGTATTTGG + Intronic
1079764124 11:24369373-24369395 ATTCAAATGCTGATCTAATTTGG - Intergenic
1079816179 11:25061633-25061655 ATTGAGATGATGAAGGTATTTGG + Intronic
1080211471 11:29791326-29791348 ATTCATATGTTCATGGTAGTTGG + Intergenic
1080777256 11:35397627-35397649 ACCCCCATGGTGATGGTATTTGG + Intronic
1080909301 11:36580027-36580049 ATTCACATACTTATTGTATTAGG + Intronic
1080975723 11:37337791-37337813 ATTCCCAAGGTGATTGTATTAGG - Intergenic
1081238258 11:40672349-40672371 ACTCCCAAGATGATGGTATTAGG - Intronic
1081610709 11:44561587-44561609 ATTCATATGTTGATGGTATTTGG + Intergenic
1085583564 11:77678602-77678624 AATCTCAAGGTGATGGTATTAGG + Intronic
1085659775 11:78353060-78353082 ATGCTCATGCTGCTGGTATGGGG - Intronic
1085720888 11:78911572-78911594 ATTCATATATTGATGGCATTTGG + Intronic
1086059528 11:82685986-82686008 ATGCCCAAGGTGATGGTATTAGG - Intergenic
1086975356 11:93126013-93126035 ATTCCCAGCGTGATGGTATTTGG - Intergenic
1088427763 11:109723561-109723583 ATCCACAAGGTGATGGTGTTAGG - Intergenic
1088873580 11:113913833-113913855 ATTCATATGTTGATGGTATTTGG + Intronic
1089173526 11:116532629-116532651 ATTCCCAGGGGGATGGTATTAGG + Intergenic
1089942480 11:122433311-122433333 ATTCCCAGGGTAATGGTATTTGG + Intergenic
1090536248 11:127645012-127645034 ATTAACATGCTACTGCTATTTGG - Intergenic
1090587991 11:128234873-128234895 ATTCCCATCATGATGGTATTGGG - Intergenic
1091039415 11:132262660-132262682 ATCCTCATTGTGATGGTATTAGG - Intronic
1091812557 12:3411626-3411648 ATTCACATGTAGATGATATTTGG + Intronic
1093288064 12:17290209-17290231 ATTCCCAGTGTGATGGTATTTGG - Intergenic
1093806173 12:23435734-23435756 ATCCCCAAGGTGATGGTATTAGG + Intergenic
1095931692 12:47632489-47632511 ATTACCAAGGTGATGGTATTAGG - Intergenic
1097431762 12:59517799-59517821 ATTCACCTGTTGATGACATTTGG - Intergenic
1097510423 12:60531771-60531793 ATTAATATGTTGATGGTATTTGG + Intergenic
1098012572 12:66070752-66070774 ATTCATATGTTGATGGTATTTGG + Intergenic
1098036571 12:66308827-66308849 AGTCACATTCTGAGGATATTGGG + Intronic
1098223278 12:68293037-68293059 ATTCACTTGCTGGTGGACTTTGG - Intronic
1098327041 12:69313722-69313744 ACTCCCAAGGTGATGGTATTAGG + Intergenic
1099168210 12:79333395-79333417 ACTCCCAAGGTGATGGTATTAGG - Intronic
1099549943 12:84031421-84031443 TTTCACATGCTTATGGCATTGGG - Intergenic
1100164703 12:91903200-91903222 AGTCACATTCTGAGGGTACTGGG - Intergenic
1100270129 12:93016746-93016768 ATTCCCAAGGTGATGATATTAGG + Intergenic
1100818664 12:98410355-98410377 ATTCATATGTTGATGGAATTTGG + Intergenic
1101005333 12:100396140-100396162 ATTCCCAATGTGATGGTATTTGG - Intronic
1101380380 12:104209037-104209059 ATTTACAAGCTGATGATCTTGGG - Intergenic
1102480331 12:113218872-113218894 ATTCACCTGTTGATGACATTTGG + Intronic
1102793392 12:115667327-115667349 AGTCAGCTCCTGATGGTATTTGG - Intergenic
1102892193 12:116568601-116568623 GTTCATATGTTGATGGTATTTGG + Intergenic
1103449433 12:121018106-121018128 ACTCCCAAGGTGATGGTATTAGG + Intergenic
1104027207 12:125036716-125036738 ATTCCCAATGTGATGGTATTTGG + Intergenic
1104310571 12:127651032-127651054 ATTCCCAAGGTGATGGTATTTGG - Intergenic
1104371808 12:128230020-128230042 ATTCCCAATGTGATGGTATTTGG - Intergenic
1105046175 12:133005604-133005626 ATTTATTTGTTGATGGTATTTGG + Intronic
1106352980 13:28952467-28952489 ATTCCCATGCATATGATATTAGG - Intronic
1106827894 13:33543788-33543810 ATTCTGATGCTGTTGGTACTAGG + Intergenic
1107603533 13:42037766-42037788 ATTCCCAGGGTGATGGTATTAGG - Intergenic
1107644227 13:42477551-42477573 ATCCACCTGCTGATGGTGATGGG + Intergenic
1107823665 13:44308384-44308406 ATTCACATGCTTATGGAGGTTGG + Intergenic
1108079671 13:46721854-46721876 ATTCACATTCTGATGCTCTATGG - Intronic
1108276200 13:48812112-48812134 ATCCACAGTGTGATGGTATTAGG - Intergenic
1108970986 13:56376472-56376494 CTTCAAATCCTGATGTTATTTGG - Intergenic
1109489387 13:63076180-63076202 TTTCACATTCTCATGGGATTTGG + Intergenic
1109490310 13:63088950-63088972 ATTCACATACAGAAGGTATTTGG + Intergenic
1110166555 13:72449488-72449510 ATTTATATGTTGATGGTATTTGG - Intergenic
1110759539 13:79216128-79216150 ACTCTCAATCTGATGGTATTAGG - Intergenic
1111248070 13:85568237-85568259 ATTAATATGTTGATGATATTTGG - Intergenic
1111482804 13:88853990-88854012 ATTCTCAATGTGATGGTATTAGG + Intergenic
1111946447 13:94670306-94670328 ATCCCCATTGTGATGGTATTTGG - Intergenic
1112224115 13:97520966-97520988 ATTCAAAAGCTGTTGGCATTTGG + Intergenic
1113248557 13:108426026-108426048 ACTCCCAAGATGATGGTATTAGG - Intergenic
