ID: 1030983382

View in Genome Browser
Species Human (GRCh38)
Location 7:116211414-116211436
Sequence GCAGGGAGACATTTTCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030983378_1030983382 7 Left 1030983378 7:116211384-116211406 CCAAAGGGCGGTTGTCACCAGCG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1030983382 7:116211414-116211436 GCAGGGAGACATTTTCAGCTTGG 0: 1
1: 0
2: 0
3: 15
4: 207
1030983377_1030983382 8 Left 1030983377 7:116211383-116211405 CCCAAAGGGCGGTTGTCACCAGC 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1030983382 7:116211414-116211436 GCAGGGAGACATTTTCAGCTTGG 0: 1
1: 0
2: 0
3: 15
4: 207
1030983373_1030983382 26 Left 1030983373 7:116211365-116211387 CCTTGTTTGGCAGGTAGTCCCAA 0: 1
1: 0
2: 0
3: 8
4: 177
Right 1030983382 7:116211414-116211436 GCAGGGAGACATTTTCAGCTTGG 0: 1
1: 0
2: 0
3: 15
4: 207
1030983381_1030983382 -10 Left 1030983381 7:116211401-116211423 CCAGCGTCTCAGCGCAGGGAGAC 0: 1
1: 0
2: 2
3: 6
4: 105
Right 1030983382 7:116211414-116211436 GCAGGGAGACATTTTCAGCTTGG 0: 1
1: 0
2: 0
3: 15
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030983382 Original CRISPR GCAGGGAGACATTTTCAGCT TGG Intronic
900865410 1:5265518-5265540 GCAGGCAGACATGCTCAGCTTGG - Intergenic
902490035 1:16774917-16774939 GCGGTGACACATTTTCATCTTGG + Intronic
904275316 1:29379992-29380014 GCAGGGACACATCTTCTGCCAGG + Intergenic
905657366 1:39693234-39693256 GCAGGGGGAAATTTTCAACCAGG + Intronic
905874216 1:41422124-41422146 GCAGGGAGACTTTTGCAGGGTGG + Intergenic
907073988 1:51562662-51562684 GCAGGGACCCATTCTGAGCTTGG + Intergenic
909193541 1:72586688-72586710 GCAGGGAAACAATTGCAACTTGG - Intergenic
910434073 1:87187613-87187635 GCAGGGAGAGATTTGAACCTAGG + Intergenic
911060087 1:93740120-93740142 ACAGGAAGGCATTTTCATCTGGG + Intronic
912239956 1:107895989-107896011 GCGGGGATCCATTTTCAGCTTGG + Intronic
916028837 1:160859099-160859121 GCAGGCTGACATTTTCAGTGGGG + Intronic
916286403 1:163109854-163109876 GCCTGGAGACATTTTCCCCTTGG + Intergenic
917055033 1:170971683-170971705 GCATGCAGACATTTTCATATTGG + Intronic
917601597 1:176579471-176579493 ACAGGGAGACATAAACAGCTGGG + Intronic
919396456 1:197055408-197055430 CCAGGGAGGGAATTTCAGCTAGG + Intronic
921241481 1:213188312-213188334 GGAGGGTGAGATTTTCTGCTTGG + Intronic
923530403 1:234807613-234807635 GCGGTGACACATTTTCATCTTGG - Intergenic
924059428 1:240156292-240156314 GCAGAGGGAAATGTTCAGCTGGG + Intronic
924902289 1:248413870-248413892 AAAGAGAGACATTTTCAGCACGG + Intergenic
1063555870 10:7079029-7079051 ACAGGTAGACAGTTTCAGTTTGG - Intergenic
1063730379 10:8689914-8689936 ACTGGGTGACATTTTCAGCAAGG - Intergenic
1063885410 10:10572651-10572673 GCAGGGACACAGTTGGAGCTGGG - Intergenic
1066207130 10:33200342-33200364 TCAGGGAAGCATTTTCACCTTGG + Intronic
