ID: 1030983900

View in Genome Browser
Species Human (GRCh38)
Location 7:116218025-116218047
Sequence CTGTTAGAATGGTGGGGAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030983894_1030983900 -2 Left 1030983894 7:116218004-116218026 CCAATTTCTCTGTTCCTTAGTCT 0: 1
1: 0
2: 4
3: 57
4: 537
Right 1030983900 7:116218025-116218047 CTGTTAGAATGGTGGGGAGTCGG 0: 1
1: 0
2: 0
3: 15
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030983900 Original CRISPR CTGTTAGAATGGTGGGGAGT CGG Intronic
901111584 1:6801046-6801068 AAGTTAGAAGGGTGGAGAGTGGG + Intronic
903830493 1:26171377-26171399 CTGCCAGGAAGGTGGGGAGTGGG + Exonic
904580190 1:31537485-31537507 AGAGTAGAATGGTGGGGAGTAGG + Intergenic
904725048 1:32540291-32540313 GTCTTAGAATGATGTGGAGTAGG - Intronic
904981761 1:34509498-34509520 CTGTCAGTCTGTTGGGGAGTGGG + Intergenic
909488000 1:76195756-76195778 CTGGAGGAATGTTGGGGAGTAGG - Intronic
910391186 1:86746304-86746326 CTGTCAGCATGGAGGTGAGTGGG - Intronic
912098173 1:106171471-106171493 CTGTGCCAATGGTGGTGAGTTGG - Intergenic
913302418 1:117386379-117386401 TTGTTAGAATGATGGGGATGAGG + Intronic
913501783 1:119478401-119478423 CTGTTAGAATGGAGCGAAGAAGG + Intergenic
915898156 1:159827249-159827271 CTGTGAGAATGGTGAGGACCCGG + Intronic
917309410 1:173663036-173663058 GTGTTGGAAGGGTGGGGAGTTGG - Intronic
923056745 1:230432155-230432177 TTGCTTGAATGGTGGCGAGTTGG + Intergenic
924144371 1:241058760-241058782 CTTTTAAAATGATGAGGAGTTGG + Intronic
924467808 1:244314016-244314038 CTGTTAGAATGGAGGCATGTGGG - Intergenic
1064704850 10:18061017-18061039 CTGTAAGAGTAGTGGGGAGGAGG + Intergenic
1065109653 10:22427219-22427241 CTGGAAGAATGGTGGGGTGGAGG + Intronic
1065682864 10:28254951-28254973 ATGACATAATGGTGGGGAGTAGG + Intronic
1065794343 10:29292255-29292277 CTGCTGGCATTGTGGGGAGTGGG + Intronic
1065948216 10:30626506-30626528 CTGCTGGCATTGTGGGGAGTGGG - Intronic
1067031947 10:42884215-42884237 CTGTTGGGAGTGTGGGGAGTGGG + Intergenic
1068513683 10:57998912-57998934 CAGTTAGGATGGAGGGCAGTGGG - Intergenic
1072519043 10:96214214-96214236 CTGTGAGAATGCTGGAGAGCAGG + Intronic
1074548905 10:114425144-114425166 CTATTAGAAGGTTGGGGAGGTGG - Intergenic
1076529668 10:131136043-131136065 TCGTTAGCATGGTGGGGAGGGGG - Intronic
1077665517 11:4105183-4105205 CTTTCAGAATGGTGGGCAGTGGG - Intronic
1079223776 11:18587961-18587983 ATGTTGGAAGGCTGGGGAGTAGG - Intronic
1079745973 11:24130638-24130660 CTTGTAGAATAGTTGGGAGTTGG + Intergenic
1081207329 11:40291510-40291532 CAGTTAGAAGGGGGTGGAGTTGG + Intronic
1084001071 11:66295678-66295700 ATGGTGGAATGGTGGGGAGGGGG - Exonic
1086639427 11:89133516-89133538 TTGTTAAAATGGTGAGGACTTGG - Intergenic
1087672103 11:101119457-101119479 CTGTTAGAAGAGTGAGCAGTTGG + Intronic