1114573430 14:23691948-23691970 ATTCATATGTTTATGGCATTTGG - Intergenic
1114848084 14:26348211-26348233 ATTCCCTTGGTGATGGTATGTGG - Intergenic
1114914185 14:27241217-27241239 ATTCATATATTGATGGAATTTGG - Intergenic
1115656020 14:35444486-35444508 ATTCATATGTTGATGGTATTTGG - Intergenic
1115944751 14:38646969-38646991 ACTCACAATGTGATGGTATTTGG + Intergenic
1116485824 14:45446919-45446941 ACTCACATGTTTATTGTATTAGG - Intergenic
1116797331 14:49406219-49406241 ATTCCCAATTTGATGGTATTTGG + Intergenic
1117143485 14:52812972-52812994 ATTAATATGTTGATGGTATTTGG + Intergenic
1117225190 14:53651084-53651106 ATTCATATGTTAATGGCATTTGG - Intergenic
1117533009 14:56677108-56677130 ATCCTCAAGGTGATGGTATTTGG - Intronic
1117559641 14:56923628-56923650 ATTCACATGTTGGTGGTATTTGG + Intergenic
1118214520 14:63796158-63796180 AATCAAATGTTGATGATATTTGG + Intergenic
1118429877 14:65706766-65706788 CTTCCCAAGGTGATGGTATTAGG - Intronic
1118979387 14:70703922-70703944 ATTCATATGTTGCTGGCATTTGG + Intergenic
1119001733 14:70888217-70888239 ATTCTCCTCATGATGGTATTTGG - Intergenic
1119077825 14:71661612-71661634 ATTCACATGATGATGTAATCTGG + Intronic
1119161793 14:72458866-72458888 ATCCCCAAGGTGATGGTATTGGG - Intronic
1119686503 14:76636754-76636776 ATTCACCTGTTGATGACATTTGG - Intergenic
1119966517 14:78922511-78922533 ATTTAGATGCAGATGGTATAAGG + Intronic
1120255609 14:82115733-82115755 ATTCATATGTCGATGATATTTGG + Intergenic
1120617258 14:86722677-86722699 ATTCACAGGCTACTGGTCTTTGG + Intergenic
1121006414 14:90493425-90493447 ATCCCCATTGTGATGGTATTAGG + Intergenic
1121227354 14:92330849-92330871 ACTCACAATGTGATGGTATTTGG - Intronic
1121682167 14:95802674-95802696 ATTTATATGTTGATGGCATTTGG + Intergenic
1121703185 14:95971819-95971841 ATTCATATATTGATGGCATTAGG + Intergenic
1121722908 14:96123899-96123921 ATTCACCTGTTGATGGACTTGGG - Intergenic
1124052649 15:26212409-26212431 ATTCACAAGCTGATTGTCCTGGG - Intergenic
1125102659 15:35932869-35932891 ATTCCCAGTGTGATGGTATTTGG - Intergenic
1125746567 15:42001084-42001106 AGTCTGATGCTGATGGGATTTGG + Intronic
1126697698 15:51340240-51340262 ATTCACATTCTGATGTGGTTTGG - Intergenic
1127005013 15:54559119-54559141 ATTCACATGTTTATTGTTTTTGG - Intronic
1127105858 15:55614287-55614309 ATATACATGCTGATGGCATAAGG + Exonic
1127521058 15:59743386-59743408 ATTCTCAATGTGATGGTATTAGG + Intergenic
1127550453 15:60032583-60032605 ATTCAAATGCTAATTTTATTTGG + Intronic
1128048098 15:64637282-64637304 ATTCAGTTGTTGATGGCATTTGG + Intronic
1129929525 15:79398818-79398840 CATCACAAGCTGATGGAATTAGG + Intronic
1130554645 15:84914319-84914341 ATTCCCTAGGTGATGGTATTAGG - Intronic
1130651534 15:85764735-85764757 ATGCTGATGCTGATGGTTTTGGG - Intronic
1130928845 15:88405957-88405979 ATTCATATGTTGATGGTATTTGG - Intergenic
1131421265 15:92307469-92307491 ATTCCCAGGGTGATGGTACTAGG - Intergenic
1131673725 15:94649705-94649727 TTTCAGATGATGATGGTATCTGG - Intergenic
1131676176 15:94672968-94672990 CTTCAAATACTGATAGTATTTGG - Intergenic
1132153991 15:99482618-99482640 ATTGCCATTGTGATGGTATTGGG - Intergenic
1133709067 16:8383631-8383653 ATTCACACACTGATGAAATTTGG - Intergenic
1133924897 16:10184072-10184094 ACTCCCAAGGTGATGGTATTAGG + Intergenic
1134311701 16:13081042-13081064 ATTCCCAATGTGATGGTATTTGG - Intronic
1134559287 16:15194066-15194088 ATCCCCAAGGTGATGGTATTAGG + Intergenic
1134919824 16:18105679-18105701 ATCCCCAAGGTGATGGTATTAGG + Intergenic
1135297259 16:21292124-21292146 ATTCACATGTTGATGGACATTGG - Intronic
1135927985 16:26711897-26711919 ATCCCCAAGGTGATGGTATTGGG - Intergenic
1137962330 16:52895135-52895157 ATTCATATGTTGATGGTATTTGG - Intergenic
1139661376 16:68423342-68423364 ATTCATATATTGATGGCATTTGG + Intronic
1139979340 16:70841559-70841581 ATTGCCATTGTGATGGTATTGGG + Intronic
1143235366 17:5395033-5395055 ATTAAAATGCTAATGATATTGGG + Intronic
1144303385 17:13944836-13944858 ATTCCCAAGGTGATGGTATTAGG + Intergenic
1145727428 17:27144061-27144083 ATTCATATGTTGAAGATATTTGG + Intergenic
1146101561 17:29987525-29987547 GTTCAGCTGCTGATAGTATTTGG + Intronic
1146592294 17:34137907-34137929 AACCCCAAGCTGATGGTATTAGG - Intronic
1146741587 17:35288761-35288783 ATTCGCATGTTGAAGGTTTTAGG + Intergenic
1147499421 17:40948534-40948556 ATTCACAGGCTCTGGGTATTAGG - Intergenic
1149239231 17:54629535-54629557 ATCCACAAAGTGATGGTATTGGG - Intergenic
1149298369 17:55281933-55281955 AATCACGTGCCGATGCTATTAGG - Intronic
1149384898 17:56132882-56132904 ATTACCAAGGTGATGGTATTAGG - Intronic
1150889745 17:69134249-69134271 ATTCCCATTGTGATGGTATTAGG + Intronic