1066226912 10:33392788-33392810 GAAGAGAGACATTATCACCTGGG + Intergenic
1068768596 10:60795125-60795147 GCAGCGAGACCTTTTAAGATTGG + Intergenic
1071992272 10:91111240-91111262 GCAGGCAGATATTTTTAACTGGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1073366669 10:102948411-102948433 GCAGGGAGACATGATAAGGTGGG + Intronic
1073902177 10:108235150-108235172 TCAGGGGGATATTTTCAGGTAGG + Intergenic
1073982634 10:109172408-109172430 GCAGGGAGTAATTTTCAGCCTGG + Intergenic
1074085506 10:110206813-110206835 GCAGTGAAACAATGTCAGCTGGG + Intergenic
1076058396 10:127393886-127393908 GCAAGGAGTCATTATTAGCTCGG - Intronic
1076392956 10:130117407-130117429 ACAAAGAGAAATTTTCAGCTGGG + Intergenic
1076401510 10:130188571-130188593 GGAGGGAGACATGTTCCTCTGGG + Intergenic
1076566101 10:131400599-131400621 GCAGGGAGACAGCTTAAGCAGGG + Intergenic
1077131837 11:976890-976912 GCAGGGAGACCTTTGGAGCAGGG + Intronic
1079740722 11:24056243-24056265 TCAGGGAGAAAATTTCAGCTAGG + Intergenic
1080877758 11:36292182-36292204 ACAAGGAGACATGTACAGCTTGG - Intergenic
1083041562 11:59692334-59692356 CCAGGGAGAAATTGTAAGCTGGG - Intergenic
1085499373 11:77005539-77005561 GCCCTGAGACATTTTCATCTGGG - Intronic
1086098852 11:83077347-83077369 GCAAAGAAACATTTTCGGCTGGG - Intergenic
1088703728 11:112440880-112440902 GCTGGGAGGCATGATCAGCTGGG - Intergenic
1089102105 11:115971905-115971927 GAAGGGATCCAGTTTCAGCTTGG - Intergenic
1090299220 11:125620339-125620361 GCAGTGATACTTTTCCAGCTGGG + Intronic
1091398159 12:166740-166762 GCAGGGAGAGTTTTTGAGCAGGG + Intronic
1091795131 12:3293745-3293767 GTAGGGGGACAGTTGCAGCTGGG + Intergenic
1091836353 12:3588814-3588836 GCAGGGAGGCATCTTCAGAATGG + Intronic
1093166011 12:15805015-15805037 GCAGGGACAGGTTTCCAGCTAGG - Intronic
1094421938 12:30280275-30280297 GCATGGAGACATTTTCCCCATGG - Intergenic
1094614711 12:32025801-32025823 ACAGGGATACATTTTCCTCTGGG + Intergenic
1097490962 12:60269943-60269965 GCAGGGCGACAATTCCAGCGCGG - Intergenic
1097611606 12:61829876-61829898 GGAGGGAGATATTTTGAGGTAGG - Intronic
1097954671 12:65471184-65471206 GCAGGGAGTCTTATTCAGTTTGG - Intronic
1100143260 12:91644560-91644582 GTATGTAGACATTTTCAGATTGG + Intergenic
1100945928 12:99784066-99784088 GCAGGGAGAAAATATCATCTGGG - Intronic
1101091576 12:101292050-101292072 GCAAGGAAACATTTTCACCCAGG - Exonic
1102949528 12:117021091-117021113 GCAGGGAGACATGGACAGGTAGG - Intronic
1107447880 13:40484464-40484486 GCAGGGGGACTTTCTCAGATGGG + Intergenic
1110619534 13:77579596-77579618 CCAGGGAGTCATTTTGAGCCAGG + Intronic
1114449410 14:22815112-22815134 GCAGGGAGACAGCTGCAGCCAGG + Intronic
1115068899 14:29297371-29297393 GCCTGGAGACATTTTCCCCTTGG + Intergenic
1117353898 14:54905313-54905335 TAAGGGATTCATTTTCAGCTTGG + Intergenic
1117628729 14:57667227-57667249 GGAGAGAGACATGTTCTGCTGGG + Intronic
