ID: 1030977772

View in Genome Browser
Species Human (GRCh38)
Location 7:116148164-116148186
Sequence GGTCAGAGTATTCCAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030977768_1030977772 11 Left 1030977768 7:116148130-116148152 CCAGACAGAGATAATAGACAGTA 0: 1
1: 0
2: 2
3: 19
4: 201
Right 1030977772 7:116148164-116148186 GGTCAGAGTATTCCAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030977772 Original CRISPR GGTCAGAGTATTCCAGAAAC AGG Intronic
No off target data available for this crispr