1151971867 17:77461657-77461679 ATTCACAAAGTGATTGTATTAGG + Intronic
1152010702 17:77712109-77712131 ATTGATATGCTGATGGCTTTTGG + Intergenic
1152269214 17:79313898-79313920 TTTCAGAGGCTGAAGGTATTTGG - Intronic
1152324828 17:79629526-79629548 ATTCGCTTGCTGGTGGGATTCGG + Intergenic
1153108512 18:1556818-1556840 ATTCACATGATGTTGGCAGTAGG + Intergenic
1153240032 18:3022678-3022700 ATTCATATGTTGATGGTACCTGG - Intergenic
1153554582 18:6298019-6298041 ATGCACATGCTGATATCATTAGG + Intronic
1153591129 18:6675026-6675048 ACTCCCAGGATGATGGTATTAGG - Intergenic
1153625886 18:7022125-7022147 CTACACATGATGATGGTATGGGG - Intronic
1153696475 18:7647878-7647900 ATGCACATGCTGCTGGTCTTTGG + Intronic
1153890313 18:9507995-9508017 ATCCCCAAGGTGATGGTATTAGG - Intronic
1155198118 18:23493926-23493948 ATTCATATATTGTTGGTATTTGG - Intergenic
1155614974 18:27711622-27711644 ATGAACATGCATATGGTATTTGG + Intergenic
1155626323 18:27839015-27839037 ATCCATATAGTGATGGTATTTGG + Intergenic
1155899238 18:31367618-31367640 ATCCCCAAGGTGATGGTATTAGG + Intergenic
1156129637 18:33955288-33955310 ATTCCCATGCTTATGATATCAGG + Intronic
1156250838 18:35351304-35351326 ATTCACAATGTGGTGGTATTTGG + Intergenic
1156805462 18:41173693-41173715 CTTCATATGCTGCTGGAATTTGG + Intergenic
1157847006 18:51013398-51013420 ATTCATATCTTGATGCTATTTGG + Intronic
1159501600 18:69278563-69278585 ACTCATATGTTAATGGTATTTGG + Intergenic
1159661597 18:71103158-71103180 ATTCATATGTTGATGGCACTTGG + Intergenic
1159734616 18:72079162-72079184 ATTCACTTGTAGATGGAATTTGG + Intergenic
1159800344 18:72891088-72891110 ATTCAGATGCTGAAATTATTTGG - Intergenic
1160118977 18:76109946-76109968 ACTCTCAAGGTGATGGTATTAGG - Intergenic
1163866771 19:19779703-19779725 ATTCATATGTGGATAGTATTAGG + Intergenic
1163894804 19:20049383-20049405 ATTCATATGTGGATAGTATTAGG - Intergenic
1164230716 19:23285420-23285442 ATGCCCATGCTGAAGGTTTTTGG + Intergenic
1164546774 19:29172381-29172403 ATTCCCAATGTGATGGTATTTGG + Intergenic
1164909567 19:31994793-31994815 AATCCCATTGTGATGGTATTTGG - Intergenic
1165217643 19:34287873-34287895 ATTCCCATTGTGATGGTATCTGG - Intronic
1165563795 19:36705633-36705655 ATGCATATTCTGATGTTATTGGG + Intronic
1166653525 19:44593623-44593645 ATGCCCAAGGTGATGGTATTAGG + Intergenic
1167252715 19:48409238-48409260 ATTGCCATTGTGATGGTATTGGG - Intronic
1168281759 19:55309681-55309703 AATCCCAAGGTGATGGTATTAGG - Intronic
925041563 2:735250-735272 AGTCACATGTTAATGATATTTGG + Intergenic
925432688 2:3809329-3809351 ATCTACATGCTAATGATATTGGG + Intronic
925451365 2:3972616-3972638 GTCCAAATGCTGATGGCATTTGG + Intergenic
925749571 2:7075453-7075475 ATTTATATGTTGATGGTGTTTGG + Intergenic
926619403 2:15033577-15033599 ATTCACAATGTGATGGTATTTGG + Intergenic
926922613 2:17954075-17954097 ATTCATATGTTGATGGTGTATGG + Intronic
928055922 2:28054495-28054517 ATCCCCAAGGTGATGGTATTAGG + Intronic
928767618 2:34666448-34666470 ATTCTCAAGGTGATAGTATTAGG + Intergenic
928771469 2:34707083-34707105 ATCCCCAAGATGATGGTATTAGG + Intergenic
929065649 2:37971941-37971963 ATTCACATATTTATGATATTGGG + Intronic
929269018 2:39952361-39952383 ATTCATATGTTTATGGTGTTTGG + Intergenic
929326196 2:40614320-40614342 ACTCACAATGTGATGGTATTAGG - Intergenic
929396683 2:41531703-41531725 ATTCATATGTTGATGGTATTTGG - Intergenic
929996963 2:46833748-46833770 ATTCCCAATATGATGGTATTTGG - Intronic
930507526 2:52303166-52303188 TTTCACCTGTTGATGGCATTTGG + Intergenic
930565476 2:53013941-53013963 ATTCTAAAACTGATGGTATTAGG - Intergenic
930626124 2:53699270-53699292 ATTCATTTGTTGATGATATTTGG - Intronic
931076913 2:58725554-58725576 AATCCCAATCTGATGGTATTTGG + Intergenic
931527370 2:63171786-63171808 ACTCACCAGCTGATGGTATCTGG - Intronic
931952874 2:67384946-67384968 ATTCATATACTGATAGGATTTGG + Intergenic
932012061 2:67988496-67988518 ATCCCCAAGGTGATGGTATTAGG - Intergenic
932186165 2:69698257-69698279 ATCCTCAAGGTGATGGTATTAGG - Intronic
932487861 2:72095675-72095697 CTTCACATGTTGAGGGTTTTAGG - Intergenic
933048754 2:77574515-77574537 ATCCCCAAGGTGATGGTATTAGG - Intronic
933843917 2:86309810-86309832 ATTCCCAATGTGATGGTATTTGG - Intronic
935539585 2:104333962-104333984 ATTTTTATGTTGATGGTATTTGG + Intergenic
935675397 2:105590776-105590798 ACCCACAAGGTGATGGTATTAGG + Intergenic
935920320 2:108005821-108005843 ATCCCCAAGGTGATGGTATTAGG - Intronic
936396699 2:112137244-112137266 ATTCCCAAGATGATGGCATTAGG + Intergenic
936543148 2:113368394-113368416 ATTCACAAGGTGAAGGTGTTAGG - Intergenic