1117978011 14:61317624-61317646 GCAGGGAGGAATTGTCTGCTAGG - Intronic
1119140904 14:72266226-72266248 GCTGGAAGGCATGTTCAGCTGGG + Intronic
1121242377 14:92440076-92440098 TCATGGTGACATTTGCAGCTGGG + Intronic
1121351100 14:93173639-93173661 GCAGCTGGACATTTACAGCTTGG + Intergenic
1121771912 14:96553215-96553237 GCAGTGAAAAATTTTCAGCCAGG + Intronic
1124791770 15:32734145-32734167 TCAGGAAGACATGTTCAGCTGGG - Exonic
1124961755 15:34402643-34402665 GCAGGAAGATCTTTTGAGCTTGG - Intronic
1124978380 15:34548865-34548887 GCAGGAAGATCTTTTGAGCTTGG - Intronic
1126645356 15:50869915-50869937 ACTGGGAGAAATTTTCAGGTTGG + Intergenic
1130234851 15:82124559-82124581 GCAGGGGGAACTGTTCAGCTTGG + Intergenic
1130266310 15:82407698-82407720 GCAGGAAGATCTTTTGAGCTTGG + Intergenic
1130505703 15:84539190-84539212 GCAGGAAGATCTTTTGAGCTTGG - Intergenic
1131065201 15:89430198-89430220 GCAGGGAGACCTTCAGAGCTGGG - Intergenic
1131549037 15:93340578-93340600 GCTTGCAGACATTTTCAGCCTGG - Intergenic
1132759921 16:1503728-1503750 TCACGGGGACAGTTTCAGCTTGG + Intronic
1133180019 16:4047223-4047245 GCATGGAGCCATTTTCATCCAGG + Intronic
1137696330 16:50464588-50464610 AGAGGGAGCCTTTTTCAGCTGGG + Intergenic
1139139915 16:64248800-64248822 GCAGTAAGACATATTCAGGTAGG + Intergenic
1140132553 16:72176293-72176315 AGGGGGAGACATTTTCACCTAGG - Intronic
1140342170 16:74175037-74175059 GCAGGGAGGCAGGTGCAGCTGGG + Intergenic
1141858241 16:86699539-86699561 GGAGTAAGACATTTTCGGCTGGG - Intergenic
1143828078 17:9628984-9629006 GCTGGGAGACTTTCTGAGCTAGG + Intronic
1145048912 17:19643937-19643959 GAAGGGAGAATGTTTCAGCTTGG + Intergenic
1145053507 17:19682456-19682478 GCAGAGACACATTCTCAACTAGG - Intronic
1146973618 17:37092732-37092754 GCTGGGAGACACCTCCAGCTAGG + Intronic
1148339025 17:46862363-46862385 GCAGGTAGACATCTACAGGTTGG + Intronic
1148717028 17:49723204-49723226 GGAAGGAGACATTTTCAGAAAGG + Intronic
1148875985 17:50687502-50687524 GAAGGCAGGCATTTCCAGCTGGG - Intronic
1149385303 17:56137219-56137241 GAAGGGTCACATTTTCTGCTGGG - Intronic
1152588166 17:81198308-81198330 GCAGGGAGACAGATGCAGCAAGG + Intronic
1155104780 18:22652268-22652290 GAAGGCAGACATTGTCAGATTGG - Intergenic
1157120805 18:44909277-44909299 GCAGGAACACATTTTCTCCTCGG - Intronic
1159893094 18:73971693-73971715 TCAGGGAGGCATTTTAAGCAGGG - Intergenic
1161245277 19:3248341-3248363 ACAGGGATACAGTTTCAGTTTGG - Intronic
1161926816 19:7306953-7306975 GCATGTAGAAACTTTCAGCTGGG + Intergenic
1161926876 19:7307379-7307401 GCATGTAGAAACTTTCAGCTGGG + Intergenic
1166434353 19:42754850-42754872 GCAGGGAGTCATGGCCAGCTCGG + Intronic
1166444234 19:42844878-42844900 GCAGGGAGTCATGGCCAGCTCGG + Intronic
1166454125 19:42926290-42926312 GCAGGGAGTCATGGCCAGCTCGG + Intronic
1166470065 19:43072217-43072239 GCAGGGAGTCATGGCCAGCTTGG + Intronic