1088131090 11:106491940-106491962 TTGTTAAAATGGCTGGGAGTGGG + Intergenic
1089125963 11:116176752-116176774 CTCTCAGAATGGTGGGGGGAGGG + Intergenic
1090437705 11:126700636-126700658 TTCTTAGAAGGCTGGGGAGTGGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091687687 12:2575234-2575256 CTGCTAGAATGGACGGGAGCAGG + Intronic
1093991450 12:25593185-25593207 ATGGTAGTATGGTGGTGAGTGGG - Intronic
1095297629 12:40545075-40545097 CTGTTTGACTGCTGGAGAGTTGG - Exonic
1095934387 12:47660808-47660830 TTGTTAAAATGGTGAGGACTTGG + Intergenic
1096483806 12:51962281-51962303 CTATTTGTATGGTGGGGGGTGGG - Intronic
1096489594 12:52006562-52006584 CTGTAAGAAGCCTGGGGAGTCGG - Intergenic
1098054599 12:66491456-66491478 CTGTCAGAGTGGTGGGGCTTGGG + Intronic
1102687529 12:114736173-114736195 CTGGGAGAGTTGTGGGGAGTTGG + Intergenic
1102925271 12:116821459-116821481 CTGTTAGGATGGTGGGGTTGTGG - Intronic
1103871889 12:124098223-124098245 CTGTGAGGATGGTGGGGCGCAGG + Intronic
1105035168 12:132914436-132914458 GGGGTAGAATGGTGGGAAGTGGG - Intronic
1105766197 13:23562033-23562055 AGGTTAGAAAGGTGGGGAGGAGG + Intergenic
1107401205 13:40070913-40070935 GTGTTAGAATTGTGGGGTGAGGG + Intergenic
1107789988 13:43992075-43992097 AAGATAGAATGGTGGGGGGTTGG + Intergenic
1108487410 13:50940929-50940951 ATGTCAGCATGGTTGGGAGTTGG + Intronic
1109885848 13:68543359-68543381 CTGTGAGATTGCTGGGGAGATGG - Intergenic
1112132615 13:96540512-96540534 CTATTAGAGTGGTTGGGAGGAGG - Intronic
1112371943 13:98802009-98802031 CTGGTAGGATGGTGAGGACTCGG + Intronic
1113467617 13:110523456-110523478 CTGTCAGAGGGGTGGGGAGGTGG - Exonic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1114634297 14:24178671-24178693 CTGTAAGAATGGTGGGGGTTGGG + Exonic
1118929118 14:70223763-70223785 CTGTTTGCATGGGGAGGAGTCGG - Intergenic
1119216973 14:72876543-72876565 CTGTTTGGCTGGTTGGGAGTAGG - Intronic
1119228498 14:72961979-72962001 CTGTTAGAACAGAGGGAAGTGGG - Intergenic
1120520022 14:85516270-85516292 CTGGTAGAGTGGCAGGGAGTGGG + Intergenic
1125077982 15:35642359-35642381 CTGTTAGTATAGTTGGAAGTAGG - Intergenic
1125883298 15:43211064-43211086 CTCTGAGGATGGTGAGGAGTTGG + Intronic
1127376548 15:58390114-58390136 CTGTTGGACTGGAAGGGAGTTGG - Intronic
1129365829 15:75053758-75053780 CTGTTAGACTGGTGGGGGTGTGG + Intronic
1131213763 15:90519954-90519976 CTGTGAGAATCCTGGGTAGTAGG - Intergenic
1131991754 15:98099600-98099622 CGGTTGGAGTGGTGGGGTGTGGG + Intergenic
1132703757 16:1232385-1232407 CCGAGAGAAGGGTGGGGAGTCGG + Intergenic
1132707761 16:1254010-1254032 CCGAGAGAAGGGTGGGGAGTCGG - Intergenic
1133197440 16:4181547-4181569 CTGATACAATGGTGGAGAGTGGG - Intergenic
1134337396 16:13313418-13313440 CTGCTATGATGGTTGGGAGTTGG - Intergenic
1134366545 16:13584343-13584365 CTGGTAGAATCATGGGAAGTTGG - Intergenic
