ID: 1030979699

View in Genome Browser
Species Human (GRCh38)
Location 7:116171823-116171845
Sequence CTCAGACTCAGGTGGATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030979693_1030979699 -1 Left 1030979693 7:116171801-116171823 CCACCAGTTCGAATCCCAGAATC No data
Right 1030979699 7:116171823-116171845 CTCAGACTCAGGTGGATCCAAGG No data
1030979694_1030979699 -4 Left 1030979694 7:116171804-116171826 CCAGTTCGAATCCCAGAATCTCA No data
Right 1030979699 7:116171823-116171845 CTCAGACTCAGGTGGATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030979699 Original CRISPR CTCAGACTCAGGTGGATCCA AGG Intergenic
No off target data available for this crispr