936647126 2:114384808-114384830 ATGCATATGTTGATGGCATTTGG - Intergenic
937054374 2:118920314-118920336 ATTCACCTGTTAATGGAATTTGG - Intergenic
937489875 2:122355509-122355531 ATTCACAGGCTGCAGGGATTAGG - Intergenic
937495986 2:122419804-122419826 ATTCCCAGTGTGATGGTATTGGG + Intergenic
938586431 2:132695144-132695166 ATCCCCATTGTGATGGTATTTGG - Intronic
938683851 2:133717936-133717958 ATTCCCAGTGTGATGGTATTAGG - Intergenic
939104348 2:137932110-137932132 ATTCCCAATATGATGGTATTAGG - Intergenic
940367779 2:152867800-152867822 ATTGTCATGGTGATAGTATTGGG + Intergenic
940383322 2:153041991-153042013 ATTCATATTTTGATGGTATTTGG + Intergenic
940515305 2:154677076-154677098 GTTCACATGTTGATGGCATTTGG + Intergenic
940572925 2:155464337-155464359 ATTCATATGATTATGGAATTTGG + Intergenic
941561277 2:167048052-167048074 ATTCCCAATGTGATGGTATTTGG - Intronic
941619405 2:167759200-167759222 AGTCATATGCTGCTGGTCTTAGG - Intergenic
941631097 2:167885070-167885092 ATTCAGATGTTGAGGGGATTGGG - Intergenic
943765238 2:191653976-191653998 ATTTATATGCTGATGGTATTTGG - Intergenic
944936014 2:204569038-204569060 ATTTAAATGCTGATGGGTTTTGG - Intronic
945769072 2:214016943-214016965 ATGGACATGCAGATGGTGTTAGG + Intronic
946698663 2:222387496-222387518 ATTCTCACTGTGATGGTATTTGG - Intergenic
1170497237 20:16937724-16937746 ATTCACATATTAATGGTATTTGG - Intergenic
1170939984 20:20840786-20840808 ATTCACATGATGGTTGTATAGGG - Intergenic
1172180930 20:33003029-33003051 AATCACAGGCTGGTGGTGTTGGG - Intronic
1174301071 20:49582854-49582876 ATTCACAGGCTCCTGGGATTAGG + Intergenic
1174347056 20:49937743-49937765 ATTTAGATGGGGATGGTATTTGG - Intronic
1174943656 20:54960458-54960480 ACCCACATGGTGATGGTATTAGG + Intergenic
1176937295 21:14882100-14882122 ATACCCAAGGTGATGGTATTAGG - Intergenic
1176982451 21:15398675-15398697 ATTCCCAAGATGATAGTATTAGG - Intergenic
1177434295 21:21030591-21030613 ATTCACATGCTCCAGGGATTTGG + Intronic
1177596383 21:23248440-23248462 ATTCACAGGCTCTAGGTATTAGG + Intergenic
1177724884 21:24954830-24954852 ACTCCCAAGGTGATGGTATTAGG - Intergenic
1178173189 21:30065516-30065538 AGTTTCATGCTTATGGTATTAGG + Intergenic
1178712830 21:34934610-34934632 ATTCACATGCTGGTGCTTTAGGG + Intronic
1178730198 21:35094982-35095004 AGTCTCAAGGTGATGGTATTAGG + Intronic
1179039075 21:37785775-37785797 ATCCACAAGGTGATGGTACTAGG + Intronic
1181347600 22:22231455-22231477 ACCCCCAAGCTGATGGTATTAGG + Intergenic
1181358513 22:22317285-22317307 ATCAAAATGCTGATGGTGTTAGG - Intergenic
1182600683 22:31461263-31461285 AGTCCCAGGCTGATGGTCTTGGG - Intronic
1183173921 22:36208480-36208502 CAACACATTCTGATGGTATTTGG - Intergenic
1183853561 22:40613231-40613253 ATTCACCTGTTGATGGCATTTGG + Intronic
1184881836 22:47310719-47310741 ATTCACCTGCTGATGTCATTTGG + Intergenic
949175043 3:1051314-1051336 ATTCAAATGCTGCTGGTTTGTGG + Intergenic
949695354 3:6688355-6688377 ATTCCCAAGGTGATGATATTAGG - Intergenic
949787058 3:7753398-7753420 ATTCCCAGGGTGATGGTATTAGG + Intergenic
951710526 3:25581645-25581667 ATTCCCAATGTGATGGTATTAGG + Intronic
951768610 3:26229119-26229141 ATTCACATTATGGTGGTAGTTGG - Intergenic
951934633 3:28008414-28008436 ATTCCCAAGGTGATGGTATTAGG + Intergenic
952053892 3:29420421-29420443 GGTCACATCCTGATGGGATTTGG + Intronic
952465256 3:33577720-33577742 ATCCTCAAGGTGATGGTATTAGG + Intronic
954928650 3:54260570-54260592 GTTCATATGTTGCTGGTATTTGG - Intronic
955466575 3:59243307-59243329 ACTCCCAAGGTGATGGTATTAGG + Intergenic
955502345 3:59597799-59597821 ATTCCCAATGTGATGGTATTTGG - Intergenic
955726017 3:61933637-61933659 AGTCACACTCTGATGGTCTTAGG - Intronic
956933994 3:74079065-74079087 ATCCCCAAGGTGATGGTATTAGG + Intergenic
957012747 3:75027127-75027149 ATTCATAGGTTGATGGCATTTGG - Intergenic
957291023 3:78278336-78278358 ATTGACAGACTGATAGTATTCGG - Intergenic
957532745 3:81461202-81461224 ATTCACAGGCTGATCCTCTTGGG - Intergenic
957697238 3:83655625-83655647 ATTGACATGCTGATGGGTGTCGG - Intergenic
958100087 3:88998375-88998397 ATCCCCAAGGTGATGGTATTAGG + Intergenic
958593196 3:96187098-96187120 ATTTCCAAGCTGATGGTATTAGG + Intergenic
959210018 3:103366651-103366673 ACTCCCAAGGTGATGGTATTTGG - Intergenic
960143404 3:114173007-114173029 ATTCCCAATATGATGGTATTAGG + Intronic
962052303 3:131829611-131829633 AATCATATGCTGATGAGATTGGG - Intronic
963019326 3:140857383-140857405 ACTCCCAAGGTGATGGTATTAGG + Intergenic
963075750 3:141344885-141344907 ATTCACATGATCTTGGAATTAGG + Intronic
963328305 3:143886438-143886460 ATCCCCATTGTGATGGTATTAGG - Intergenic