1167172571 19:47843052-47843074 GCAGGGAGCCAAATCCAGCTAGG + Exonic
1167718613 19:51161347-51161369 GCATTGAAACATCTTCAGCTTGG - Intergenic
925747395 2:7055269-7055291 TCAGAGAAACAGTTTCAGCTGGG - Intronic
926303695 2:11621910-11621932 GCAAGGAGACAAATTCAGCAGGG - Intronic
926752188 2:16206661-16206683 CCATGGAGACATTTGGAGCTGGG + Intergenic
926777843 2:16439820-16439842 GCAGGGAGACACTTTAAGTGTGG + Intergenic
930023650 2:47016508-47016530 GCAGGGAAAGATCTTCACCTGGG + Intronic
930174808 2:48290850-48290872 GGAGGGAGATATTTTCAGACAGG + Intergenic
932218378 2:69981983-69982005 GTAGGGAGAGATTTGCAGTTAGG - Intergenic
934610640 2:95732663-95732685 GCCTGGAGACATTTTCCCCTTGG + Intergenic
937213186 2:120291442-120291464 TCAGGGAGACTCTCTCAGCTTGG + Intronic
938736482 2:134191056-134191078 GGAGGGACACAGTTTCGGCTTGG - Intronic
939016836 2:136913465-136913487 GCCTGGAGACATTTTCCCCTTGG - Intronic
939570255 2:143832351-143832373 GTAAGGAGGCATTGTCAGCTTGG - Intergenic
939733263 2:145811593-145811615 GGATGGAGACATTTGCAGTTAGG - Intergenic
940973689 2:159921024-159921046 GGAGGCAGACACTTCCAGCTGGG - Intergenic
942959844 2:181817187-181817209 GAAGGGAGACATTCTTAACTCGG + Intergenic
943084097 2:183291640-183291662 CCTGGGAGACATTGTGAGCTCGG - Intergenic
944440055 2:199733174-199733196 GCTGGGAGATAGTTTAAGCTGGG + Intergenic
948436658 2:237958284-237958306 GCAGATACACATTTTCAGCCGGG + Intergenic
948862469 2:240759497-240759519 GCAGGGAGACAGCTTAGGCTTGG - Intronic
1169192592 20:3667606-3667628 GCAGGGAGGCAACTTCACCTCGG - Intergenic
1169334713 20:4746791-4746813 GCAGTGAGCCCTTTTCAGCAGGG - Intergenic
1171029421 20:21663919-21663941 GCATGGAGACAGATGCAGCTGGG + Intergenic
1171435302 20:25117489-25117511 GCAGGAACACATCCTCAGCTTGG + Intergenic
1172017450 20:31886279-31886301 GCAGGATGACATTTGCAGCTGGG - Intronic
1172882169 20:38209110-38209132 TCAGAGAGCTATTTTCAGCTGGG + Intergenic
1172902903 20:38347781-38347803 GGAGGCAGACATTGGCAGCTGGG + Intronic
1176169728 20:63691359-63691381 GCAGGGAGAAAATTTCGGGTTGG - Intronic
1176264334 20:64200944-64200966 GAAGGGAGACATTGCCTGCTTGG + Intronic
1177251319 21:18595384-18595406 ACAGGGTGATATTTTCATCTGGG - Intergenic
1179148836 21:38793366-38793388 GTAGGGAGACATCTTCAACCAGG + Intergenic
1181267134 22:21636910-21636932 GCAGGCAGACATGTAGAGCTTGG - Exonic
1182711583 22:32326616-32326638 GCAGGGACACATTTACAAGTAGG - Intergenic
1183596902 22:38818286-38818308 ACAGGGAGAACTTGTCAGCTGGG + Intergenic
949807909 3:7975540-7975562 GCAGGGAGATATTGTTAGCATGG - Intergenic
949872051 3:8597114-8597136 GAAGTGAGACATGTTCAGATGGG + Intergenic
950520674 3:13496026-13496048 GCAGGGATGCGTTTTCAGCCAGG + Intronic
953557164 3:43955512-43955534 GAAAGGATATATTTTCAGCTCGG + Intergenic
955549494 3:60068295-60068317 GAAAGCAAACATTTTCAGCTTGG - Intronic
