ID: 1030971642

View in Genome Browser
Species Human (GRCh38)
Location 7:116064542-116064564
Sequence TCAAGGGGGTGGAGGGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 917
Summary {0: 1, 1: 1, 2: 8, 3: 112, 4: 795}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030971642 Original CRISPR TCAAGGGGGTGGAGGGCAAG GGG Intronic
900171373 1:1270781-1270803 TCAAGGGGCTGGCAGGCAAGAGG - Intronic
900396650 1:2455788-2455810 GCAGGGGGGTGGAGGGCCCGAGG - Intronic
900573911 1:3373666-3373688 TCCTGGGGGTGCTGGGCAAGCGG + Intronic
900809473 1:4790471-4790493 TTAAGGGGCTGGAAGACAAGCGG + Exonic
900811105 1:4801939-4801961 TCCAGTGGGTGGTGGGCAAGAGG - Intergenic
901160081 1:7170460-7170482 TGTCGGGGTTGGAGGGCAAGGGG - Intronic
901942368 1:12673058-12673080 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
902395072 1:16128086-16128108 GCAAGGGAGTGGAGGAAAAGAGG + Intronic
902715739 1:18271606-18271628 CCTAGGGGAGGGAGGGCAAGAGG - Intronic
902966918 1:20011879-20011901 TCCAGGGGGTGGTGGGGAATGGG + Intergenic
903017098 1:20368355-20368377 GGACGGGGGTGGAGGGCAAATGG - Intergenic
903305175 1:22408203-22408225 TAGAGGGGGTGGAGGGTGAGGGG + Intergenic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904593089 1:31626193-31626215 TCAAGGGGGAGGAGGGAAGGAGG - Intronic
904773986 1:32895659-32895681 TCATGGCGATGGAGGCCAAGAGG + Exonic
905116623 1:35646788-35646810 TGAAGGGGGAGCAGGGAAAGAGG + Intergenic
905312521 1:37059867-37059889 TCACGGGGGTTGAGGGAAAGTGG - Intergenic
905480823 1:38260845-38260867 TTAGGGAGGAGGAGGGCAAGAGG - Intergenic
906524526 1:46486452-46486474 CCAAGGGGGAGGTGGGTAAGGGG - Intergenic
906561238 1:46758585-46758607 CGAAGGGAGTGGAGGGTAAGGGG - Intronic
906639128 1:47431078-47431100 CCAAGGTGGTGGTGGGCAAATGG - Intergenic
906842682 1:49157229-49157251 TCTGGGGGGTGGGGGACAAGGGG - Intronic
907574585 1:55514634-55514656 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
908252272 1:62274523-62274545 TGAAGGGGAGGGAGGGCAGGAGG + Exonic
908672795 1:66566856-66566878 GTTAGGGGGTGGGGGGCAAGGGG - Intronic
908868861 1:68584486-68584508 GTCAGGGGGTGGAGGGCTAGGGG + Intergenic
908902186 1:68968447-68968469 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
909212037 1:72836258-72836280 GTCAGGGGTTGGAGGGCAAGGGG + Intergenic
909456556 1:75856433-75856455 TGTCGGGGGTGGAGGGCTAGGGG - Intronic
909861365 1:80609910-80609932 CCGGTGGGGTGGAGGGCAAGGGG - Intergenic
909888987 1:80979287-80979309 TCAGGGAATTGGAGGGCAAGAGG + Intergenic
910632006 1:89364943-89364965 GTCAGTGGGTGGAGGGCAAGGGG - Intronic
910948420 1:92618195-92618217 TCAAGGGGTGGAAGTGCAAGTGG + Intronic
911108960 1:94163217-94163239 TCAAGGGGTGGAAGTGCAAGTGG - Intronic
911962109 1:104318670-104318692 TCCAGGTGGTGGATGACAAGAGG + Intergenic
912596405 1:110881248-110881270 TGAAGGTGGGGGAGGGCAGGAGG - Intronic
912749834 1:112277544-112277566 GGCAGGGGGTGGAGGGAAAGTGG + Intergenic
913279323 1:117170997-117171019 TCAGGGGGGCTGGGGGCAAGGGG - Intronic
915137950 1:153746866-153746888 TTAAGGGATTAGAGGGCAAGGGG + Intronic
915391504 1:155548161-155548183 TCAGTGGGTTGGGGGGCAAGGGG + Intronic
915578099 1:156794666-156794688 TTAAGCGGCTGCAGGGCAAGAGG + Exonic
915579009 1:156802217-156802239 TGAAGGAGGTGGGAGGCAAGAGG - Intergenic
915988033 1:160485808-160485830 TCAAGGAGTTGGAGGAGAAGTGG + Exonic
916614297 1:166423601-166423623 GTCAGGGGGTGGAGGGCTAGGGG - Intergenic
916760534 1:167812302-167812324 TCAAGGTGGTGGAGGGTGGGTGG - Intronic
917070859 1:171149211-171149233 TCGGGGGGATGGAGGGCTAGGGG - Intronic
917274987 1:173322323-173322345 GTAAGGGGGCGGGGGGCAAGGGG + Intergenic
917710448 1:177679217-177679239 ACTAGGGGGTGGGGGACAAGGGG - Intergenic
917715191 1:177728191-177728213 TCGGGGGGGTCGGGGGCAAGGGG + Intergenic
918169079 1:181978194-181978216 TCAGTGGGGTGGGGGACAAGGGG + Intergenic
918174576 1:182031618-182031640 TCAAGGAGGTTGATGGAAAGGGG + Intergenic
918353218 1:183679382-183679404 TGTCGGGGGTGGGGGGCAAGGGG - Intronic
918593457 1:186265602-186265624 TCAGGGGAGTGGGGGGCTAGGGG - Intergenic
918766164 1:188486492-188486514 CTCAGGGGGTGGTGGGCAAGGGG + Intergenic
918921114 1:190711660-190711682 TCAGGGGGGTGGGGGGAAAAGGG - Intergenic
919227499 1:194725686-194725708 TCAGGAGGGTGGAGGGCAGAAGG - Intergenic
920584376 1:207143331-207143353 GTCAGGGGGTGGGGGGCAAGGGG + Intronic
920673890 1:208025538-208025560 TCAGGGGGTAGGAGGACAAGTGG - Exonic
921753065 1:218819916-218819938 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
922761081 1:228131129-228131151 TCAAGTGGCTGAAGGTCAAGAGG - Intergenic
923418153 1:233785350-233785372 TTTAGGGGGTGGGAGGCAAGGGG + Intergenic
923469328 1:234276932-234276954 TGAAGCAGGTGGAGGGCAAGAGG + Intronic
924837070 1:247660950-247660972 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1062815168 10:493992-494014 TGAAGGGGGAGGAGGACAACTGG + Intronic
1062911475 10:1215127-1215149 CCAAGGGGCTGGAGGTCAGGGGG - Intronic
1063291304 10:4752490-4752512 TCGAGGGGGTGGGGGGCTACAGG + Intergenic
1063463530 10:6229208-6229230 GCAAAGGGGTGAAGGGCCAGAGG + Intronic
1063618943 10:7627133-7627155 AAAACGGGGTGGTGGGCAAGGGG + Intronic
1064046167 10:12017887-12017909 TCTGGGGGTTGGAGGGCCAGGGG - Intronic
1064236111 10:13577377-13577399 TGCAGGGGGTGGAGGGCTAGGGG - Intergenic
1064565119 10:16631905-16631927 TCATGGGGATGGGGGACAAGGGG + Intronic
1064729882 10:18319443-18319465 CTCAGGGGGTGGGGGGCAAGGGG + Intronic
1064788929 10:18933705-18933727 GTCAGGGGGTGGAGGGCAAGGGG - Intergenic
1064816618 10:19272678-19272700 TGTGGTGGGTGGAGGGCAAGGGG - Intronic
1065428032 10:25625930-25625952 TCAGGGGGCTGGGGGGCTAGGGG + Intergenic
1065834014 10:29640755-29640777 TCAATGGGGTGGAAGGAGAGAGG - Intronic
1066150437 10:32610566-32610588 TTGTGGGGGTAGAGGGCAAGGGG - Intronic
1066187011 10:33019981-33020003 TCACGGGGGTGGGGGGCAAGGGG - Intergenic
1066256951 10:33689407-33689429 GTTAGGGGGTGGGGGGCAAGGGG - Intergenic
1066302004 10:34105538-34105560 TCATGGGAGTAGAGGGCAGGAGG - Intergenic
1066499813 10:35981701-35981723 TTCAGGGGGTGGGGGACAAGGGG - Intergenic
1066763205 10:38777921-38777943 TCAGGGGGGTGGGAGGCAGGGGG - Intergenic
1067226932 10:44382684-44382706 CCCAGGGGGTGGAGGGGGAGAGG - Intronic
1067266907 10:44754346-44754368 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1067909826 10:50334997-50335019 TCAAGGGAGTACAGGGCATGAGG + Intronic
1067968502 10:50942109-50942131 TGAAGCTGGTAGAGGGCAAGGGG - Intergenic
1068034511 10:51742876-51742898 TTCAGGAGGTGGGGGGCAAGGGG + Intronic
1069242968 10:66165303-66165325 TGAAGGGGGTGGAGGAAGAGAGG + Intronic
1069914030 10:71776203-71776225 TCTTGGGGGTGGAGGGCATTGGG - Intronic
1070349851 10:75581780-75581802 TTTAGGGGGTGGGGGGCTAGGGG + Intronic
1070774858 10:79103582-79103604 TCTAGGGGAGGGAGGGCAAGGGG + Intronic
1071108324 10:82124561-82124583 GTCGGGGGGTGGAGGGCAAGAGG + Intronic
1071600374 10:86955977-86955999 CCAAGGGGGTGGGGAGGAAGAGG + Intronic
1071712202 10:88060819-88060841 TCAAGGGGGTGGTGGCAAGGTGG + Intergenic
1072045442 10:91650132-91650154 TCCAGGGGGTGGGGGGCAAGGGG + Intergenic
1072372562 10:94779110-94779132 TTGAGGGGTTGGGGGGCAAGGGG + Intronic
1072393001 10:95008285-95008307 GTCAGGGGGTGGGGGGCAAGAGG - Intergenic
1072420912 10:95290363-95290385 TTACTGGGGTGGGGGGCAAGTGG - Intronic
1072994298 10:100229529-100229551 CCATGGGGCGGGAGGGCAAGCGG + Exonic
1073300069 10:102465760-102465782 TTGAGGGTGGGGAGGGCAAGTGG + Intronic
1073485998 10:103819566-103819588 AGAAGAGGGAGGAGGGCAAGGGG + Intronic
1073885415 10:108033939-108033961 TTCAGGGGGTGGAGGGCTAGGGG + Intergenic
1073968949 10:109024726-109024748 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1075085121 10:119409708-119409730 TAAAGGGGTTGGGGGGCAGGGGG - Intronic
1075753281 10:124791499-124791521 TCAAGGGATTGGAGCCCAAGGGG - Intronic
1076396769 10:130144453-130144475 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1076884267 10:133254433-133254455 TCAAGGGGCTGGTGGGCCAGGGG + Intergenic
1077555648 11:3224834-3224856 ACATGGGGGTGGTGGGGAAGCGG + Intergenic
1077914957 11:6605303-6605325 TCAGGAGAGTGGAAGGCAAGAGG + Intronic
1077971314 11:7193970-7193992 GTCAGGGGGTCGAGGGCAAGGGG + Intergenic
1078422067 11:11220746-11220768 ACATGGGGGTGGAGGGGCAGCGG - Intergenic
1078458270 11:11492742-11492764 TTCGGGGGGTGGGGGGCAAGGGG + Intronic