963348716 3:144126884-144126906 ATCCCCAAGGTGATGGTATTAGG - Intergenic
963773806 3:149418369-149418391 ATTCACCTGCTGATGGTCATTGG - Intergenic
963842534 3:150122349-150122371 ACTCCCAAGGTGATGGTATTAGG + Intergenic
964826931 3:160838911-160838933 ATTTATATGTTGATGGCATTTGG + Intronic
964885579 3:161478465-161478487 ATTCCCAAGGTAATGGTATTAGG - Intergenic
964990212 3:162801580-162801602 ATGCACAAGATGATGGTATTAGG + Intergenic
965165581 3:165191971-165191993 TTTCATATACTGATGTTATTAGG - Intronic
965209007 3:165760245-165760267 ATTCACATTCTACTGGTATAGGG - Intergenic
965314668 3:167177163-167177185 ATGCCCATGCTGAAGGTTTTTGG - Intergenic
965688236 3:171328082-171328104 ATTCCCAACCTGTTGGTATTAGG + Intronic
965929033 3:174019248-174019270 ATTCATATGTTGATGGTATTTGG + Intronic
966172832 3:177101449-177101471 ATTCATATGTTGATGACATTTGG + Intronic
967667188 3:192187138-192187160 ATTTGCATGCTGATTCTATTAGG - Intronic
968859261 4:3153276-3153298 ATTACCAGGGTGATGGTATTAGG - Intronic
970055853 4:11971288-11971310 ACCCCCAAGCTGATGGTATTAGG - Intergenic
970326536 4:14930791-14930813 ATTCCCAATGTGATGGTATTTGG + Intergenic
970499603 4:16664109-16664131 ACTCCCAAGATGATGGTATTAGG + Intronic
970568141 4:17352499-17352521 ATTGACAATGTGATGGTATTTGG + Intergenic
970682045 4:18520559-18520581 ATTCACAACATGATGGTATTTGG - Intergenic
970810867 4:20092814-20092836 ATTCCCTTTGTGATGGTATTTGG + Intergenic
970860541 4:20697916-20697938 ACTCCCAAGGTGATGGTATTTGG - Intronic
971032915 4:22660431-22660453 ATACACATACTGATAGTGTTTGG - Intergenic
971506445 4:27371366-27371388 ATTGCCATTGTGATGGTATTAGG - Intergenic
971733814 4:30419789-30419811 ATCCTCAGGGTGATGGTATTAGG - Intergenic
972268312 4:37484126-37484148 ACCCACAAGATGATGGTATTGGG + Intronic
972833552 4:42841902-42841924 ACTCACAAGGTGATAGTATTAGG + Intergenic
974300814 4:60064998-60065020 ATCCCCAATCTGATGGTATTAGG - Intergenic
974658405 4:64855013-64855035 ACTCCCAAGATGATGGTATTAGG - Intergenic
975867113 4:78735275-78735297 ATTCCCAAAGTGATGGTATTAGG - Intergenic
976397705 4:84574079-84574101 ATTCCCAGTGTGATGGTATTTGG + Intergenic
977019064 4:91736617-91736639 ATTCATATGTTGATGATATTTGG + Intergenic
977366568 4:96076438-96076460 ATCCCCAAGGTGATGGTATTAGG + Intergenic
977509419 4:97943228-97943250 ACTCCCAAGGTGATGGTATTAGG - Intronic
977518450 4:98051396-98051418 ATTCATATGTTGATGGCATTGGG + Intronic
978104061 4:104880323-104880345 ATTCACATTTTGATGGTATTTGG - Intergenic
978144611 4:105357147-105357169 TTTTACATGCAGATGCTATTTGG - Intergenic
978155991 4:105489743-105489765 ACTCCCAAGGTGATGGTATTAGG + Intergenic
978165658 4:105603518-105603540 ATTCCCATGATGGTGGTGTTGGG + Intronic
978215419 4:106195528-106195550 ATTCAAATGCTGATCTTATCTGG - Intronic
978237674 4:106479049-106479071 ATTTATATGTTGATGGTATTTGG + Intergenic
978627735 4:110706402-110706424 ATATATATGTTGATGGTATTTGG + Intergenic
978823475 4:112992769-112992791 ATGCACAATGTGATGGTATTTGG - Intronic
979030329 4:115635280-115635302 ATTCAACTTCTGATGGTAGTTGG - Intergenic
980078259 4:128317171-128317193 ATTGCCATTGTGATGGTATTGGG + Intergenic
981570643 4:146147303-146147325 ATTCTCAATGTGATGGTATTTGG + Intergenic
981667776 4:147249219-147249241 ATTGTCATTGTGATGGTATTGGG + Intergenic
981917559 4:150051563-150051585 ATCCCCAAGGTGATGGTATTAGG + Intergenic
982113441 4:152076977-152076999 ACTCCCAAGGTGATGGTATTAGG + Intergenic
982825606 4:160000931-160000953 ATCCCCATTGTGATGGTATTTGG - Intergenic
983180778 4:164646107-164646129 ATCCCCATGGTGATGGTATTAGG + Intergenic
983316811 4:166143018-166143040 ATTCACAGTGTGATGGTATTGGG - Intergenic
983475834 4:168210795-168210817 ATTCATATGTTGATGATATTTGG + Intergenic
984008231 4:174339431-174339453 ATTCACTTGTTGATGACATTTGG + Intergenic
984109599 4:175595968-175595990 ATGCATATGTTGATTGTATTTGG + Intergenic
985037564 4:185856657-185856679 ATTCATATGTTGATGGCATTTGG + Intronic
985065739 4:186119438-186119460 ATTCAGAAGCAGATGGTCTTTGG + Intronic
985116138 4:186593439-186593461 ATTCACAGGCTCCTGGGATTAGG - Intronic
985150524 4:186942772-186942794 ATCCCCAAGGTGATGGTATTAGG + Intergenic
985912110 5:2892727-2892749 ATTCCCAGGCTGATGGCCTTGGG + Intergenic
986073470 5:4310929-4310951 ATGCTCATGCTGCTGGTACTTGG + Intergenic
986268379 5:6210193-6210215 ACCCCCATGGTGATGGTATTAGG - Intergenic
987248257 5:16072367-16072389 ATTCCCAGTGTGATGGTATTTGG + Intronic
987507263 5:18789821-18789843 ATGCACAGGCTAATGGTACTGGG + Intergenic
987718200 5:21598356-21598378 ATTCCCAGTGTGATGGTATTTGG - Intergenic