956660439 3:71592094-71592116 GCAAAGAGTCATTTGCAGCTGGG + Intergenic
958149997 3:89679416-89679438 TCAGGGAAAGATTTTAAGCTAGG - Intergenic
959613076 3:108316617-108316639 AAAGGGAGACAGTTACAGCTAGG + Intronic
961384903 3:126517844-126517866 GCAGGGAGCCATGTGCAGGTCGG + Intergenic
963144776 3:141981668-141981690 GAATGGTGACATTTTCAGTTAGG + Intronic
964654510 3:159051854-159051876 GCCTGGAGACATTTTCCCCTTGG - Intronic
970384072 4:15538409-15538431 GCAGGCAGAGATTTGCAACTGGG - Intronic
972891119 4:43557528-43557550 GCAGGGATACATGTCCATCTGGG - Intergenic
974587827 4:63902381-63902403 GCTGGGAGGTATTTTCATCTTGG - Intergenic
976770768 4:88649941-88649963 GCAGGGAGTGATGGTCAGCTAGG + Exonic
977720624 4:100236246-100236268 GCAGAGAGCGATTTTGAGCTTGG - Intergenic
979477590 4:121176290-121176312 GCAGGCAGAGCTTTTCAGCCAGG + Intronic
979485706 4:121267627-121267649 GCAGGCAGACATTTCTAGGTGGG - Intergenic
980843267 4:138292529-138292551 GTAGGAAGACATCTTCAGATGGG - Intergenic
981541145 4:145847330-145847352 GAAAGCAGAAATTTTCAGCTGGG - Intronic
981562424 4:146062531-146062553 GCAGGGAGACAATGAGAGCTGGG + Intergenic
982404558 4:155005585-155005607 GCAGGGAAACATTTTCCTCAGGG + Intergenic
982475450 4:155844401-155844423 GCAGAGAGCAGTTTTCAGCTTGG + Intronic
985091503 4:186367051-186367073 GATGGGAGACATTTTCACTTAGG - Intergenic
985396233 4:189547373-189547395 GTAGGGTGACATTTTTATCTTGG - Intergenic
987189727 5:15463656-15463678 GCAGGGACAGATTTCCTGCTGGG + Intergenic
987639653 5:20596325-20596347 AAAGGGAGACATTGTCAGATTGG - Intergenic
987712464 5:21519817-21519839 GCAGTTAGACATTTTCAGCATGG - Intergenic
988301958 5:29440978-29441000 GCAGTTAGACATTTTCAGCATGG + Intergenic
991762824 5:69938969-69938991 GCAGTTAGACATTTTCAGCATGG - Intergenic
991784503 5:70179158-70179180 GCAGTTAGACATTTTCAGCATGG + Intergenic
991842051 5:70814009-70814031 GCAGTTAGACATTTTCAGCATGG - Intergenic
991876949 5:71179546-71179568 GCAGTTAGACATTTTCAGCATGG + Intergenic
993573668 5:89574519-89574541 GAAGGGAGAATTTTTCAACTGGG + Intergenic
998213704 5:140221334-140221356 ACAGGGACACAGTTTCAGTTTGG - Intronic
1000122742 5:158212788-158212810 GCAAGGAGACATTCTCTCCTTGG + Intergenic
1000342472 5:160288362-160288384 TCAGGGATAAATTTTGAGCTGGG - Intronic
1001428432 5:171640781-171640803 TCACAGAGTCATTTTCAGCTTGG - Intergenic
1002898295 6:1391594-1391616 GCAGCGAGATGTTTGCAGCTGGG + Intronic
1005601624 6:27431996-27432018 GCAGGGAGAGGTTTCTAGCTTGG + Intergenic
1006277626 6:33018397-33018419 TCAAGGAGACATTGTTAGCTGGG - Intergenic
1007620934 6:43214007-43214029 GTAGGGTGACATTTCCATCTGGG + Intronic
1009005189 6:57776552-57776574 GCAGTTAGAGATTTTCAGCATGG + Intergenic
1009966208 6:70581699-70581721 GCAGGAGGACAGTTTGAGCTGGG - Intronic
1009997114 6:70908049-70908071 CCAGGGAGATATTGTCAGCAAGG - Intronic