1079263170 11:18903423-18903445 TGTCGGGGGTGGGGGGCAAGGGG + Intergenic
1079286107 11:19134703-19134725 GTCAGGGGGTGGGGGGCAAGGGG + Intronic
1079301227 11:19280680-19280702 AGAAGGGGGTGGAGGTGAAGGGG + Intergenic
1079309941 11:19356272-19356294 TCAGGGGGGAGGATGGCAAAGGG + Intronic
1079863547 11:25705896-25705918 TGTTGGGGGTGGAGGTCAAGGGG - Intergenic
1080023982 11:27594644-27594666 TGAGGGGGGTGGGGGGCTAGGGG - Intergenic
1080038790 11:27737155-27737177 GCCAAGGGGTGCAGGGCAAGAGG - Intergenic
1080429519 11:32185403-32185425 TCAAAGGGATTGAGTGCAAGAGG - Intergenic
1080441442 11:32298564-32298586 TCATGGGGGTAGATGGCAAAGGG + Intergenic
1080844280 11:36013452-36013474 GTAGGGGGGTGGGGGGCAAGGGG - Intronic
1081508951 11:43748456-43748478 ACTAGAGGGTGGAGGGAAAGGGG + Intronic
1081678080 11:44982661-44982683 TGAAGGGGGTTCAGGGCATGGGG - Intergenic
1082130395 11:48481711-48481733 TCAAGGTGGGGCAGGGCAGGGGG - Intergenic
1082637793 11:55617675-55617697 TACGGGGGGTGGGGGGCAAGGGG + Intergenic
1082776403 11:57248118-57248140 GGTGGGGGGTGGAGGGCAAGGGG + Intergenic
1082886343 11:58087710-58087732 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1082957824 11:58890094-58890116 ACTAGAGGGTGGAGGGAAAGGGG - Intronic
1082957935 11:58891595-58891617 CCTAGAGGGTGGAGGGAAAGGGG - Intronic
1082973373 11:59047713-59047735 TCTAGAGGGTGGAGGGAAAGGGG - Intergenic
1082977786 11:59091489-59091511 TCTAGAGGGTGGAGGGAAAGGGG - Intergenic
1083507563 11:63173213-63173235 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1083733564 11:64667110-64667132 TGAGGGGGGTGGAGGAGAAGCGG + Intronic
1083782823 11:64926802-64926824 TCAAGGGGAAGGAGGTGAAGCGG + Exonic
1083897778 11:65628785-65628807 TCAAGGAGGCGGCGGGCAACAGG - Intronic
1083936748 11:65873361-65873383 TCCTGGGGGTGGAGGGCAGGAGG - Intronic
1084021042 11:66418471-66418493 TCACGGAGGTGGGAGGCAAGGGG + Intergenic
1084450588 11:69234506-69234528 CCAAGACGGTGGAGGGAAAGAGG + Intergenic
1084661919 11:70551036-70551058 CCAAGGGGCTGGAGTGCCAGCGG + Intronic
1084686704 11:70700384-70700406 TCAATGGAGTGGAGGGCAGAGGG - Intronic
1084722676 11:70917851-70917873 TCAGGGGGGTGGAGGGTGAGAGG + Intronic
1086028096 11:82319204-82319226 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1086037568 11:82435333-82435355 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1086277446 11:85147898-85147920 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1087097351 11:94331843-94331865 TTCAGGGGGTGGGGGGCTAGGGG + Intergenic
1087610378 11:100426908-100426930 TCTAGGGGGTGGGAAGCAAGGGG + Intergenic
1087618300 11:100514046-100514068 TTCATGGGGTGGAGGGCAATGGG - Intergenic
1087686247 11:101268977-101268999 TGTTGGGGGTGGTGGGCAAGGGG - Intergenic
1087694814 11:101364623-101364645 TCATGGGGTGGGAGGGCTAGCGG - Intergenic
1087749818 11:101995019-101995041 TGTCGGGGGTGGAGGGCTAGGGG - Intronic
1087888338 11:103506446-103506468 TCATGGGGTTGGGGGGCCAGGGG + Intergenic
1087937064 11:104046886-104046908 TGTCGGGGGTGGAGGGCTAGGGG - Intronic
1088111707 11:106268663-106268685 TGTTGGGAGTGGAGGGCAAGGGG - Intergenic
1088179981 11:107098317-107098339 GTCAGGGGGTGGAGGGCTAGGGG + Intergenic
1088732204 11:112693641-112693663 TCACAGGGGTGGGGGGCAGGGGG - Intergenic
1089268124 11:117281673-117281695 TGATGGGGGTGGAGGTAAAGTGG - Exonic
1089648971 11:119899633-119899655 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1089694202 11:120206637-120206659 TCAAGGGTGTGGTGGGAAAGTGG - Intergenic
1089706079 11:120278760-120278782 GTCAGGGGGTGGAGGGCAAGGGG + Intronic
1089827380 11:121291029-121291051 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
1089919297 11:122193254-122193276 TCAAGGTGGTGAAGGTCATGTGG - Intergenic
1090275160 11:125413826-125413848 TGAAGGGGGAGAAAGGCAAGAGG + Intronic
1090324889 11:125876759-125876781 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1090451057 11:126806828-126806850 TGTTGGGGGTGGGGGGCAAGGGG - Intronic
1090608629 11:128450812-128450834 ACCAGGGGGTGGTGGGCTAGGGG + Intergenic
1090748659 11:129727298-129727320 ACATGGGGATGGAGGGCAGGGGG + Intergenic
1091035104 11:132225856-132225878 TCAGGGGGTTGGGGGGCTAGAGG - Intronic
1091161153 11:133422112-133422134 GCCAGGGGGTGGGGGGCTAGGGG - Intronic
1091166944 11:133486904-133486926 TGTAGGGGGTGGAGGGGAAGAGG - Intronic
1091180866 11:133603357-133603379 AGCAGGGGGTGGAGGGGAAGAGG + Intergenic
1091284001 11:134397920-134397942 TCAAGAGAGTGCTGGGCAAGGGG - Intronic
1091642930 12:2251221-2251243 TCATGGGGGTGAAGGGCAAAGGG + Intronic
1092023448 12:5221719-5221741 TCTAGGTGGTAGAGGGCAAAAGG + Intergenic
1092960714 12:13594520-13594542 GTAAGGGGGTGGGGGGCTAGGGG + Intronic
1093977274 12:25437218-25437240 TTTGGGGGGTGGGGGGCAAGGGG + Intronic
1094304415 12:29001449-29001471 CCCAGGAGATGGAGGGCAAGAGG + Intergenic
1094598309 12:31885289-31885311 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1095356944 12:41285847-41285869 GTCAGGGGGTGGTGGGCAAGGGG + Intronic
1096777237 12:53971811-53971833 TCAGAGGGATGGAAGGCAAGGGG + Intergenic
1096902389 12:54898631-54898653 TCGGGGGGGTGGAGTGAAAGGGG + Intergenic
1097460285 12:59853863-59853885 TCAGGGTGGTGGAGGGCTAGGGG - Intergenic
1097505883 12:60469242-60469264 ACCAGGGGGTGGAGGGTGAGAGG - Intergenic
1097777873 12:63668822-63668844 TGAAGCGCGTGAAGGGCAAGCGG - Intronic
1098780704 12:74682372-74682394 TCAGGGGGGTGGGGGGCTAGGGG + Intergenic
1099316997 12:81096616-81096638 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1099485713 12:83226982-83227004 ACCAGGGGGTGGAGAGCAAGGGG - Intergenic
1099687646 12:85909831-85909853 GCCGGGGGGTGGGGGGCAAGGGG + Intergenic
1099919313 12:88937962-88937984 AGAAGGAGGTGGAGGGCAAAGGG + Intergenic
1100317197 12:93455262-93455284 TGTCGGGGGTGGGGGGCAAGGGG - Intergenic
1100432145 12:94540551-94540573 ACAAGAAGGTGCAGGGCAAGAGG - Intergenic
1100641471 12:96485693-96485715 GCAGGGGAGGGGAGGGCAAGGGG - Intergenic
1101289336 12:103351928-103351950 GGAAGAGGGTGGAGGGGAAGGGG - Intronic
1101538270 12:105640782-105640804 TCAGATGGGTTGAGGGCAAGTGG - Intergenic
1101568606 12:105932983-105933005 TTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1101715549 12:107309048-107309070 TCAAGCAGCTGGAGGGCAAGAGG - Intergenic
1101782922 12:107851600-107851622 TCAGGGGGGTTGGGGTCAAGAGG + Intergenic
1101808990 12:108091620-108091642 ACAAGGTGGTTGAGGACAAGGGG + Intergenic
1102035406 12:109768306-109768328 TCAAGAGCGCCGAGGGCAAGCGG + Exonic
1102929188 12:116849552-116849574 CAGAGGTGGTGGAGGGCAAGAGG - Exonic
1103249240 12:119485907-119485929 ACAAGGTGGTGGAGGGGAAGCGG - Intronic
1103268060 12:119647768-119647790 TCGGGGGGGTGGGGGGCAAAGGG - Intergenic
1103598979 12:122042100-122042122 AGAAGGGGGTGCAGGACAAGGGG + Intronic
1103795220 12:123498688-123498710 TCACGGTGGTGGAGGCCCAGGGG - Exonic
1104499516 12:129271555-129271577 GTTAGGGGGTGGGGGGCAAGGGG - Intronic
1104546581 12:129718338-129718360 TCCAGGGAGGGGAGGGGAAGGGG + Intronic
1104611849 12:130235190-130235212 TGAAGGGGGTGGGGGGCATTCGG + Intergenic
1105431356 13:20340321-20340343 CCCAGGGGCTGGAGGGCAGGTGG - Intergenic
1105968410 13:25405263-25405285 TCAAGGGGAGGGATGGGAAGAGG + Intronic
1106048673 13:26169340-26169362 CGAAAGGGGAGGAGGGCAAGGGG + Intronic
1106376819 13:29197214-29197236 TCCAGGGGATGGGGGGCAAGGGG - Intronic
1107673499 13:42771058-42771080 TTCAGGGGGTAGAGGGCAAGGGG - Intergenic
1108154303 13:47569864-47569886 GTCAGGGGGTGGAGGGCTAGGGG + Intergenic
1108164940 13:47683097-47683119 TCACGGGGTGGGGGGGCAAGGGG - Intergenic
1108165861 13:47692431-47692453 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1108459069 13:50647152-50647174 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1108854056 13:54771868-54771890 GCCAGGGGGTGGAGGGCAAGGGG - Intergenic
1109755527 13:66754223-66754245 GTCAGTGGGTGGAGGGCAAGTGG + Intronic
1109938535 13:69327558-69327580 TTCAGGGGGTGGAGGCTAAGGGG - Intergenic
1109973549 13:69802010-69802032 TCAGGGGGTAGGGGGGCAAGGGG - Intronic
1110200555 13:72845134-72845156 ACTTGGGGGTGGGGGGCAAGGGG - Intronic
1110822688 13:79934767-79934789 CTTAGTGGGTGGAGGGCAAGGGG + Intergenic
1111053133 13:82912461-82912483 TCACAGGGTTGGGGGGCAAGGGG + Intergenic
1111835835 13:93387320-93387342 TGTTGGGGGTGGAGGGGAAGGGG - Intronic
1112081621 13:95978018-95978040 GCCAGGGGGTAGGGGGCAAGGGG + Intronic
