ID: 1030977284

View in Genome Browser
Species Human (GRCh38)
Location 7:116142592-116142614
Sequence GCCCTCAACAAGTTAACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030977284_1030977285 -4 Left 1030977284 7:116142592-116142614 CCACAGGTTAACTTGTTGAGGGC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1030977285 7:116142611-116142633 GGGCTCTTCAGATGCTCTTAAGG 0: 1
1: 0
2: 1
3: 12
4: 122
1030977284_1030977286 20 Left 1030977284 7:116142592-116142614 CCACAGGTTAACTTGTTGAGGGC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1030977286 7:116142635-116142657 GCTTTTTCTCATGTGCCCAGAGG No data
1030977284_1030977287 21 Left 1030977284 7:116142592-116142614 CCACAGGTTAACTTGTTGAGGGC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1030977287 7:116142636-116142658 CTTTTTCTCATGTGCCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030977284 Original CRISPR GCCCTCAACAAGTTAACCTG TGG (reversed) Intronic
902042222 1:13501052-13501074 GCCCACAGCAAGTTTACATGAGG - Intronic
902198872 1:14819114-14819136 GCCCTCAAGAAATGAACCTCTGG + Intronic
912014447 1:105015602-105015624 GCCTTCAACAGGTTAACCATAGG + Intergenic
913962717 1:143352704-143352726 GCCGGCAAGAAGTCAACCTGGGG - Intergenic
913995612 1:143650131-143650153 GGCAGCTACAAGTTAACCTGAGG + Intergenic
914057072 1:144178289-144178311 GCCGGCAAGAAGTCAACCTGGGG - Intergenic
914122074 1:144788077-144788099 GCCGGCAAGAAGTCAACCTGGGG + Intergenic
915919233 1:159961856-159961878 GCACTCAAGAAGTTTACCTTTGG + Intergenic
915919315 1:159962340-159962362 GCACTCAAGAAGTTTACCTTTGG + Intergenic
916742172 1:167655602-167655624 GCCCTCCACCAGTCACCCTGGGG + Intronic
919293768 1:195668304-195668326 GACCTCAACAAAATAATCTGGGG - Intergenic
921214941 1:212928695-212928717 GACCTCAAGCAGTTAAGCTGGGG - Intergenic
922695676 1:227729728-227729750 GCCAGCAACAACTTGACCTGGGG + Intronic
1063302162 10:4859904-4859926 GCCCTCATGGAGTTGACCTGTGG + Intergenic
1070036669 10:72731991-72732013 TTCCTCAACAAGTTAACCATAGG - Intronic
1070568743 10:77624573-77624595 GCCCTCAATAACTTAATCTTTGG + Intronic
1073399702 10:103246468-103246490 GTCCTCAACCAGTGAACCTTTGG - Exonic
1076599403 10:131647199-131647221 GAGGTTAACAAGTTAACCTGCGG + Intergenic
1078324120 11:10365387-10365409 GCCCTCAATTTGGTAACCTGGGG + Intronic
1078455020 11:11468297-11468319 GCCCTCAACAACTTGCCTTGGGG - Intronic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1093171813 12:15869671-15869693 CTCCTCAACAAATGAACCTGGGG - Intronic
1094672647 12:32585889-32585911 GCCCTCAACTAGTACTCCTGGGG - Intronic
1098043197 12:66372987-66373009 AGACTCAACAAGTTAAGCTGCGG - Intronic
1098888641 12:75985155-75985177 GTTCTCCACGAGTTAACCTGTGG - Intergenic
1099437381 12:82660227-82660249 GTCCTCACCAAGTAAAACTGAGG - Intergenic
1114825070 14:26067322-26067344 GCCATTAACAATTTAACATGAGG - Intergenic
1118377143 14:65187438-65187460 TCCCTCATCAAGTTAGCCTGGGG + Intergenic
1122976700 14:105173840-105173862 GCCCCCAACCAGATACCCTGAGG + Intronic
1126644037 15:50857045-50857067 ACCCCAAACAAGTTAACATGAGG + Intergenic
1127080170 15:55369931-55369953 TCCCTCCACAAGTAAACATGAGG - Intronic
1137527609 16:49249985-49250007 GCCCTTAACAAGCTATCCTTGGG - Intergenic
1139563142 16:67756419-67756441 TCCCTCACAAAGATAACCTGAGG + Intronic
1141710442 16:85695798-85695820 GCCCTCTACCACTTCACCTGTGG + Intronic
1144155913 17:12502284-12502306 ACCCTCAACAAATTAACCATAGG + Intergenic
1146722452 17:35132873-35132895 GCCCTCTACAAGGTGTCCTGTGG + Intronic
1150573501 17:66409255-66409277 ACTTTCAACAAGTGAACCTGAGG - Intronic
1153650375 18:7234150-7234172 GCCTGCAACAAGCTAACATGGGG - Intergenic
1163153356 19:15427635-15427657 GCCCTCACCACCCTAACCTGTGG - Intronic