1136922569 16:34344735-34344757 CTGTGAGGAGAGTGGGGAGTAGG + Intergenic
1136982004 16:35067071-35067093 CTGTGAGGAGAGTGGGGAGTAGG - Intergenic
1137349894 16:47704320-47704342 CTGTCAGAGGGGTGGGGAGGAGG + Intergenic
1138309297 16:56009499-56009521 CAGGGAGAATGGTGGGCAGTAGG + Intergenic
1140472215 16:75222326-75222348 TTGTTAGACTGGTGGCGAGAGGG - Intronic
1143659912 17:8318451-8318473 CTGTCAGCAAGGTGGGCAGTGGG + Exonic
1146933578 17:36795437-36795459 CTGTGAGGAGGGTGGGGAATGGG - Intergenic
1147029608 17:37621766-37621788 CTGTTACCATAGTGGGGTGTAGG - Intronic
1147205587 17:38835186-38835208 CTGTTAGAACAGAGGGAAGTGGG + Exonic
1151319313 17:73343081-73343103 CTGGAAGCAAGGTGGGGAGTGGG + Intronic
1152494388 17:80660829-80660851 CTGAGAGAAGGGTGGGGAGATGG - Intronic
1156833318 18:41522162-41522184 CAGTTAGAATGCTGGGGATAAGG - Intergenic
1158671489 18:59478092-59478114 CCCTTAGATTGGTGGGGTGTGGG - Intronic
1161614569 19:5262876-5262898 CTGTTAGTTTGGTGAGGAGAAGG + Intronic
1161793969 19:6376010-6376032 CTCTTAGAAGGGTGGGGTGTGGG - Intronic
1162614945 19:11791759-11791781 GACTTAGAAGGGTGGGGAGTGGG - Intergenic
1163369281 19:16893143-16893165 CTTTCAGAGTGGTGGGGAGGAGG - Exonic
925602078 2:5618406-5618428 CTGTTAGAATGGATGGAATTTGG - Intergenic
926501766 2:13663272-13663294 CTGCTAAAATGGTGGGGAAGGGG - Intergenic
927596411 2:24401841-24401863 CTGCTAGAAGGGTGGAGGGTGGG - Intergenic
927627467 2:24737116-24737138 CTTTCAGAGAGGTGGGGAGTGGG - Intronic
927811564 2:26183245-26183267 ATGTCAGAAGGGTGGGGAATAGG + Intronic
929431892 2:41894119-41894141 CTTGTTGAGTGGTGGGGAGTGGG - Intergenic
929483207 2:42332362-42332384 CTGTGATAATGGTTGGAAGTGGG + Exonic
931225616 2:60327128-60327150 CTGTTAGGCTTGTGGGGAGTGGG - Intergenic
932112687 2:69014698-69014720 CTGTTACAGTGGTGGGGAGATGG + Intronic
933573384 2:84039741-84039763 ATGTGAGAGTAGTGGGGAGTTGG + Intergenic
933870861 2:86563895-86563917 AAGTTAGAATGGTTGGGACTTGG - Intronic
934048361 2:88190293-88190315 CTGTGAGGATGGTTGGGAGCAGG + Intergenic
937223994 2:120357752-120357774 CTATTAGAATGGCTGGGAATGGG + Intergenic
937915343 2:127096163-127096185 CTGATAGAATGGGGAGGAGAGGG - Intronic
940517966 2:154704922-154704944 CAGATAAAATGGTGGGGAGGTGG + Intronic
942267740 2:174245464-174245486 CTTTTAGATTGGTGGCAAGTAGG - Intronic
944914067 2:204339614-204339636 CAGGTAGTATGGTGGGGAGCGGG + Intergenic
946101343 2:217327232-217327254 CAGATAGAAAGGTCGGGAGTTGG - Intronic
946832529 2:223741055-223741077 CAGTGAGATGGGTGGGGAGTGGG + Intergenic
946921615 2:224585784-224585806 CTGGTCACATGGTGGGGAGTGGG + Intergenic
947043386 2:225949666-225949688 CTGATAGAATGGTTGGGTGGGGG - Intergenic
947193398 2:227535527-227535549 CTGTTAGAATTCTTGGCAGTAGG + Intronic