1112233892 13:97617510-97617532 TTAAGGAGGTGGATAGCAAGAGG + Intergenic
1113800333 13:113083074-113083096 TCAGAGGAGTGGAGGACAAGAGG - Intronic
1114600153 14:23949443-23949465 TCAGGGGGGTGGGGGGCTAGGGG + Intergenic
1114742856 14:25115949-25115971 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1114797365 14:25731750-25731772 TGTCGGGGGTGGAGGGCTAGGGG - Intergenic
1115385421 14:32790763-32790785 GCCAGGGAGTGGGGGGCAAGGGG - Intronic
1115736059 14:36331338-36331360 CACAGGGAGTGGAGGGCAAGGGG - Intergenic
1115842239 14:37484988-37485010 GTCAGGGGGTGGAGGGGAAGGGG - Intronic
1117064884 14:52002788-52002810 TAAAGGGGCTGGAGGACAAAAGG - Intronic
1117399346 14:55344708-55344730 TGGTGGGGGTGGAGGACAAGGGG - Intronic
1117634335 14:57725837-57725859 TCAAGGGGTGGAAGTGCAAGTGG + Intronic
1117819803 14:59636346-59636368 GCAAGGGAGCAGAGGGCAAGAGG - Intronic
1118035061 14:61857611-61857633 TCAAGAGGCTGGAGGGGAAGTGG + Intergenic
1118063950 14:62170321-62170343 TCAGGGCGGTGGGGGGCAAGGGG - Intergenic
1118088533 14:62446239-62446261 GTCAGGGGGTGGAGGGCTAGGGG - Intergenic
1118298145 14:64589189-64589211 TCAAGGGGGTGAAGCGTATGTGG - Exonic
1118664323 14:68050298-68050320 TCAAGGGGGTGATGGGGAAGAGG - Intronic
1119120085 14:72067308-72067330 TCGGGGAGGTGGAGGACAAGGGG + Intronic
1119586441 14:75840390-75840412 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1120022650 14:79548182-79548204 TCAGGTGGGTGGAGGGCTAGGGG - Intronic
1121266047 14:92603337-92603359 TGAAGGGTGGGGAGGGCAAAGGG - Intronic
1121485994 14:94314713-94314735 TCAATGGGGCGTAGTGCAAGAGG + Intronic
1121942800 14:98089224-98089246 GTCGGGGGGTGGAGGGCAAGGGG - Intergenic
1122275961 14:100590947-100590969 GCAGTGGGGTGGAGGCCAAGGGG - Intergenic
1123400993 15:19986235-19986257 TGTTGGGGGTGGGGGGCAAGAGG + Intergenic
1123968491 15:25482144-25482166 TCGCGGGGGTGGGGGGCTAGGGG - Intergenic
1124045493 15:26146257-26146279 TCAAGGTGGTCGGGGGCAGGAGG + Intergenic
1124053116 15:26217408-26217430 TCAGGGGGTGGGGGGGCAAGGGG + Intergenic
1124343420 15:28904602-28904624 TCAAATGGGTGGAAGGGAAGAGG - Intronic
1125104004 15:35949646-35949668 TCATGGGGGTGGGGGGCTAGCGG + Intergenic
1125142280 15:36422432-36422454 TTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1125361695 15:38871401-38871423 GCAAGGGGGTGGAGGGGCAGAGG - Intergenic
1126173789 15:45716653-45716675 TCAATGGGGTTGAGGGGATGGGG - Intergenic
1126507783 15:49427851-49427873 AAAAGGGAGTGGTGGGCAAGTGG + Intronic
1126559917 15:50032179-50032201 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1126662110 15:51043496-51043518 CCAGGGGGGTGGGGGGCAAAGGG - Intergenic
1126891136 15:53205644-53205666 TGATGGGGGTGGCGGGGAAGGGG - Intergenic
1127056946 15:55141801-55141823 TCAGGGGAGTGGAAGTCAAGGGG + Intergenic
1127509292 15:59624353-59624375 CCAAGGGGGTGGATGGCCTGAGG - Intronic
1127568082 15:60213167-60213189 GGGTGGGGGTGGAGGGCAAGGGG + Intergenic
1127572257 15:60255089-60255111 TCAGGGGGTGGGGGGGCAAGGGG + Intergenic
1127798469 15:62457701-62457723 ACAAAGGGGAGGAGTGCAAGAGG + Intronic
1128147074 15:65337692-65337714 TCCTGGAGGTGGAGGGCTAGAGG - Intronic
1128767063 15:70257717-70257739 TCCAGGGTGAGGAGGGCATGTGG + Intergenic
1130904592 15:88231311-88231333 TGATGTGGGTGGGGGGCAAGGGG - Intronic
1131443894 15:92479751-92479773 GTAAGGGGGTGGGGGGCTAGGGG - Intronic
1132566309 16:625170-625192 TCCAGGGGAGGGAGGGGAAGCGG + Intronic
1132586432 16:707569-707591 TCACAGAGGTGGAGGGCAGGTGG - Intronic
1133225049 16:4337066-4337088 TCAAGGGGGCCGGGGGCCAGGGG - Exonic
1133431148 16:5738001-5738023 TGGAGGGGGTGGGGGGCAAGGGG - Intergenic
1133743226 16:8667449-8667471 TCAGGGGATTGGGGGGCAAGGGG - Intergenic
1135185719 16:20314069-20314091 TCCAGGGGATGGGGGGCAAGGGG + Intronic
1135536699 16:23300187-23300209 GTCAGGGGGTGGAGGGCTAGGGG + Intronic
1135732263 16:24904934-24904956 GTCGGGGGGTGGAGGGCAAGGGG - Intronic
1135796651 16:25450545-25450567 GTCAGGGGGTGGAGGGCTAGGGG - Intergenic
1135951398 16:26917775-26917797 TCAGGAGGGTGGGGGGCTAGGGG - Intergenic
1135974798 16:27101200-27101222 TTCAGCGGGTGGGGGGCAAGGGG + Intergenic
1137020280 16:35418356-35418378 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1138175974 16:54898587-54898609 TTGTGGGGGTGGAGGGCAAGGGG - Intergenic
1138306043 16:55975629-55975651 ACCAGGGGGTGGGGGGCTAGGGG + Intergenic
1138850880 16:60627909-60627931 GTCAGGGGGTTGAGGGCAAGGGG + Intergenic
1138931653 16:61665499-61665521 GTCAGGGGGTGGGGGGCAAGGGG + Intronic
1139001411 16:62515117-62515139 ATACGGGGGTGGAGGGCTAGAGG - Intergenic
1140552281 16:75879673-75879695 TTTAGGGGTTGGGGGGCAAGGGG + Intergenic
1141574889 16:84957545-84957567 TCAAGCTTCTGGAGGGCAAGTGG - Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1141911788 16:87065114-87065136 TGAAGGGAGGGGAGGGGAAGAGG + Intergenic
1141981912 16:87556058-87556080 TCGATGGGGTGGAGGCCACGTGG + Intergenic
1142070217 16:88087728-88087750 TCACGGGGGTGTAGGGGAAGCGG - Intronic
1142500759 17:331692-331714 TGAAGGGGGTGCCGGGCATGGGG - Intronic
1143304390 17:5934292-5934314 GCCAGTGGGTGGGGGGCAAGGGG - Intronic
1143308612 17:5969760-5969782 GCCAGGGGGTGGGGGGCTAGGGG + Intronic
1143412116 17:6715594-6715616 TCAGGGGGTTGGAGGGCAAGGGG - Intergenic
1143570314 17:7754007-7754029 TCCATGGGGTGGAGTGCTAGGGG + Intronic
1143633104 17:8149963-8149985 TCAAGCAGGTGCAGGGTAAGTGG - Exonic
1143700946 17:8659618-8659640 TCATGGTTGTGGAGGCCAAGAGG - Intergenic
1143872006 17:9963926-9963948 TCTAGGGGGTGGAGGGCAAGGGG + Intronic
1144052785 17:11511282-11511304 TCAAGGGGTGAGGGGGCAAGGGG + Intronic
1145036071 17:19541398-19541420 TCTAGTGGGTGGGGGGCAGGAGG + Intronic
1145199028 17:20923340-20923362 TCAGGTGGCTGGGGGGCAAGGGG - Intergenic
1147645583 17:42031784-42031806 TCTGGGGAGGGGAGGGCAAGAGG + Exonic
1147776810 17:42907649-42907671 TGTAGGTGGTGGAGGGCAGGAGG + Intronic
1147915035 17:43880912-43880934 TCAGGGAGGCTGAGGGCAAGAGG + Intronic
1148060539 17:44832994-44833016 TCAAGGGGGAGGAGAGAAGGGGG - Intergenic
1148177599 17:45581168-45581190 TCCGGGGGGTGGGGGGCGAGGGG + Intergenic
1148470695 17:47891406-47891428 TCGGGGGGGTGGAGGGCTGGGGG - Intergenic
1148684650 17:49494865-49494887 TGAAGGGCAGGGAGGGCAAGCGG + Intergenic
1149380523 17:56088774-56088796 TCAAGGGGGAGGAGAGCACAAGG - Intergenic
1150481814 17:65516789-65516811 TGAAGGGGGGGCAGGGAAAGGGG + Intergenic
1150626553 17:66845289-66845311 TTAGGGGGGTGGTGGGCAAAGGG + Intronic
1150636484 17:66916717-66916739 GCAGGGAGGTGGAGGGCAAGTGG + Intergenic
1150747731 17:67829462-67829484 TCCGGGGGGTGGGGGGCAAGGGG - Intronic
1150854190 17:68734804-68734826 TCAAGGGGGTTGAGGGCAGAGGG - Intergenic
1150930477 17:69579293-69579315 TCAAGGGGAGGCTGGGCAAGAGG + Intergenic
1151198545 17:72450417-72450439 TTGCGGGGGTGGGGGGCAAGGGG - Intergenic
1151560708 17:74868101-74868123 GCAGGGGAGTGGAGGGGAAGGGG - Intronic
1152387865 17:79985856-79985878 TCAAGGCTGTGGAGGTCAAAGGG + Intronic
1153000141 18:447399-447421 TCAAGGAGGTAGAGGGAGAGGGG + Intronic
1153066092 18:1046727-1046749 TCGGGGGGTTGGGGGGCAAGGGG - Intergenic
1153270390 18:3315327-3315349 GTAGAGGGGTGGAGGGCAAGGGG - Intergenic
1153368610 18:4287679-4287701 GTCATGGGGTGGAGGGCAAGGGG + Intronic
1153710464 18:7793900-7793922 ATAAGGGGCTGGAGGTCAAGAGG + Intronic
1153947763 18:10032322-10032344 TCAAGGAGGAGAAGGGAAAGTGG + Intergenic
1155929547 18:31690985-31691007 TCAGTGGGGTGGGGGGCAAGGGG + Intergenic
1156229532 18:35140181-35140203 TCAAGGCTGTGGAGGGCACCAGG - Intronic
1156454477 18:37285280-37285302 TCAAGGGAGGGGAAGGCCAGAGG - Intronic
1157107955 18:44792551-44792573 TCCAGGCGGTGGTGGGCAACAGG - Intronic
1158015254 18:52775692-52775714 ACAAGTGGCTGGATGGCAAGAGG - Intronic
1158222665 18:55166371-55166393 TCAAGAGGGTGTAGGGGAGGTGG + Intergenic
1158390757 18:57043124-57043146 TGTCGGGGGTGGAGGGCAAGGGG + Intergenic
1158687010 18:59623675-59623697 GCAAGGGGTTGGAGGGCCGGGGG + Intronic
1158735056 18:60069746-60069768 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1159254979 18:65933593-65933615 TATTGGGAGTGGAGGGCAAGAGG + Intergenic
1159345801 18:67201389-67201411 ACAAGAGGGTGGATGGCGAGAGG - Intergenic
1159754771 18:72350888-72350910 TCAAGGATGTGGAGGCCACGTGG + Intergenic
1159889504 18:73940593-73940615 TGAAGAGCGTGGAGGACAAGGGG - Intergenic