988104998 5:26733481-26733503 ATTCTCAAAGTGATGGTATTGGG + Intergenic
988246879 5:28696569-28696591 ACACACATGTTGATGCTATTTGG + Intergenic
989312758 5:40039549-40039571 ATCCCCAAGGTGATGGTATTAGG - Intergenic
990146575 5:52767618-52767640 AATCTTATGTTGATGGTATTTGG - Intergenic
990398266 5:55407377-55407399 ATTTATATGCTAATGTTATTGGG + Intronic
990646339 5:57848796-57848818 ATTGCCATGTTGATTGTATTGGG + Intergenic
991277181 5:64863012-64863034 ATTCCCAGTGTGATGGTATTTGG - Intronic
991559436 5:67933961-67933983 ATTCCCAAGGTGATGGTATTAGG + Intergenic
992070513 5:73144487-73144509 ATTCACAATGTGATGATATTTGG + Intergenic
992193335 5:74315669-74315691 ATTCACTTGTTGAAGGCATTTGG - Intergenic
992493629 5:77270559-77270581 GGTGACATGTTGATGGTATTTGG + Intronic
992560818 5:77951113-77951135 ATTGTCATTGTGATGGTATTGGG + Intergenic
992948346 5:81831946-81831968 GTGCACATTCTGATTGTATTAGG + Intergenic
994282368 5:97921115-97921137 ATTCCCATTGTGATGGAATTTGG + Intergenic
994444172 5:99852142-99852164 ATTCATCTACTGATGGCATTTGG - Intergenic
994477874 5:100292902-100292924 ATTCCCAATATGATGGTATTTGG - Intergenic
994988587 5:106969367-106969389 ATTCATTTGCTGATGGTATTTGG - Intergenic
995602442 5:113812481-113812503 ACTCCCAAGGTGATGGTATTAGG - Intergenic
996338744 5:122412985-122413007 ACTCTCAAGATGATGGTATTTGG + Intronic
996490761 5:124092984-124093006 ACTCCCAAGTTGATGGTATTAGG - Intergenic
997298694 5:132786235-132786257 ATTCACAGGCTGTGGGGATTAGG - Intronic
997411559 5:133694934-133694956 ACCCCCAAGCTGATGGTATTAGG - Intergenic
998227186 5:140336114-140336136 ATTGACAGGCTGAGGGTATGAGG - Intronic
998517407 5:142769155-142769177 ATTTAGCTGCTGGTGGTATTAGG - Intergenic
1000701479 5:164456754-164456776 ATTACCAAGTTGATGGTATTTGG + Intergenic
1001453171 5:171841672-171841694 ATTCCCAAAGTGATGGTATTTGG - Intergenic
1002700900 5:181124251-181124273 ATTCACCTGTTGATGGTCATTGG - Intergenic
1002788474 6:421583-421605 ATTGATTTGCTGATGATATTTGG - Intergenic
1004241972 6:13931832-13931854 ACTCCCAAGGTGATGGTATTAGG + Intronic
1004699206 6:18063218-18063240 ATTCCTATTGTGATGGTATTAGG + Intergenic
1004760755 6:18663488-18663510 ATTCTGCTGCTGAGGGTATTGGG + Intergenic
1004876660 6:19962458-19962480 ATTCACAAGTTCAGGGTATTAGG - Intergenic
1005146830 6:22701199-22701221 ATTCACTTGCTGTGGGGATTAGG + Intergenic
1006651531 6:35555607-35555629 ATACTCACGCTGATGGTTTTTGG + Intergenic
1006677192 6:35772854-35772876 AATAAAATGGTGATGGTATTTGG - Intergenic
1006949932 6:37813367-37813389 ATCCCCATGGTGATGGCATTAGG + Intergenic
1007799225 6:44377876-44377898 ATCCCCAAGGTGATGGTATTAGG - Exonic
1009331722 6:62430613-62430635 ATTCCCAATGTGATGGTATTTGG - Intergenic
1009524036 6:64720423-64720445 ATTCACAGGTTCTTGGTATTAGG + Intronic
1010413393 6:75586321-75586343 GTTCTCATGCTGATGGTGTAAGG - Intergenic
1010706883 6:79125197-79125219 ATTCTCAAGTTGATGGTATAAGG - Intergenic
1010726390 6:79338683-79338705 ATCCCCATTGTGATGGTATTTGG + Intergenic
1011227304 6:85121776-85121798 ATTCATATGTTGACGATATTGGG + Intergenic
1011555569 6:88568782-88568804 AATCACAATGTGATGGTATTAGG + Intergenic
1011983396 6:93415526-93415548 ATTCTCATACTGATAGTATCAGG - Intronic
1012006971 6:93725341-93725363 ATGCACAATGTGATGGTATTTGG - Intergenic
1012126684 6:95438025-95438047 ATTCAAATGTTGATAATATTTGG + Intergenic
1012723081 6:102772831-102772853 ATGCATATGTTGATGGTATTTGG + Intergenic
1012986040 6:105877365-105877387 AATCCCAAGGTGATGGTATTAGG - Intergenic
1013476525 6:110512081-110512103 ATTCACAGTGTGATGGTGTTTGG + Intergenic
1014503200 6:122219797-122219819 ATTGGCATGCTGTTGTTATTTGG + Intergenic
1015093785 6:129389952-129389974 ATTCCCAATGTGATGGTATTTGG - Intronic
1015563069 6:134537297-134537319 ATTCACATGCCGATGGTGCTGGG - Intergenic
1016019411 6:139220038-139220060 ACTCTCAAACTGATGGTATTAGG + Intergenic
1016090777 6:139976249-139976271 ATCCCCATCTTGATGGTATTTGG + Intergenic
1016499708 6:144705618-144705640 ACTCCCATAGTGATGGTATTGGG - Intronic
1016652886 6:146483600-146483622 ATTCATATGTTGATGATATTTGG - Intergenic
1017033717 6:150248179-150248201 ATTAATATGTTGATGGCATTTGG - Intronic
1017198628 6:151729090-151729112 ACTCTCAAGATGATGGTATTAGG + Intronic
1017579131 6:155841451-155841473 ATTTACATTCTGCTGCTATTCGG - Intergenic
1017868825 6:158468948-158468970 GTTCCCATGGTGGTGGTATTAGG - Intronic
1018296099 6:162345879-162345901 ATTCGTATGTTGATGGTATTTGG + Intronic
1018326725 6:162678194-162678216 ATTCACCTGTTGATGGTTATTGG + Intronic
1018494417 6:164335224-164335246 ATCCCCAAGGTGATGGTATTAGG + Intergenic