1165139227 19:33689050-33689072 GCCCTCTACAAGTTACCCAGGGG - Intronic
1166749893 19:45159663-45159685 ACCCTGAACAAGATCACCTGTGG + Intronic
1168170644 19:54586471-54586493 GCCCTCAACCACTTCACCTGGGG - Intronic
1168313886 19:55475494-55475516 GCTCTCAACTAGTGAACATGTGG + Intergenic
1202696555 1_KI270712v1_random:130962-130984 GCCGGCAAGAAGTCAACCTGGGG - Intergenic
926892525 2:17650360-17650382 CCACTCAACAAGTTAATCTGGGG - Intronic
932592750 2:73076885-73076907 GACCTCAACAAGTCCACTTGTGG - Intronic
934277715 2:91587987-91588009 GCCGGCAAGAAGTCAACCTGAGG - Intergenic
937163394 2:119788157-119788179 GCAAACAACAAGTTAATCTGGGG - Intronic
948620162 2:239229368-239229390 CCCTCCATCAAGTTAACCTGAGG - Intronic
1171146859 20:22792171-22792193 GCCCTCAGGAAGTTATCATGAGG - Intergenic
1181561637 22:23706603-23706625 CCCTTCAACAAGTCAACCAGGGG + Intergenic
1183324337 22:37183335-37183357 GCCCTCAACAAAATGTCCTGTGG + Intronic
1184337792 22:43864448-43864470 TCCCTCACCAAATGAACCTGGGG + Intergenic
950018155 3:9768590-9768612 GCCCTCAGCAAGCTTAGCTGGGG - Intronic
950540187 3:13607829-13607851 GCCCATAACAGGTTAACATGGGG - Intronic
952745210 3:36770553-36770575 TCTCTCAAGAAGTTTACCTGGGG - Intergenic
952843377 3:37666923-37666945 GCCCTCAACCAGTGAATCTCAGG - Intronic
953796802 3:45992216-45992238 ACCATCAACAAGGCAACCTGGGG + Intronic
956626337 3:71270727-71270749 GCCCTCAAAAAGTTACCAAGTGG + Intronic
960472844 3:118088843-118088865 GCACACATCAAGTTAGCCTGGGG + Intergenic
972762066 4:42116381-42116403 GAACTCAACAAATTAACCAGGGG + Exonic
974715157 4:65660189-65660211 GCCCTCTACCAGTCTACCTGAGG + Intronic
979885941 4:126027872-126027894 GTCCTCAACAAGCTGAGCTGGGG - Intergenic
984740691 4:183158603-183158625 ACCCTCAACACCATAACCTGAGG - Intronic
985278886 4:188268010-188268032 CCCCTCAACAAGTTGAACCGTGG + Intergenic
988214422 5:28252917-28252939 GCCCTCAACAAGCAAAGCTGAGG - Intergenic
989209265 5:38843979-38844001 GCTTTAATCAAGTTAACCTGAGG - Intergenic
1001117135 5:168949129-168949151 CCCCTGAACAAGCTGACCTGTGG + Intronic
1003859293 6:10307550-10307572 CCCCTCATCAATCTAACCTGGGG - Intergenic
1004916985 6:20341387-20341409 GGCCTCAGCAAAGTAACCTGGGG + Intergenic
1011272866 6:85597324-85597346 ACCCTCAACACGTTAAAATGTGG - Intronic
1027927675 7:84487629-84487651 AACTTCAAGAAGTTAACCTGTGG + Intronic
1030543471 7:110862969-110862991 GCCCTCCACACATTACCCTGTGG + Intronic
1030977284 7:116142592-116142614 GCCCTCAACAAGTTAACCTGTGG - Intronic
1032533417 7:132640368-132640390 GGCCTCAACAAATTAATTTGAGG - Intronic
1033298211 7:140160640-140160662 GGCCCCAACAAGTGATCCTGAGG + Intronic
1034387992 7:150756375-150756397 GCCCTTGACAAGTTAACAAGGGG + Intergenic
1036021361 8:4850804-4850826 GCCCTCAAAAATTCAACCAGTGG + Intronic
1039532180 8:38272640-38272662 TCCTTCAACAAATTAACATGTGG + Exonic
1045285195 8:100784641-100784663 GCTCTCAACAACTTAACATATGG - Intergenic
1058159471 9:101552251-101552273 GACCTGAACAAGGTAACCAGAGG + Exonic
1058308654 9:103473485-103473507 GCCTTCAATAAGTGATCCTGAGG - Intergenic
1187893936 X:23963477-23963499 ACCCTCAAGAAGTTCAACTGGGG - Intergenic
1193533902 X:82689329-82689351 GACATCAACAACATAACCTGTGG - Intergenic
1196186095 X:112746657-112746679 GCATTCATTAAGTTAACCTGAGG - Intergenic
1199081982 X:143587284-143587306 GCCCACAACAAATTTCCCTGTGG - Intergenic
1199990744 X:152986419-152986441 GTCCTCAACAAGTGCCCCTGAGG - Intergenic
1200033833 X:153315893-153315915 GTCCTCAACAAGTGCCCCTGAGG - Intergenic
1200058444 X:153473439-153473461 GCCCTGAACCAGGGAACCTGGGG + Intronic
1200612551 Y:5341655-5341677 GCCCTCAAAAAGTAATACTGTGG + Intronic
1201587811 Y:15580754-15580776 GCCATCAGGAAGTTAGCCTGGGG - Intergenic