1160150329 18:76392920-76392942 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160150357 18:76392989-76393011 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160150394 18:76393081-76393103 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160150404 18:76393104-76393126 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160150487 18:76393316-76393338 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160150506 18:76393362-76393384 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160150553 18:76393482-76393504 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160150601 18:76393597-76393619 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160150740 18:76393947-76393969 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160150766 18:76394008-76394030 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160150813 18:76394128-76394150 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160150878 18:76394294-76394316 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160150897 18:76394340-76394362 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160150916 18:76394386-76394408 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160150963 18:76394506-76394528 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160151057 18:76394736-76394758 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160151096 18:76394828-76394850 TCAGGTGGGGGGAGGGCAGGTGG + Intronic
1160275600 18:77430818-77430840 TCGAGGGGTTGGGGGGCTAGGGG + Intergenic
1160456531 18:79006105-79006127 TCGTGGGGGTGGAGGGCGCGTGG + Intergenic
1160680055 19:408358-408380 TCATGGGGGCGGCAGGCAAGAGG + Exonic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1163565458 19:18048525-18048547 TCATGGGGGTGGTGGGCATGAGG - Intergenic
1163660303 19:18573055-18573077 TCAGGAGGGTGGAGGACATGTGG + Intronic
1164026445 19:21357657-21357679 TCAATGGTGTGAAGGGCCAGAGG - Intergenic
1164460024 19:28438822-28438844 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
1164892255 19:31834398-31834420 TCAAGGTGGTTTAGGGTAAGTGG + Intergenic
1164913309 19:32029523-32029545 TCAAGAGGCTGGAGTCCAAGTGG - Intergenic
1164918806 19:32073165-32073187 CCAAGGGAGTGGAGTGAAAGTGG - Intergenic
1165077442 19:33287821-33287843 TAAGGGAGGTGGAGGACAAGAGG - Intergenic
1165121488 19:33561695-33561717 TCTAGGGGTTGGGGGGCAAGGGG - Intergenic
1165940098 19:39410564-39410586 GCTAGGGGGAGGAGGGGAAGAGG - Intergenic
1166616229 19:44249866-44249888 TCTAGGGGGTGGAGGGGAGGTGG - Intronic
1167100074 19:47399240-47399262 AAAAGGGGGAGGAGGGGAAGAGG + Intergenic
1167599658 19:50447120-50447142 ACTGGGGGGTGGAGGTCAAGGGG - Intronic
1167763215 19:51462249-51462271 TCAGGGGGATGGAGGCAAAGGGG + Intergenic
1168063722 19:53908178-53908200 TCAAGTGGGTCAAGGGAAAGAGG - Intergenic
1168098704 19:54129420-54129442 TCACAGGGGCAGAGGGCAAGGGG - Intronic
925843926 2:8018944-8018966 TAAAGGGGGCTGAGGGCATGCGG + Intergenic
925885701 2:8392359-8392381 TCAAGGGGGTGTTGAGCCAGAGG + Intergenic
926330036 2:11816910-11816932 TCAGGGGGTTGGGGGGGAAGGGG - Intronic
926472700 2:13280784-13280806 TCATGGTGGTGGAAGGCAGGGGG - Intergenic
926585392 2:14680264-14680286 GTCAGGGGGTGGAGGGCAAAGGG + Intergenic
927125502 2:20009475-20009497 GTCAGGGGGTGGGGGGCAAGAGG + Intronic
927267283 2:21164081-21164103 TTAAGGGCGGGGAGGGGAAGGGG - Intergenic
927297330 2:21469731-21469753 CTAAGGAGGTGGAGGGCTAGAGG - Intergenic
928094211 2:28393965-28393987 AAAAGGGGGTGGGGGGGAAGGGG - Intronic
928691420 2:33803505-33803527 TAAGTGGGGTGGAGGGCAACAGG + Intergenic
928787225 2:34903223-34903245 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
928869045 2:35952917-35952939 TTGGTGGGGTGGAGGGCAAGGGG - Intergenic
929910510 2:46085591-46085613 TCAGGGAGGAGGAGGCCAAGTGG - Intronic
929967377 2:46545208-46545230 TGGAGGATGTGGAGGGCAAGGGG + Intronic
930175460 2:48296842-48296864 TCAGGGGGGTGAGGGGTAAGGGG - Intergenic
930222745 2:48761724-48761746 TTGTGGGGGTGGAGGGCATGGGG - Intronic
930327982 2:49944464-49944486 TCAAAGTGGGGGAGGGGAAGAGG + Intronic
930672401 2:54164855-54164877 TCACGGGGGTGAGGGGCAAGAGG - Intronic
931683659 2:64773754-64773776 TCAAGGTGGAGAAGGGCGAGGGG - Intergenic
931985618 2:67739111-67739133 TCATGGGGTTGGGGGGCTAGGGG - Intergenic
932380177 2:71275523-71275545 TTGGGGGGGTGGGGGGCAAGGGG + Intergenic
932619302 2:73256411-73256433 TCAAGGGGCTGGTGGGGCAGGGG + Exonic
932798325 2:74716803-74716825 TCATGGAGGTGGGGGGCAAGTGG - Intergenic
933335700 2:80956168-80956190 GTCAGGGGGTGGTGGGCAAGCGG - Intergenic
933748173 2:85585557-85585579 TTAAGGGTGTGCAGGGCAAGGGG + Intronic
934095829 2:88602796-88602818 TGACGGGGGTGGGGAGCAAGGGG + Intronic
934676344 2:96252543-96252565 TCAAGAGGGGAGAGGGCACGTGG + Exonic
934764684 2:96874080-96874102 TCAAAGATCTGGAGGGCAAGTGG + Intergenic
934785294 2:97000781-97000803 GTCAGGGGGTGGAGGGCAAGGGG - Intronic
934852876 2:97712635-97712657 GCAAGGAGGTGGTGGGCAAGGGG + Intergenic
934926233 2:98383478-98383500 TCTATGGGGTGGAGGGCACCGGG - Intronic
935021422 2:99236135-99236157 TGTAGGGGGTGGGGGGCTAGGGG + Intronic
935451774 2:103217747-103217769 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
936140418 2:109935412-109935434 TCAAGGGGGAGGGGAGCAGGAGG + Intergenic
936177108 2:110233357-110233379 TCAAGGGGGAGGGGAGCAGGAGG + Intergenic
936204277 2:110436074-110436096 TCAAGGGGGAGGGGAGCAGGAGG - Intronic
936517698 2:113192768-113192790 CCAAGGGTGTGGAGAGCATGAGG - Intronic
936695536 2:114943044-114943066 GCTGGGGGGTGGAGGGCTAGAGG - Intronic
937274541 2:120675402-120675424 GCAGGGGAGTGGAGGGAAAGGGG + Intergenic
937321067 2:120961096-120961118 TCAATGTGGTGGAGGGGGAGGGG - Intronic
937365412 2:121257487-121257509 TCAGGTGGGTGGAGGGCAGGAGG - Intronic
937492020 2:122379816-122379838 TCAGGGGGGTGGGGGGCTAGGGG - Intergenic
937604098 2:123775700-123775722 TCAGGGTGTGGGAGGGCAAGAGG - Intergenic
937784236 2:125876655-125876677 TCTCGGGGGTGGGGGGCTAGGGG - Intergenic
937946060 2:127338479-127338501 GCGAGAGGGTGGAGGGCAGGAGG - Intronic
938305112 2:130248011-130248033 TCTATGGGGTGTCGGGCAAGTGG + Intergenic
938448902 2:131399196-131399218 TCTACGGGGTGTCGGGCAAGTGG - Intergenic
938595547 2:132784012-132784034 TGGAGGGGGCGGAGGGGAAGGGG + Exonic
939162163 2:138603630-138603652 TCACAGGGTTGAAGGGCAAGGGG + Intergenic
939224381 2:139346574-139346596 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
939914383 2:148021218-148021240 TCAGGGGGGTGGGGGGAAGGCGG + Intronic
939941259 2:148354257-148354279 GGTGGGGGGTGGAGGGCAAGGGG - Intronic
940048364 2:149434629-149434651 GAAAGGGAGTGGAGGGCAAGAGG + Intronic
940811521 2:158248064-158248086 TTCAGGGGGTGGGGGACAAGGGG - Intronic
940950467 2:159666924-159666946 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
941038169 2:160590470-160590492 TGAAGGGGGAGGAGGGGAGGGGG - Intergenic
941072987 2:160975715-160975737 TCGGGGGGGTGGGGGGCTAGGGG - Intergenic
942052450 2:172152748-172152770 GTACGGGGGTGGGGGGCAAGGGG + Intergenic
942251776 2:174053572-174053594 TCAGTGTGGTGGAGGGAAAGGGG + Intergenic
942277886 2:174336058-174336080 GCAAGAAGGAGGAGGGCAAGAGG - Intronic
943047905 2:182880463-182880485 TGAGCGGGGTGGAGGGCTAGGGG + Intergenic
943087298 2:183328128-183328150 TGAAGGTGGTGGCGGGTAAGAGG - Intergenic
943283832 2:185972017-185972039 TCATGGGCCTGGAGGGCATGGGG + Intergenic
943322520 2:186463103-186463125 ATAAGGGTGTGGAGGGCAGGGGG - Intergenic
943344914 2:186727062-186727084 TGAAGGGGGTGGGGGGAGAGAGG - Intronic
944818199 2:203401268-203401290 TGAAGGTGGAGGAGGGCAAGAGG - Intronic
944940663 2:204622006-204622028 TCAAGGGGGTGAGGGGCAGAGGG + Intronic
945385029 2:209187158-209187180 TAGAGGGGGTGGGGGGCTAGGGG + Intergenic
945780480 2:214165622-214165644 TCAAGGGGGTGGGGGGCAGTGGG - Intronic
946122895 2:217531968-217531990 TGAAGGGGGTGGGGAGCAGGAGG - Intronic
946212758 2:218160852-218160874 GCCAGGGGATGGAGGGCAAGGGG + Intergenic
946697503 2:222374507-222374529 TTTCGGGGGTGGAGGGCTAGGGG - Intergenic
947302959 2:228708984-228709006 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
947439235 2:230103707-230103729 GTCAGGGGGTGGAGGGTAAGGGG - Intergenic
947581008 2:231318554-231318576 TGAACGTGGTAGAGGGCAAGTGG - Intronic
948053313 2:234994141-234994163 AGAAGGGTGTGGAGGGGAAGAGG - Intronic
948611195 2:239168095-239168117 GCAAGGGGGTGGAGAGAAAAAGG - Intronic