1018494505 6:164336381-164336403 ATTCCCATAGTGATAGTATTAGG + Intergenic
1020354997 7:7266188-7266210 ATTCAAATGCTAATGTTATTTGG - Intergenic
1020607601 7:10358032-10358054 ATTGACATTCTGTTGGTTTTGGG + Intergenic
1021101907 7:16594033-16594055 ATCCCCATTGTGATGGTATTTGG + Intergenic
1021260904 7:18456101-18456123 ATTTCCTTGCTGATCGTATTAGG + Intronic
1021267172 7:18539079-18539101 ATTCATATGTTGATAGCATTTGG - Intronic
1021345440 7:19521592-19521614 ACTCTCAAGGTGATGGTATTAGG + Intergenic
1022620307 7:31977143-31977165 ATTCATATGTTGATGGCATTTGG + Intronic
1023134769 7:37040498-37040520 ATGCACATGCTGATGGCAGCTGG - Intronic
1023498621 7:40824881-40824903 ATTGCCATTGTGATGGTATTGGG - Intronic
1024144346 7:46497335-46497357 ACTCCAAAGCTGATGGTATTAGG + Intergenic
1024344278 7:48297057-48297079 ATTCACATACAGATGGTATTGGG + Intronic
1024760835 7:52594591-52594613 ATCCACAAGATGATGATATTAGG + Intergenic
1024833083 7:53484747-53484769 ATTCCCAAGGTGATGGCATTAGG + Intergenic
1024988714 7:55218427-55218449 ATTCCCAAGGTGATGGTATTTGG - Intronic
1026129119 7:67605954-67605976 ATTCACAGGCTGCTACTATTGGG - Intergenic
1027680259 7:81211660-81211682 ATTCACAGGGTCATGGTTTTGGG - Intergenic
1027736666 7:81940953-81940975 ATTCTGATGCTGATGATTTTAGG - Intergenic
1028452289 7:90999131-90999153 ATTCACGTGTTGATGACATTTGG - Intronic
1028666679 7:93351705-93351727 AATCCCAGGGTGATGGTATTGGG - Intronic
1028690702 7:93646195-93646217 ATTCACCTGTTGAGGGAATTTGG + Intronic
1029445228 7:100608184-100608206 ATCTCCATGCTTATGGTATTGGG + Intergenic
1030445054 7:109638691-109638713 ATTTCCATTGTGATGGTATTGGG - Intergenic
1030560589 7:111079783-111079805 ATTCATATACTGATGGCACTTGG + Intronic
1030895634 7:115056360-115056382 ACTCCCATGTTGATAGTATTAGG - Intergenic
1030969434 7:116036490-116036512 ATTCACATGCTGATGGTATTTGG - Intronic
1031277003 7:119737698-119737720 ATTCACATGTTGATGCTTTTAGG - Intergenic
1031660323 7:124416365-124416387 ATTCCCAAAGTGATGGTATTTGG + Intergenic
1031980169 7:128119637-128119659 ATCCCCAAGGTGATGGTATTTGG + Intergenic
1032140670 7:129327125-129327147 ATTCCCAGTGTGATGGTATTAGG + Intronic
1033294766 7:140121968-140121990 ATTCAGGTGCTGCTGGTATGGGG - Intronic
1034082117 7:148288492-148288514 ATTCATATGTTGATGGTATTTGG - Intronic
1034707795 7:153161912-153161934 ATTCATATGCTAATTGTATTTGG - Intergenic
1034930594 7:155158636-155158658 ATTTATATGTTGATGGCATTTGG - Intergenic
1035725171 8:1820054-1820076 GTTCACCTGTTGATGGAATTTGG + Intergenic
1035851047 8:2919621-2919643 ATGCAAATGCTGAGGGAATTAGG - Intergenic
1038069183 8:23994397-23994419 ATTTATTTGCTGATGGGATTTGG + Intergenic
1038237744 8:25777224-25777246 ACCCACATGGTGATGGTATTAGG + Intergenic
1039689141 8:39843944-39843966 ATTTATATGTTGATGGTTTTTGG - Intergenic
1041593016 8:59612495-59612517 ATTCTCATGCAGATGGTTTGTGG - Intergenic
1041748069 8:61231011-61231033 ATCCCCAAGGTGATGGTATTAGG - Intronic
1042131156 8:65587831-65587853 ATTTATATACTGATGGTATTAGG - Intergenic
1042236879 8:66622010-66622032 ATTCACAGGCTCTGGGTATTCGG + Intergenic
1042258248 8:66829079-66829101 ATTGACATTCTGCTGGTGTTTGG + Intronic
1042472898 8:69211430-69211452 ATCCCCAAGGTGATGGTATTTGG - Intergenic
1042628654 8:70791035-70791057 ATTCCCAAGGTGATGGTGTTAGG - Intergenic
1043056206 8:75443001-75443023 ATTCTCAAGATGATGGTATTAGG + Intronic
1043556838 8:81439858-81439880 ACTCCCAAGTTGATGGTATTAGG + Intergenic
1043919659 8:85966413-85966435 ATTCAGATGCAGATGGTCTGAGG + Intergenic
1044137081 8:88599571-88599593 ATTGCCATTGTGATGGTATTGGG - Intergenic
1046175246 8:110567150-110567172 ATTCAGAGGCTGATGATATTTGG + Intergenic
1046794202 8:118353356-118353378 ATTCCCAAAGTGATGGTATTTGG + Intronic
1047619950 8:126596218-126596240 ACTCACATGGTGCTGGTTTTTGG + Intergenic
1047688401 8:127324276-127324298 ACTGATATGCTTATGGTATTTGG - Intergenic
1047872008 8:129094412-129094434 ATCCCCAAGGTGATGGTATTTGG + Intergenic
1048049162 8:130801015-130801037 ACTCACAAGGTGATGGTATTAGG - Intronic
1048681968 8:136853066-136853088 ATTGACATGCTGAGGGCTTTAGG - Intergenic
1050166336 9:2768698-2768720 ATTCCCAAAGTGATGGTATTTGG - Intronic
1050367297 9:4884385-4884407 ATTCCCATGGTGGTGGTATTAGG - Intronic
1050504391 9:6332308-6332330 AACCACAGGGTGATGGTATTGGG + Intergenic
1050962264 9:11749740-11749762 ATTCACAGGCTTCTGGAATTAGG + Intergenic
1051026549 9:12619868-12619890 ATTCCCAATGTGATGGTATTTGG + Intergenic
1051297500 9:15611893-15611915 ATTGCCATTGTGATGGTATTAGG + Intronic