1010971952 6:82272233-82272255 GCAGGGTGACCTTTTCAGAGAGG - Intergenic
1021773298 7:24026539-24026561 GCAGGCAGTCACTTTCACCTAGG - Intergenic
1022008960 7:26292277-26292299 GCAGGGAGAAATGATCAGCGCGG + Intronic
1022923839 7:35040857-35040879 TCAGGGAAACATTGTCAGATGGG + Intergenic
1029840282 7:103355404-103355426 GCAGGGTGTAGTTTTCAGCTGGG + Intronic
1030322567 7:108184508-108184530 GTAAGGAGACAGCTTCAGCTGGG + Exonic
1030983382 7:116211414-116211436 GCAGGGAGACATTTTCAGCTTGG + Intronic
1031662971 7:124450178-124450200 ACAGGGTCACATTTTCAGCAAGG + Intergenic
1032210398 7:129909208-129909230 GCAGGGAGAAAATGTCAGGTGGG + Intronic
1033209849 7:139452749-139452771 GCATGGAGACATCTTCAGGTTGG + Exonic
1033251151 7:139760949-139760971 GCAGTGAGACCCCTTCAGCTAGG - Intronic
1033609063 7:142948034-142948056 GCAGGGAGACCACTTGAGCTTGG + Intronic
1034706079 7:153146171-153146193 GCAGGGATACATTTTTCCCTTGG + Intergenic
1037174262 8:15928811-15928833 GCAGGGAGACATCTGGAGATAGG + Intergenic
1038261255 8:25997340-25997362 GCAGGCAGACGGTTTGAGCTCGG + Intronic
1039161684 8:34628559-34628581 ACAGGGAGGTATTTACAGCTAGG - Intergenic
1039656295 8:39411769-39411791 GGAGAGAGACTTTTTCTGCTTGG + Intergenic
1041963370 8:63646480-63646502 GCATTGTCACATTTTCAGCTGGG + Intergenic
1042458946 8:69039563-69039585 GCAGGGAGACCATTTCACTTAGG + Intergenic
1042786601 8:72554076-72554098 TCAGGGAGACAGTTTCAACTAGG + Intronic
1043510454 8:80945812-80945834 GCTGGGAGACATTTTCCCCATGG - Intergenic
1045505061 8:102772362-102772384 GCAGGGACCCATATTGAGCTGGG - Intergenic
1046791907 8:118331582-118331604 GCAAGAAGATATTTTCAGCCAGG + Intronic
1049795545 8:144495841-144495863 GCAGGCAGACAGCTTCGGCTGGG - Intronic
1056131086 9:83587204-83587226 GCAAAGAGATATTTGCAGCTGGG + Intergenic
1057570532 9:96201157-96201179 GCAGTTAGAGATTTTCATCTGGG - Intergenic
1057604641 9:96490082-96490104 GTGGGGAGACTTTTCCAGCTGGG + Exonic
1058133216 9:101277050-101277072 GCATGGAGACATTGGCAGTTAGG + Intronic
1058615441 9:106822339-106822361 GCAGGCAGAAATGTTCATCTGGG + Intergenic
1060137980 9:121175876-121175898 GCAGGGAGACATACTAAACTAGG - Intronic
1187194868 X:17073193-17073215 GCAGTGAGACATTTTCTTTTTGG + Intronic
1187919805 X:24190617-24190639 GCAGGGTGACATTTTTGTCTAGG - Intronic
1189237514 X:39498891-39498913 GCAGGTAGATATCTTGAGCTTGG + Intergenic
1189996607 X:46645313-46645335 GCAGGGAGACATTCAGAGCTTGG - Intronic
1195016364 X:100785607-100785629 GCAGAGAGCAATCTTCAGCTTGG + Intergenic
1195670250 X:107463671-107463693 GCAAGGAGACATTTTTAGAATGG - Intergenic
1199680534 X:150221461-150221483 GGAGGGAGTCATTCTCAGCACGG - Intergenic
1200041608 X:153374899-153374921 GCAGGGAGGCATTGACAGCGTGG + Intergenic
1202364258 Y:24145433-24145455 GCAGGAAGATCTTTTGAGCTTGG + Intergenic
1202506522 Y:25524689-25524711 GCAGGAAGATCTTTTGAGCTTGG - Intergenic