1168842198 20:916766-916788 GGATGGGGGTGGAGGGAAAGAGG - Intergenic
1168863056 20:1059946-1059968 TGAATGGGGTGGAGGGACAGAGG - Intergenic
1169066305 20:2695990-2696012 GGAAGCGGGTGGAGGGCCAGGGG - Intronic
1170671247 20:18435590-18435612 TGTCGGGGGTGGGGGGCAAGAGG + Intronic
1170691712 20:18622228-18622250 TTCAGGGGGTCGGGGGCAAGGGG - Intronic
1170909016 20:20544866-20544888 GTCAGGGGGTGGGGGGCAAGGGG + Intronic
1170963319 20:21044467-21044489 GCAAGGGTGGTGAGGGCAAGGGG + Intergenic
1171242522 20:23583149-23583171 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1172511317 20:35503096-35503118 TCAAGGAGCTGGAGGGCCAGAGG + Exonic
1172601822 20:36189319-36189341 GCAAGGGTGTGGATGGGAAGGGG - Intronic
1172656731 20:36542317-36542339 TCCAGGGGCTGGAGGTCATGGGG + Intronic
1173032991 20:39379428-39379450 TAAAGGGGCTGCAGGACAAGAGG + Intergenic
1173296275 20:41761433-41761455 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1173574542 20:44103648-44103670 TCAAGGTGGTAGAAGGTAAGTGG - Intergenic
1173619792 20:44428352-44428374 TGCAGGGGGTGGTGGGCATGGGG - Exonic
1174670205 20:52299976-52299998 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1174744285 20:53046132-53046154 TCAAGGGGGCTGCAGGCAAGAGG + Intronic
1175309622 20:58002693-58002715 TCAGGGGGGTGGGGGGCTGGGGG + Intergenic
1175734564 20:61376350-61376372 CCCAGGGGAAGGAGGGCAAGAGG + Intronic
1176127089 20:63480464-63480486 TCCAGTGGGTGGAGGCCAGGGGG + Intergenic
1176241129 20:64076475-64076497 GCGAGGGGGTCGAGGGCATGGGG - Intronic
1176691476 21:9916307-9916329 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
1176968030 21:15233600-15233622 TCATGGGGGTGGAGGGGAGGGGG + Intergenic
1177313751 21:19430146-19430168 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1177593781 21:23208893-23208915 GTCAGGGGGTGGAGGGCTAGGGG + Intergenic
1177714238 21:24818099-24818121 TCGTGGGGGTGGGGGGCTAGGGG + Intergenic
1178067925 21:28926724-28926746 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
1179371193 21:40807463-40807485 GGATGGGGGTGGAGGGCGAGGGG + Intronic
1179380026 21:40889804-40889826 TCAGAGGGGTAGAGGGTAAGAGG - Intergenic
1179532256 21:42027939-42027961 TCAAGGAGGCGGAGGACAGGAGG - Intergenic
1179793851 21:43771030-43771052 TCAGGGGTCTGGAGGGGAAGTGG + Intergenic
1179889410 21:44328038-44328060 TCAAGGTGCCCGAGGGCAAGAGG - Intergenic
1180056065 21:45359821-45359843 CCAGGGGTGTGGATGGCAAGAGG - Intergenic
1180586057 22:16892349-16892371 TCAAGGGGGTGGGAGGCTGGGGG - Intergenic
1180951269 22:19721671-19721693 ACACGGTGGTGGAGGCCAAGGGG + Exonic
1181013158 22:20053995-20054017 TGGAGGGGGAGGAGGGCAGGAGG - Intronic
1181177230 22:21044766-21044788 TTTAGGGGCTGGAGGGGAAGGGG - Intergenic
1181618012 22:24068205-24068227 AGAAGGGGGTGGAGGGAAGGAGG + Intronic
1182049960 22:27305099-27305121 TCAGGGGGGTGGAAGGAAAATGG - Intergenic
1182877290 22:33703188-33703210 TCAGAGGGGTGGAGGAAAAGCGG + Intronic
1183591085 22:38779635-38779657 TCAAGGGGGCGCAGGGCAGGTGG + Intronic
1183698288 22:39435660-39435682 TCAGGGTGGTGGTGGGGAAGGGG - Intronic
1183730426 22:39615410-39615432 GCAAGGGGCAGGAGGGCAATTGG + Intronic
1183746132 22:39693002-39693024 TCAAGGGGGTGGGGTCCAAGGGG + Intergenic
1183806216 22:40213417-40213439 TGAAGGGGCTGGAGAACAAGTGG + Intronic
1184436228 22:44479099-44479121 GGAAGGGTGTGGTGGGCAAGAGG - Intergenic
1184608064 22:45585724-45585746 TCCAGGAGGTGGAGGGCATGGGG + Intronic
1185110216 22:48896432-48896454 GGCAGGGGGTGGAGGGCATGTGG + Intergenic
1185110235 22:48896475-48896497 GTGATGGGGTGGAGGGCAAGGGG + Intergenic
1185415270 22:50705979-50706001 TCCAGGCGGTGGAGCGCAAGTGG + Intergenic
949119397 3:367785-367807 TTTGGGGTGTGGAGGGCAAGGGG - Intronic
949145133 3:690871-690893 TGGAGGGGCTGGTGGGCAAGAGG - Intergenic
949162487 3:896857-896879 TTTAGGGGGTGGGGGGCAATTGG - Intergenic
949697752 3:6719094-6719116 ATCAGGGGGTGGGGGGCAAGGGG - Intergenic
949791385 3:7796363-7796385 TCAAGGAGGTGGTGGGGATGTGG - Intergenic
950863860 3:16173729-16173751 GCAAGGGGGCGGGGGGCAGGAGG - Intergenic
951765169 3:26189865-26189887 TTCAGGGGGTGGGGGGCAAGGGG - Intergenic
951911401 3:27754232-27754254 TGTAGGGGGTGGGGGGCTAGGGG - Intergenic
951939868 3:28065742-28065764 TCTCGGGGGTGGGGGGCTAGGGG + Intergenic
952015590 3:28952875-28952897 TCAAGGAGGAAGAAGGCAAGAGG + Intergenic
952861460 3:37816141-37816163 TAAAGGGTGTGGAGGGTATGTGG + Intronic
952889428 3:38030463-38030485 CCAAAGGGGTGGTGGGCAACAGG - Intergenic
952944469 3:38468371-38468393 TCAAGGGGGTTGAGAACTAGGGG + Intronic
953548347 3:43881430-43881452 ACAAGGAGTTGGAGGGAAAGAGG + Intergenic
953881907 3:46695065-46695087 GCCTGGGGGTGGAGGGCATGGGG - Intergenic
954227477 3:49191594-49191616 TCAAGATGGTGGAGAGGAAGTGG + Intronic
954260251 3:49433508-49433530 TGAAGGGGCTGGAGTGAAAGTGG - Intergenic
954994289 3:54867271-54867293 TCATGGGGGTGAGGGGCGAGGGG + Intronic
955515129 3:59718898-59718920 TCAAGGGATTGGAGAGCAGGAGG - Intergenic
955586680 3:60485647-60485669 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
956220755 3:66900125-66900147 TTCAGGGGGTAGGGGGCAAGAGG + Intergenic
956318077 3:67961825-67961847 GTCAGGGGGTGGAGAGCAAGGGG + Intergenic
956453300 3:69395011-69395033 TGTCGGGGGTGGAGGGCAAGGGG + Intronic
956633189 3:71336421-71336443 ATCGGGGGGTGGAGGGCAAGGGG - Intronic
956949231 3:74261210-74261232 TAATGGGGGGGGGGGGCAAGTGG - Intergenic
957376941 3:79370831-79370853 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
957689867 3:83553798-83553820 TCAAGGAGTTGAAGTGCAAGTGG - Intergenic
957844583 3:85715650-85715672 GTCAGCGGGTGGAGGGCAAGGGG - Intronic
958677407 3:97283602-97283624 TCAGGGGGGTGAGGGGCAAGGGG + Intronic
958775486 3:98478122-98478144 TCAGGGGGTTGGGGGGCTAGGGG - Intergenic
958993899 3:100879167-100879189 ACCAGGGGGTGAGGGGCAAGGGG - Intronic
959176518 3:102919771-102919793 TGTCGGGGGTGGGGGGCAAGGGG - Intergenic
959291790 3:104484641-104484663 TAATGGGGGTGGCTGGCAAGAGG + Intergenic
960125769 3:113996867-113996889 GCTGGGGGGTGGGGGGCAAGGGG + Intronic
960278736 3:115756855-115756877 GTCAGGGGGTGGAGGGCTAGGGG + Intergenic
960436080 3:117628344-117628366 TCAGGGGGGTTGGGGGCAAAAGG + Intergenic
960515249 3:118595927-118595949 ACAAGGGGCTGGATGTCAAGAGG - Intergenic
961662554 3:128477379-128477401 TGTAGGGGGTGGAGGCCAGGGGG + Intergenic
962292038 3:134145410-134145432 TCAGGGGAGTGGAGGGCAGGGGG + Intronic
962302975 3:134259602-134259624 TCCAGAGGGCAGAGGGCAAGGGG - Intergenic
962526686 3:136243652-136243674 ACAAGGGAGAGGAGGGCATGTGG + Intergenic
962611545 3:137081370-137081392 ACAAGATGGTGAAGGGCAAGTGG - Intergenic
963035933 3:141028910-141028932 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
963768852 3:149368058-149368080 TTAGGGGGCTGGGGGGCAAGGGG + Intergenic
963916375 3:150862256-150862278 TCATGGGGTGGGAGGGCAGGAGG + Intergenic
964377428 3:156063058-156063080 TGTCGGGGGTGGAGGGCAAGGGG - Intronic
964831805 3:160891992-160892014 GTCAGGGGGTGGAGGGCTAGGGG + Intronic
964844904 3:161034689-161034711 TCGGGGGGGTGGAGGACTAGGGG + Intronic
964844956 3:161035080-161035102 GTCAGGGGGTGGGGGGCAAGGGG + Intronic
964905377 3:161713029-161713051 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
965320451 3:167247224-167247246 ACAAGTGGTTGGACGGCAAGAGG + Intronic
965790419 3:172381615-172381637 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
965858561 3:173119152-173119174 TCGAGGGGGTGTGGGGAAAGGGG + Intronic
966311678 3:178601191-178601213 TCAGGGGGTTGGGGGGGAAGGGG + Intronic
966374835 3:179285782-179285804 TGCGGGGAGTGGAGGGCAAGTGG - Intergenic
967707269 3:192665601-192665623 TTTTGGGGGTGGGGGGCAAGGGG + Intronic
967857093 3:194126450-194126472 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
968133786 3:196207825-196207847 TCAAGGGGGTGGGCGGGATGAGG - Intronic
968734056 4:2286068-2286090 TCTAGGGGGTGCAGGGACAGTGG + Intronic
969488159 4:7483743-7483765 TCCAGGGGGTGGGGGGCCAGGGG + Intronic
970174665 4:13327105-13327127 TCAAGAGGGTTGGGGGCAAGGGG + Intergenic
970284618 4:14496179-14496201 TCAAGGGAGTGGAGGGGAGGTGG + Intergenic
970614111 4:17751776-17751798 CCAAGGGGCTGGAGGTCAAGAGG + Intronic
971023536 4:22564567-22564589 TTGAGGGGGTGGAGGGTGAGGGG + Intergenic
972028757 4:34424111-34424133 TTAGGAGGGTGGAGAGCAAGGGG + Intergenic
972442570 4:39109651-39109673 TGGAGGGGGTGGTGGGGAAGTGG + Intronic