1051721417 9:20041437-20041459 ATGCACATGCTTTTTGTATTTGG - Intergenic
1052139641 9:24963719-24963741 ATTCATATGTTGATGGTTTATGG - Intergenic
1052167845 9:25355740-25355762 ATTCACATGTTGTAGGTTTTAGG + Intergenic
1052182529 9:25547202-25547224 ATTCATGTGTTGATAGTATTTGG + Intergenic
1052191162 9:25664290-25664312 ATTCCCAATGTGATGGTATTTGG + Intergenic
1052286261 9:26789194-26789216 ATTGACATGGTGATGATAATGGG - Intergenic
1052341684 9:27370122-27370144 ATTCCCAGGCTGATGGTACTAGG + Intronic
1054929570 9:70622018-70622040 ATTCCAAAGGTGATGGTATTAGG + Intronic
1055836945 9:80454976-80454998 ATTCTCAATGTGATGGTATTGGG - Intergenic
1056335302 9:85562857-85562879 ATTCCCAAGGTGATGGTATTAGG + Intronic
1056746247 9:89306388-89306410 ATTTATATGTTTATGGTATTTGG + Intergenic
1058166047 9:101620370-101620392 ATCCCCAGGGTGATGGTATTAGG - Intronic
1058331574 9:103767941-103767963 ATCCCCATTGTGATGGTATTTGG + Intergenic
1058735560 9:107890877-107890899 ATTTTCAAGGTGATGGTATTTGG - Intergenic
1058777374 9:108297614-108297636 ATTCATATGTTGATGGTATTTGG - Intergenic
1059081370 9:111253798-111253820 ATTCACAACATGATGGGATTCGG + Intergenic
1059252398 9:112897309-112897331 ATTCACATGCTGGTATTATTAGG + Intergenic
1059465174 9:114464570-114464592 ACCCACAAGCTGATAGTATTAGG - Intronic
1059524777 9:114980521-114980543 ATTCCCAATGTGATGGTATTTGG + Intergenic
1061441742 9:130609417-130609439 CTTCAGATGCTTATGGTCTTGGG + Intronic
1061557336 9:131379185-131379207 ATTCATCAGCTGATGGAATTTGG + Intergenic
1185885656 X:3780338-3780360 ACTCCCAAGGTGATGGTATTAGG + Intergenic
1186228957 X:7431982-7432004 ATCCCCAGGGTGATGGTATTAGG + Intergenic
1186467954 X:9798949-9798971 TCTCACATGCTGATGCCATTAGG + Intronic
1186468825 X:9805427-9805449 ACCCACAAGGTGATGGTATTAGG + Intronic
1186472402 X:9831907-9831929 ATCCTCATGGTGATGGTGTTAGG - Intronic
1186890421 X:13954139-13954161 ATCCCCAAGATGATGGTATTAGG - Intergenic
1187178155 X:16915666-16915688 ACTCTCAAGGTGATGGTATTAGG + Intergenic
1188130961 X:26432327-26432349 ATTCACATTTGGATGGTAGTGGG - Intergenic
1188380387 X:29484410-29484432 ATTCATATGTTGATCGTATTTGG - Intronic
1188540232 X:31241718-31241740 ATTGACATGATGAGGGTCTTAGG - Intronic
1188714592 X:33446409-33446431 ATTGCTAAGCTGATGGTATTAGG + Intergenic
1188970896 X:36613756-36613778 ATTCACATGCTTGTGGCAGTAGG - Intergenic
1189170199 X:38901700-38901722 ATTCCCAAGGTGATGGCATTAGG + Intergenic
1189523370 X:41794193-41794215 ATTCACCTGATGATGATATTTGG - Intronic
1189863271 X:45295360-45295382 ATTCACAAGCCTCTGGTATTTGG + Intergenic
1190487291 X:50940391-50940413 ATTCCCAGTGTGATGGTATTTGG - Intergenic
1190707907 X:53046039-53046061 ATTCTCCTATTGATGGTATTTGG + Intergenic
1190757589 X:53414243-53414265 AAGAACATGCAGATGGTATTTGG + Intronic
1191044153 X:56118085-56118107 AGTCCCAAGCTGATGGCATTAGG - Intergenic
1191681983 X:63850445-63850467 ATTGCCATTGTGATGGTATTAGG + Intergenic
1191936141 X:66429097-66429119 ATTCACCTGTTGATGGTCATTGG - Intergenic
1192775543 X:74240632-74240654 ATACAAGTGCTGATGTTATTGGG - Intergenic
1193146813 X:78084972-78084994 ATTCATATTTTGATGGCATTTGG + Intronic
1193511931 X:82412856-82412878 ATCCACAAGGTGATGATATTAGG - Intergenic
1193644231 X:84047363-84047385 CTTCACGTGCTGATTGTAATAGG + Intergenic
1194081846 X:89477438-89477460 ATTCATATGATGACTGTATTAGG - Intergenic
1194865069 X:99055120-99055142 ATACTCAAGGTGATGGTATTAGG + Intergenic
1195651997 X:107294635-107294657 ATCCCCAAGGTGATGGTATTAGG - Intergenic
1196407575 X:115380800-115380822 ACCCACAAGGTGATGGTATTAGG + Intergenic
1196731540 X:118945966-118945988 ACTCCCAGGATGATGGTATTAGG + Intergenic
1197270952 X:124424256-124424278 ATTCATATGCTGATGGCATTTGG + Intronic
1197707096 X:129641832-129641854 ATTCATATGTTGATGGTATTTGG - Intergenic
1197714501 X:129696760-129696782 ATTCACATTGTGATCTTATTGGG - Intergenic
1198170593 X:134101663-134101685 ACACACAAGGTGATGGTATTAGG + Intergenic
1198764984 X:140071361-140071383 ATTCATATGCTGATGGCATTTGG - Intergenic
1199250596 X:145657999-145658021 ACTCCCAAGGTGATGGTATTAGG + Intergenic
1199495062 X:148443551-148443573 ATCCCCAAGGTGATGGTATTAGG - Intergenic
1199867485 X:151865643-151865665 ATTAACATTCTAATGATATTGGG + Intergenic
1199951584 X:152711184-152711206 ATTACCAAGGTGATGGTATTAGG + Intergenic
1199958099 X:152757264-152757286 ATTACCAAGGTGATGGTATTAGG - Intergenic
1200434514 Y:3133628-3133650 ATTCATATGATGACTGTATTAGG - Intergenic
1200837233 Y:7744485-7744507 ATTCACAAAATGATGGTATATGG + Intergenic
1201597121 Y:15682838-15682860 ATTGCCAGGGTGATGGTATTAGG + Intergenic