972630352 4:40836656-40836678 GAAAGGGGGTTGAGGGAAAGGGG + Intronic
972760845 4:42102412-42102434 TCGGGGGGGTGGGGGGCAAGGGG + Intergenic
972887711 4:43512860-43512882 GTCAGGGGTTGGAGGGCAAGGGG - Intergenic
972985263 4:44755656-44755678 TCAAAGGGGTGGAGGGCTATTGG - Intergenic
973922308 4:55700356-55700378 CCAAGGGGGTGGGGGGCAAGGGG + Intergenic
974168337 4:58232712-58232734 TCAAAGAGGAGAAGGGCAAGTGG + Intergenic
974366485 4:60956133-60956155 TCAGGGTGGTGCTGGGCAAGTGG + Intergenic
974851165 4:67406511-67406533 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
974855423 4:67455130-67455152 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
975098875 4:70489423-70489445 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
975309756 4:72890555-72890577 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
975619803 4:76285008-76285030 GCCAGAGGGTGGAGGGCAAGGGG - Intronic
975999105 4:80350778-80350800 TGTTGGGGGTGGAGGGAAAGGGG + Intronic
976310347 4:83605607-83605629 ACAAAGGGGTGGAGGGTGAGGGG - Exonic
976330797 4:83829028-83829050 TCCAGGAGGTGGAGACCAAGGGG + Intergenic
976822958 4:89227582-89227604 TCAAGCTGGTGGAGGGGAAAAGG - Intergenic
977290314 4:95158956-95158978 TCAAGGGGCTGATGGGCCAGAGG + Intergenic
977426100 4:96868851-96868873 GTCAGGGGGTAGAGGGCAAGGGG + Intergenic
977888431 4:102278992-102279014 TTAGTGGGGTGGGGGGCAAGGGG + Intronic
978051423 4:104204852-104204874 TCTTGGGGGTAGGGGGCAAGGGG + Intergenic
978452729 4:108853661-108853683 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
978494620 4:109345958-109345980 TTTCGGGGGTGGAGGGCAGGGGG + Intergenic
978522870 4:109634946-109634968 TCAGGGGGTTGGGGGGCTAGGGG - Intronic
979104002 4:116661205-116661227 TTCAGGGGGTGGAAGGCAATGGG + Intergenic
979795362 4:124839652-124839674 GGAAGGGGGTGGAGGGAGAGAGG - Intergenic
979834366 4:125344811-125344833 TCATGGTGGTGGGGGGCAGGGGG - Intronic
980364057 4:131776501-131776523 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
980380374 4:132006058-132006080 TCTTGGGGGTGGGGGGCAAGGGG + Intergenic
980497768 4:133607182-133607204 CCAAGGTGGTAGAGGTCAAGTGG - Intergenic
980519715 4:133916162-133916184 GTCAGGGGGTGGAGGGTAAGGGG - Intergenic
980549945 4:134321526-134321548 TCAAGGGGTTGGGGGACTAGGGG + Intergenic
981432584 4:144678536-144678558 TCAGGGGGATGGGGGGCTAGGGG - Intronic
981973065 4:150689305-150689327 GTATGGGGATGGAGGGCAAGGGG + Intronic
982047927 4:151467825-151467847 GTCAGGGGGTGGAGGGCAAGGGG + Intronic
982116840 4:152105127-152105149 GCAAGAGGGTGGAGGCCAAAGGG + Intergenic
982360751 4:154516304-154516326 CCAAGGGGGTGGGAGGGAAGAGG + Intergenic
982507106 4:156233325-156233347 GCCAGGGGGTGGGGGGCTAGGGG - Intergenic
982562706 4:156949801-156949823 TCAAGGGGACGTAGGGGAAGGGG - Intronic
982880909 4:160714042-160714064 TCTCGGGGGTGGGGGGCTAGGGG + Intergenic
982976287 4:162066577-162066599 TCAGGGGGTGGGGGGGCAAGGGG - Intronic
983079769 4:163370818-163370840 TTGAGGGGGTGGGGGGCTAGAGG + Intergenic
983117936 4:163843007-163843029 TGAAGAGGGAGGAGGGCAGGGGG - Intronic
983160305 4:164405280-164405302 TCGTGGGGGTGCAGGGCTAGGGG + Intergenic
983161089 4:164415590-164415612 TGTCGGGGGTTGAGGGCAAGGGG - Intergenic
983234816 4:165167245-165167267 TAGAGGGGGTGGAGGGCTGGGGG + Intronic
983611802 4:169654282-169654304 TTAAGATGGGGGAGGGCAAGGGG - Intronic
983743445 4:171164830-171164852 TTGTGGGGGTGGTGGGCAAGCGG + Intergenic
983851419 4:172585401-172585423 GTCAGGAGGTGGAGGGCAAGGGG - Intronic
983948298 4:173610551-173610573 GTCAGGGGGTGGGGGGCAAGAGG - Intergenic
984187241 4:176560970-176560992 TCAGGGGGGTGGGGGACAAGGGG - Intergenic
984619213 4:181933010-181933032 CCCAGGGGGTTGGGGGCAAGGGG + Intergenic
984875870 4:184366958-184366980 TCAAGATAGGGGAGGGCAAGCGG + Intergenic
985044550 4:185927432-185927454 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
985879679 5:2628765-2628787 TGCAGGGCGTGGAGTGCAAGGGG - Intergenic
985902465 5:2807239-2807261 TTCAGGGGGTGGAGGGATAGGGG - Intergenic
985924497 5:3005165-3005187 GCAATGGGGAGGAGGCCAAGAGG + Intergenic
986071457 5:4288614-4288636 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
986251065 5:6059007-6059029 TGAAGTGAGTGAAGGGCAAGTGG - Intergenic
986402563 5:7395347-7395369 TCAAGAGGGTGGAGAGGATGGGG + Intergenic
986467884 5:8045179-8045201 GTCAGAGGGTGGAGGGCAAGGGG + Intergenic
986582230 5:9277805-9277827 TCAGGGGGGTGCGGGGCTAGGGG + Intronic
986614382 5:9601624-9601646 TCAGGGCGGTAGAGGACAAGAGG - Intergenic
986939047 5:12927334-12927356 TTGAGGGGGTGGGGGGCTAGGGG + Intergenic
987068509 5:14313309-14313331 TCATGGCGGTGGAGGGGTAGTGG - Intronic
987830717 5:23091067-23091089 GTCAGGGGGTGGAGGGCTAGGGG + Intergenic
988340850 5:29969152-29969174 ACAGGAGGGTGGAGGGCAGGAGG + Intergenic
988490162 5:31699259-31699281 TCAAGAAGGTGGTGGGCGAGGGG + Intronic
988918357 5:35918458-35918480 TTCAGGGGGTGGAGGGCTAGGGG + Intronic
989269110 5:39511002-39511024 TGACGGGGGTGGAGGACCAGGGG + Intergenic
989347658 5:40448078-40448100 TTGGGGGGGTGCAGGGCAAGGGG - Intergenic
989697695 5:44222816-44222838 TGTCGGGGGTGGGGGGCAAGGGG + Intergenic
989819322 5:45776243-45776265 TCCAGAAGGTGGAGGGGAAGAGG - Intergenic
990062808 5:51672998-51673020 TGTCGGGGGTGGGGGGCAAGGGG - Intergenic
990882345 5:60553989-60554011 TCAACGGGGGGGTGGGCAGGAGG - Intergenic
991182389 5:63767610-63767632 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
991440349 5:66640861-66640883 TCAAGAGGGTGTAGGGAAAAGGG - Intronic
991927493 5:71719462-71719484 TCAAGGGGGTCGAGAGCGAGGGG - Intronic
992073994 5:73174302-73174324 TCAAGGGGGGAAAGGGGAAGTGG + Exonic
992163146 5:74021966-74021988 TCAGTGGGGTGGGGGGCTAGGGG - Intergenic
992329599 5:75702158-75702180 GTCAGGGGGTGGAGGGTAAGGGG + Intronic
992369272 5:76126335-76126357 TTACAGGGTTGGAGGGCAAGAGG + Intronic
992607340 5:78472383-78472405 ACTTGGGGGTGGGGGGCAAGGGG - Intronic
993467288 5:88264929-88264951 GTCAGGGGGTGGGGGGCAAGGGG + Intronic
993895521 5:93528893-93528915 TCTCGGGGGTGGGGGGCTAGGGG + Intergenic
994152198 5:96460375-96460397 TCAGGTGGTTGGAGGGCAAAAGG + Intergenic
994844069 5:104963051-104963073 TCAAGGTGGGAGAGGGCAAAAGG - Intergenic
995790070 5:115877346-115877368 GTCAGGGGGTGGAGGGCTAGGGG - Intronic
996265954 5:121540522-121540544 ACTTGTGGGTGGAGGGCAAGAGG + Intergenic
996329244 5:122311665-122311687 GGAAGGGGGTGGGGGGCAGGAGG + Intronic
996363368 5:122675039-122675061 GCCAGGGGCTGGAGGGAAAGGGG - Intergenic
996474722 5:123903821-123903843 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
996810111 5:127506958-127506980 GCAGGAGGGTGGAGGGGAAGTGG + Intergenic
997258601 5:132448143-132448165 TCAAGAGGGTGGATGTCAATAGG - Intronic
998222950 5:140302861-140302883 TAAACGGGGTGGGGGGCGAGCGG - Intronic
998535339 5:142925212-142925234 TCATGGGGGAGGTGGGCAACAGG - Intronic
998659604 5:144221412-144221434 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
999195031 5:149776031-149776053 AGAAGGAGGTGGAGGGGAAGAGG - Intronic
999321773 5:150619667-150619689 TCCCGGGGGTGCAGGGCATGCGG + Intronic
999514858 5:152290882-152290904 TGGTGGGGGTGGGGGGCAAGAGG - Intergenic
999597453 5:153220861-153220883 TCAGGGGGTTGGCGGGCAAGGGG + Intergenic
999797031 5:154998386-154998408 TCAGGGGGTTGGGGGGCTAGGGG - Intergenic
1000194434 5:158944213-158944235 GTAGGGGGGTGGAGGACAAGGGG - Intronic
1000540141 5:162529660-162529682 TGAAGGGGGTAGAAAGCAAGTGG - Intergenic
1000593073 5:163182135-163182157 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1000786381 5:165549599-165549621 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1002663986 5:180809870-180809892 TGGAGGGGGTGGAGGTCATGTGG - Intronic
1002849955 6:985193-985215 TGTAGGGGGTTGAGGGCAAGGGG - Intergenic
1003458449 6:6306702-6306724 GCAGGGAGGGGGAGGGCAAGAGG - Intronic
1003693690 6:8380203-8380225 TAAAAGGGGTGGAGGGTGAGGGG + Intergenic
1003832144 6:10023180-10023202 TCAAGGGCGTGGTGGGAAGGAGG - Intronic
1004094419 6:12538625-12538647 TTAAGGGTATGGAGGGCAAAGGG + Intergenic
1004127395 6:12887030-12887052 AGGAGGGGGTGGAGGACAAGGGG - Intronic
1004234776 6:13864839-13864861 GTCAGGGGGTGGAGGGCAAGGGG - Intergenic
1004799008 6:19124730-19124752 TGTTGGGGGTGGTGGGCAAGGGG + Intergenic
1004829488 6:19462151-19462173 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
1005193205 6:23252194-23252216 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1005223401 6:23614187-23614209 ACAAGGGGGTGGGGGGCAAGGGG + Intergenic
1005338594 6:24821776-24821798 TGGAGGGGGTTGATGGCAAGTGG - Intronic
1005772792 6:29092825-29092847 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1005785295 6:29239125-29239147 TTTAGGGGGTGGGGGGCCAGGGG - Intergenic
1006155237 6:32010031-32010053 TGTAGGAGGTGGAGGGAAAGAGG + Intergenic
1006161543 6:32042765-32042787 TGTAGGAGGTGGAGGGAAAGAGG + Exonic
1006215054 6:32434338-32434360 TTGGGGGGGTGGGGGGCAAGGGG + Intergenic
1006338156 6:33431693-33431715 TCCAGGAGGTGGGGGGCAGGTGG + Intronic
1006518384 6:34557025-34557047 TCAAGGAGGTGGAGGGTCTGGGG - Intergenic
1006882074 6:37349093-37349115 TGAAGGGGGTTGAGGGAAATGGG + Intergenic
1007239732 6:40416402-40416424 CCAAGGGGGTGGCGGGAATGAGG + Intronic
1007247368 6:40472192-40472214 TGAAGGGGCTGGAGGGAAGGTGG - Intronic
1007692962 6:43714751-43714773 TCCATGGGGTGGAGGGGAGGTGG - Intergenic
1007994584 6:46292867-46292889 TCGTGGGGGTGGAGGGCTAGGGG - Intronic
1008207915 6:48685926-48685948 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
1008496573 6:52140029-52140051 TCAGGGGAGGGGAGGGTAAGGGG - Intergenic
1008541207 6:52547737-52547759 CCAAAGGGGTGGAGGGCCACGGG + Intronic
1008662665 6:53684359-53684381 TCAAGGTGGTGGAGGAAAGGAGG - Intergenic
1009669358 6:66726690-66726712 CCAAGGGGGTGAAGGGGTAGGGG + Intergenic
1009717725 6:67422590-67422612 TGTTGGGGTTGGAGGGCAAGGGG - Intergenic
1009805288 6:68594780-68594802 GTAAGGGGGTGGAGGGCTGGGGG - Intergenic
1009838091 6:69030612-69030634 TCAGGGGAGTGGGGGGCTAGGGG + Intronic
1010096629 6:72054071-72054093 TTTGGGGGGTGGTGGGCAAGGGG - Intronic
1010616728 6:78021776-78021798 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1010679904 6:78786757-78786779 TCAGGGGGCTGGGGGGAAAGGGG - Intergenic
1011066189 6:83328312-83328334 GTCAGGGGGTGGAAGGCAAGGGG + Intronic
1011080513 6:83485749-83485771 TCAGGGGGCTGGGGGGCAATGGG + Intergenic
1011607421 6:89118233-89118255 TCAGGAGGGCGGAGGCCAAGAGG + Intergenic
1011633156 6:89346637-89346659 TGTAGGGGGTGGGGGGCAGGGGG - Intronic
1011736653 6:90317316-90317338 GTCAGGGGGTGGAGGGCTAGAGG - Intergenic
1013431975 6:110063607-110063629 GAATGGGGGTGGAGGGCAAGGGG - Intergenic
1014561082 6:122891589-122891611 TCAGGGGGCTGAGGGGCAAGGGG - Intergenic
1014729575 6:125016780-125016802 GTGAGGGGGTGGGGGGCAAGGGG + Intronic
1015113734 6:129622170-129622192 TCAATGAGGTGGAGGGCCATTGG + Intronic
1015798005 6:137032312-137032334 TCAGGCGGGTGGAGGGCACAAGG + Intronic
1015983296 6:138860872-138860894 TCAGGGGGTTGGCGGGAAAGGGG - Intronic
1017103789 6:150869321-150869343 TCAGGGGGTGGGAGGGCAAGAGG - Intronic
1017235868 6:152117174-152117196 ACAAGGAGGTGTGGGGCAAGGGG + Intronic
1017369383 6:153687553-153687575 TGTAGGGGGTGGGGGGCTAGGGG - Intergenic
1017592302 6:155990720-155990742 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1018093958 6:160368386-160368408 TCAAGGGTGTGGTAGGCAGGTGG - Intronic
1018381430 6:163261407-163261429 CTCAGGGGGTGGGGGGCAAGGGG - Intronic
1018501747 6:164418850-164418872 TGTTGGGGGTGGAGGGTAAGGGG - Intergenic
1019341745 7:511775-511797 TCAGGGGGCTGGAGGGCCATGGG + Intronic
1021048728 7:15955987-15956009 TCATGGGGTTGGGGGGAAAGGGG - Intergenic
1021535589 7:21700954-21700976 TGTTGGGGGTGGAGGGCTAGGGG + Intronic
1022139409 7:27480232-27480254 GTTAGGGGGTGGGGGGCAAGGGG + Intergenic
1022441545 7:30437219-30437241 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1022910710 7:34897675-34897697 TCAAGGGAGCAGAAGGCAAGTGG + Intergenic
1022936807 7:35186491-35186513 TGAAGCGCGTGAAGGGCAAGCGG - Intergenic
1023224488 7:37954588-37954610 GCCAGGGGGTGGGGGGCTAGGGG + Intronic
1023289152 7:38651208-38651230 TCATGGGGGTGGGGGGCTAGGGG + Intergenic
1023925541 7:44666776-44666798 TGAAAGTGGTGGTGGGCAAGTGG - Exonic
1024660272 7:51486508-51486530 ACTGGGGGGTGGGGGGCAAGAGG - Intergenic
1026107362 7:67431802-67431824 TTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1026806121 7:73430443-73430465 TGGAGGGGGAGGAGGGGAAGGGG - Intergenic
1026869572 7:73842203-73842225 TGAAGGGGGAGGAGGGAAGGGGG - Intronic
1027693640 7:81380659-81380681 TCTAGGGGCTGAAAGGCAAGAGG - Intergenic
1027864031 7:83623870-83623892 TGTTGGGGGTGGGGGGCAAGGGG - Intronic
1028057681 7:86267612-86267634 ACAGGGGGTTGGGGGGCAAGAGG + Intergenic
1028373311 7:90119096-90119118 TGAAGCGCGTGAAGGGCAAGCGG + Intergenic
1028689433 7:93635193-93635215 GTCAGTGGGTGGAGGGCAAGGGG - Intronic
1028822928 7:95233365-95233387 GTCAGGGGGTGGGGGGCAAGGGG + Intronic
1028888041 7:95956528-95956550 TGTCGGGGGTGGGGGGCAAGAGG - Intronic
1028984364 7:96998233-96998255 AGAAGGGGGTGGGGGGCACGTGG + Intergenic
1028998010 7:97123140-97123162 TTCAGGGGGTGGGGGGAAAGAGG - Intronic
1029537126 7:101163404-101163426 TCGAGGAGGTGGAGGAGAAGCGG - Exonic
1029833040 7:103280591-103280613 TGAAGCGCGTGAAGGGCAAGCGG - Intergenic
1029871093 7:103693341-103693363 TCGGGGGGTTGGGGGGCAAGGGG + Intronic
1029913219 7:104177719-104177741 TTTGCGGGGTGGAGGGCAAGGGG - Intronic
1030971642 7:116064542-116064564 TCAAGGGGGTGGAGGGCAAGGGG + Intronic
1030973497 7:116090961-116090983 TGTCGGGGGTGGGGGGCAAGGGG + Intronic
1030998932 7:116392218-116392240 TGTCGGGGGTGGCGGGCAAGGGG + Intronic
1031211141 7:118827773-118827795 GTCAGGGGGTGGGGGGCAAGAGG + Intergenic
1031239941 7:119224619-119224641 ACAAGGGTGTGAAGGCCAAGTGG + Intergenic
1031712087 7:125061302-125061324 CCAGGGAGGTGGAGGGCAAGGGG - Intergenic
1031900227 7:127401255-127401277 GTCAGGGAGTGGAGGGCAAGGGG - Intronic
1031911563 7:127522082-127522104 TCAGAGGGGTGGGGGGCTAGGGG + Intergenic
1032255074 7:130290592-130290614 GCCAGGGGCTGAAGGGCAAGAGG - Intergenic
1032687045 7:134245032-134245054 TCACAGGGGTGGGGGGCAGGGGG + Intronic
1033245547 7:139714074-139714096 ACGAGGGAGTGGAGAGCAAGTGG + Intronic
1033395943 7:140973819-140973841 ACAAGGGAGTGAAGGGCAGGTGG - Intergenic
1034097292 7:148421638-148421660 TCCAGGGTGTGGGGGGCATGGGG - Intergenic
1034170067 7:149056046-149056068 TCAAGGGGTTGAAGTGGAAGTGG + Intergenic
1034373094 7:150617696-150617718 GTAAGGGGGTGCAGGGCAAGGGG - Intergenic
1035413984 7:158667938-158667960 GTAAGAGGGTGGAGGGCCAGAGG - Intronic
1035414053 7:158668140-158668162 GTAAGAGGGTGGAGGGCCAGAGG - Intronic
1036938275 8:13026396-13026418 CCCCGGGGGTAGAGGGCAAGAGG - Exonic
1037739782 8:21599029-21599051 TCAGGGGGTTGGGGGGCAAGGGG + Intergenic
1037842075 8:22251933-22251955 GGATGGGGGTGGAGGGGAAGCGG - Exonic
1037911704 8:22747600-22747622 TCAGGGGGGTGGGGGGCTTGAGG + Intronic
1037990044 8:23315235-23315257 ACATGGGGGTGGTGGGGAAGAGG + Intronic
1038024312 8:23575498-23575520 AGAAGGGAGTGGATGGCAAGAGG + Intergenic
1038491843 8:27977173-27977195 TCATGGGGGTGGAGCCCACGTGG - Intronic
1038951353 8:32417718-32417740 ACACGGGGGTGGAGGGGGAGGGG + Intronic
1039267690 8:35843640-35843662 TTTAGGGGATGGGGGGCAAGGGG - Intergenic
1039407268 8:37324084-37324106 GCATGGGTGTGGAGGCCAAGAGG + Intergenic
1039456823 8:37712708-37712730 ACAGGTGGGTGGAGGGCAAGTGG + Intergenic
1040719197 8:50296608-50296630 TCAGGAGGATGGAGGGCAAGGGG + Intronic
1041418563 8:57641811-57641833 GTTAGGGGGTGGGGGGCAAGCGG - Intergenic
1041666824 8:60453694-60453716 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1042065772 8:64874154-64874176 TTCTGGGGGTGGGGGGCAAGGGG + Intergenic
1042210989 8:66380288-66380310 TCATGGCGGTGGAGGGGTAGAGG - Intergenic
1042524097 8:69746632-69746654 TCAAGGGGGAGGATGAAAAGTGG + Intronic
1042729024 8:71910780-71910802 AAAAGTGGGAGGAGGGCAAGTGG - Intronic
1043032321 8:75152000-75152022 TTCAGGGGGTGGGGGGCTAGGGG + Intergenic
1043368589 8:79564210-79564232 GTGAGGGGGTGGGGGGCAAGGGG + Intergenic
1043386090 8:79749048-79749070 GCAAGGGGGTGGGGGTGAAGTGG - Intergenic
1043870725 8:85428861-85428883 CACAGGGGGTGGGGGGCAAGGGG - Intronic
1044212087 8:89561990-89562012 GTAAGGGGGTAGAGGGTAAGGGG - Intergenic
1044714476 8:95088074-95088096 TCATGGGGGTGGCGAGCAGGTGG - Intronic
1045381802 8:101634778-101634800 TCAGTGGGGTGGGGGGCAGGTGG - Intronic
1045567300 8:103333418-103333440 TCAAAGGGCTGGAAGACAAGGGG + Intergenic
1045717618 8:105067064-105067086 ACAAGTGGGTGGACGTCAAGAGG - Intronic
1046036457 8:108847879-108847901 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1046437581 8:114212228-114212250 GAATGGGGGTGGAGGGAAAGAGG + Intergenic
1046750491 8:117921566-117921588 TGAAGGGGGCAGAGGGAAAGGGG + Intronic
1047309013 8:123676699-123676721 CCAAAGGGCTGGAGGGCAACTGG - Intergenic
1047374691 8:124284877-124284899 ATCAGGGGGTGGGGGGCAAGGGG - Intergenic
1047457140 8:125025336-125025358 TACAGTGGGTGGAGGGCAAGGGG + Intronic
1047547157 8:125829454-125829476 TTAGGGGGTTGGAGGGTAAGGGG - Intergenic
1048448962 8:134514954-134514976 TGTTGGGGGTGGAGGGCTAGGGG - Intronic
1048797667 8:138166323-138166345 TCAAGTGGGGAGTGGGCAAGAGG - Intronic
1048837567 8:138536013-138536035 TCCAGGAGGTGGTGTGCAAGAGG + Intergenic
1048979219 8:139694163-139694185 GAAAGGGGGTGGTGGGGAAGTGG + Intronic
1049417175 8:142500426-142500448 CCAAGGTGGAGGAGGGCATGGGG - Intronic
1050003939 9:1108315-1108337 TGCAGGGGGTGGGGGACAAGGGG - Intergenic
1050208539 9:3226678-3226700 TCAAAGGGTTGGAGGGCTACAGG + Intronic
1051112072 9:13650745-13650767 TCAAGGGGGTGGGAGGCAAGGGG - Intergenic
1051231026 9:14955707-14955729 TGCAGGGGGTGAAGGGCTAGGGG + Intergenic
1051875971 9:21793861-21793883 TCAAGGGGGTGGAGGATCAAGGG - Intergenic
1052596927 9:30573298-30573320 TGTCGGGGGTGGAGGACAAGTGG + Intergenic
1052801904 9:32976225-32976247 TCAGGGGGGTGGGGGGCTCGGGG + Intronic
1053033320 9:34801904-34801926 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
1053141129 9:35683281-35683303 GAAAGGGAGTGGAGGGAAAGAGG + Intronic
1053156225 9:35781427-35781449 AGGAGGGGGTGGAGGGGAAGGGG + Intergenic
1053482771 9:38428245-38428267 GCAGGGAGGTGGAGGCCAAGTGG + Intergenic
1053615959 9:39766101-39766123 TTACGGGGTTGGGGGGCAAGGGG - Intergenic
1053628407 9:39902386-39902408 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
1053694984 9:40629951-40629973 TCAGGGGGGTGGGAGGCTAGGGG - Intergenic
1053777652 9:41563941-41563963 TGTTGGGGGTGGAGGGCAAGGGG + Intergenic
1053874134 9:42525411-42525433 TTACGGGGTTGGGGGGCAAGGGG - Intergenic
1053898489 9:42769174-42769196 TTACGGGGTTGGGGGGCAAGGGG + Intergenic
1053941971 9:43260338-43260360 TCAGGGGGGTGGAAGGCTGGGGG - Intergenic
1054154245 9:61629090-61629112 GGAGGGGGGAGGAGGGCAAGGGG - Intergenic
1054215480 9:62348315-62348337 TGTTGGGGGTGGAGGGCAAGGGG + Intergenic
1054237558 9:62576289-62576311 TTACGGGGTTGGGGGGCAAGGGG + Intergenic
1054268200 9:62941343-62941365 TTACGGGGTTGGGGGGCAAGGGG + Intergenic
1054269857 9:63010159-63010181 TCAGGGGGGTGGGAGGCTAGGGG + Intergenic
1054306228 9:63429176-63429198 TCAGGGGGGTGGGAGGCTAGGGG - Intergenic
1054404970 9:64753172-64753194 TCAGGGGGGTGGGAGGCTAGGGG - Intergenic
1054438595 9:65238660-65238682 TCAGGGGGGTGGGAGGCTAGGGG - Intergenic
1054491809 9:65783286-65783308 TCAGGGGGGTGGGAGGCTAGGGG + Intergenic
1054551694 9:66610800-66610822 TTACGGGGTTGGGGGGCAAGGGG + Intergenic
1054672001 9:67807032-67807054 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
1054782864 9:69181975-69181997 CCATGGGGGTGGAGAGGAAGAGG - Intronic
1055177483 9:73337489-73337511 GTTGGGGGGTGGAGGGCAAGTGG + Intergenic
1055344583 9:75321852-75321874 TCAGAGGGTTGGGGGGCAAGGGG - Intergenic
1056081846 9:83103026-83103048 TGAAGGAGGAGGAGGGCCAGAGG - Intergenic
1058530741 9:105902577-105902599 TCGAGGTGGTAGAGGGCAACTGG + Intergenic
1058578772 9:106431991-106432013 GCGGGGGGGTGGGGGGCAAGAGG - Intergenic
1058819797 9:108719428-108719450 TTAGGGGGGTGGGGGGCTAGGGG + Intergenic
1059601704 9:115785623-115785645 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1059668458 9:116471598-116471620 TAAAGGGGGTGGAGGGAGGGGGG + Intronic
1059880593 9:118684696-118684718 TCATAGGGGTGGAGGGGAGGAGG - Intergenic
1060208482 9:121696561-121696583 TCATGGGGGTGGAGGGCCAAGGG - Intronic
1061287823 9:129634199-129634221 ACCTGGGGGAGGAGGGCAAGAGG + Exonic
1061829259 9:133280314-133280336 TGAAGCGGGTGGAGGGGCAGAGG + Intergenic
1203364282 Un_KI270442v1:243663-243685 AGAAGGCGGTGGGGGGCAAGAGG - Intergenic
1185669661 X:1797555-1797577 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1185911861 X:3988883-3988905 GTCAGGGGGTGGGGGGCAAGGGG - Intergenic
1185917671 X:4053890-4053912 GTCAGGGGGTGGAGGGCAAAGGG - Intergenic
1186333189 X:8558167-8558189 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1186402335 X:9271346-9271368 ACATGAGGGTGGAGGGCAGGAGG - Intergenic
1186618940 X:11216861-11216883 TGTCGGGGGTGGAGGGCTAGGGG - Intronic
1187258315 X:17661419-17661441 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1187575934 X:20555238-20555260 TTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1187699402 X:21950591-21950613 GTCAGGGGGTGGGGGGCAAGGGG - Intronic
1187886717 X:23895487-23895509 ATCAGGGGATGGAGGGCAAGGGG + Intronic
1189294306 X:39908105-39908127 TCAAGGGCCTGGAAGACAAGGGG + Intergenic
1189295791 X:39916648-39916670 TCCAGGGGGTGGCCTGCAAGTGG - Intergenic
1189359413 X:40338075-40338097 GTCGGGGGGTGGAGGGCAAGGGG + Intergenic
1189596597 X:42573139-42573161 TCAAGGGGTAGAAGGGGAAGTGG + Intergenic
1189742807 X:44138248-44138270 GCCAGGGGGCTGAGGGCAAGAGG + Intergenic
1189763261 X:44343785-44343807 TGAAGCGGGTGGAGGGGAACTGG - Intergenic
1190130012 X:47739233-47739255 ACAAGGGGGTGGGGTGCTAGGGG + Intergenic
1190510726 X:51171282-51171304 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1191182061 X:57574779-57574801 TGGAGGGGTTGGAGGGCACGAGG - Intergenic
1191730824 X:64333648-64333670 TCAAGGGGGTAGAAGAGAAGGGG - Intronic
1191949642 X:66574658-66574680 TCTGGGAGGTGGGGGGCAAGGGG - Intergenic
1192013947 X:67307846-67307868 TGAAGGGGGTGAGGGGCTAGGGG - Intergenic
1192185820 X:68946228-68946250 TGCATGGGGTGGAGGGAAAGAGG - Intergenic
1192478578 X:71465219-71465241 TCAAGTTGGGGGAGGGAAAGTGG + Exonic
1192637553 X:72833632-72833654 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1192644161 X:72887182-72887204 TGTTGGGGGTGGGGGGCAAGGGG - Intronic
1192662660 X:73058336-73058358 GTCAGGGGGTGGAGGGCTAGGGG + Intergenic
1192850283 X:74948717-74948739 GTTGGGGGGTGGAGGGCAAGAGG - Intergenic
1192906076 X:75551971-75551993 TCAAGGGAGTAGGGGGCTAGGGG + Intergenic
1193339599 X:80332502-80332524 GTCAGGGGGTGGGGGGCAAGAGG + Intergenic
1193339926 X:80335479-80335501 TTGGGGGGCTGGAGGGCAAGAGG + Intergenic
1193527952 X:82616996-82617018 GTGAGGGGGTGGAGGGCTAGGGG - Intergenic
1193660175 X:84247874-84247896 TCAAAGGGGTGGGGGGGAAGTGG + Intergenic
1194487385 X:94502261-94502283 TCAAGGGGTAGGGGGGAAAGTGG - Intergenic
1194849490 X:98853982-98854004 CCAAGGTGGTGGGGGCCAAGTGG - Intergenic
1194886717 X:99324380-99324402 GTTGGGGGGTGGAGGGCAAGGGG + Intergenic
1195633905 X:107090954-107090976 TTCGGGGGGTGGAGGGAAAGGGG - Intronic
1195798661 X:108682051-108682073 TCAAGGGGTAGGGGGGCTAGAGG - Intronic
1195917592 X:109951057-109951079 AAGAGGGGGTGGGGGGCAAGGGG + Intergenic
1196602335 X:117616850-117616872 TTTAGGGGGTGGAGGGCAAGTGG - Intergenic
1196630932 X:117939085-117939107 TTCAGGGGGTGGGGGGCTAGGGG - Intronic
1196868540 X:120090969-120090991 GCAAGGGGGAGGAGGGAATGAGG + Intergenic
1196948629 X:120853483-120853505 GCATGGGGGTGGAGGTCAAGGGG + Intergenic
1197270372 X:124418469-124418491 TCAAGTGGGTGGAGCAGAAGAGG - Intronic
1197434845 X:126414093-126414115 TGTAGGGGGTGGGGGGCAAGGGG + Intergenic
1198390173 X:136166481-136166503 TGGAGGGGGTGGTGGGGAAGGGG - Intronic
1198699303 X:139380810-139380832 TCGGGGGGGTGGGGGGCAAGGGG - Intergenic
1198794538 X:140381438-140381460 GTCAGGGGGTGGGGGGCAAGGGG + Intergenic
1199021602 X:142884714-142884736 TGTCGGGGGTGGGGGGCAAGGGG + Intergenic
1199088130 X:143652868-143652890 GTCAGGGGGTGGCGGGCAAGGGG + Intergenic
1199362237 X:146935446-146935468 ACAGGGTGTTGGAGGGCAAGTGG - Intergenic
1199402375 X:147413326-147413348 TGTCAGGGGTGGAGGGCAAGGGG + Intergenic
1199403200 X:147424757-147424779 TGGGGTGGGTGGAGGGCAAGGGG + Intergenic
1199628351 X:149760183-149760205 TCCAGGGGATGAAGGGAAAGGGG - Intergenic
1200083415 X:153590877-153590899 ACAAGGGGATGGAGGGCACTCGG + Intronic
1200094387 X:153650373-153650395 GCAAGGGAGGGGAGGGCAGGAGG + Exonic
1200097293 X:153670232-153670254 GCAAGGGGGTGCAGGGGGAGAGG - Intronic
1200109566 X:153733470-153733492 TCAAGGAGGTGGAGCGCACTGGG + Intronic
1200370260 X:155717551-155717573 GTCAGGGGGTGGGGGGCAAGAGG - Intergenic
1201915811 Y:19180398-19180420 TGATGGGGGTGGAGGGGCAGAGG - Intergenic
1202091802 Y:21198689-21198711 GCCAGGGGGTGGAGGGCTATGGG - Intergenic