948403899 2:237703380-237703402 CTGATAGAAATGTGGGGAGCAGG - Intronic
1170396970 20:15936755-15936777 CTGTTTGAATGGGAGGGAGTAGG + Intronic
1171934107 20:31257347-31257369 CTGTGAGAATGTAGGGGAGGGGG + Intergenic
1173273481 20:41557776-41557798 CTGATAGAGTGGTGGGGGATAGG - Intronic
1178074940 21:29006299-29006321 ATTCTAGAATGTTGGGGAGTGGG - Exonic
1180177327 21:46097349-46097371 CTGTGACCAGGGTGGGGAGTGGG + Intergenic
1183142950 22:35961547-35961569 CTGTGAGGTTGGTGGGGAGTTGG - Intronic
954283239 3:49599735-49599757 CTTCTAGAATGGTGGAGAGAAGG - Intronic
957551203 3:81707269-81707291 TTCTTAGAATTGTGTGGAGTTGG - Intronic
958490769 3:94769248-94769270 CTGGTAGAATGGTCTGGAGTCGG - Intergenic
961990538 3:131185299-131185321 CTGATAGAAAGATTGGGAGTAGG + Intronic
962197693 3:133378204-133378226 CTTCTAAATTGGTGGGGAGTGGG - Intronic
962601178 3:136991942-136991964 ATGTCAAAATGGTGAGGAGTGGG + Exonic
964518501 3:157539024-157539046 TTCTTAGCATGGTGGGGAGATGG - Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969995567 4:11308787-11308809 CTTCTAGAATGGTGGGTAGTTGG + Intergenic
974751932 4:66153544-66153566 CTGTTAGAATGGTGGTATGCAGG + Intergenic
975104004 4:70548226-70548248 CTTTAAGAATGTTGGGGAATTGG - Intergenic
976597707 4:86909681-86909703 CTGATAGAAGGGTGTGTAGTTGG - Intronic
977270537 4:94912354-94912376 AGGTTAGATTGGAGGGGAGTGGG + Intronic
977846316 4:101772163-101772185 CTGTTCCCATGGTGGTGAGTGGG + Intronic
978848986 4:113310358-113310380 GTGCTAGAATTTTGGGGAGTAGG + Intronic
981045485 4:140261319-140261341 CTGTTGGAGTGGTGGGGTGATGG - Intronic
982330789 4:154179734-154179756 ATGCTGGAATGGTGGGGGGTGGG - Intergenic
985894718 5:2741406-2741428 CTGTTAGAATGGAGGCAAGGAGG + Intergenic
986311861 5:6557076-6557098 TTCTTAGGATGGTGAGGAGTGGG + Intergenic
991572867 5:68074128-68074150 TTGTTATAATGGTAGGGAGAGGG - Intergenic
991955557 5:71991794-71991816 CTGTCAGAATGGAGAGGAGAAGG + Intergenic
996636010 5:125691027-125691049 CTGTTCTCATGGTGGTGAGTGGG + Intergenic
997827493 5:137119974-137119996 CTGTTAGGGAGGTGGTGAGTTGG + Intronic
998042061 5:138957030-138957052 CTGTTACTGTGGTGAGGAGTGGG - Intronic
999081233 5:148845653-148845675 CTATTAGAATGGTTTGGAGAGGG - Intergenic
999845517 5:155475307-155475329 CTGTGGGAAGGGTGTGGAGTTGG - Intergenic
999984540 5:156990730-156990752 CTGTCAGAGTGTTGGGAAGTAGG + Intergenic
1000367819 5:160507308-160507330 CTCTCAGAATGCTGGGGAGGAGG - Intergenic
1002943561 6:1739478-1739500 CTGTTTGAATGCGGGGGAGCAGG - Intronic
1006219970 6:32480663-32480685 CTGCTAGTATTGTTGGGAGTGGG - Intergenic
1006224403 6:32524434-32524456 CTGCTAGTATTGTTGGGAGTGGG - Intronic
1006229255 6:32568410-32568432 CTGTTAGTATTGTTGGGAGTGGG - Intronic
1006297871 6:33178062-33178084 CAGCTAGAAAGGTGGAGAGTTGG + Intronic
1006303497 6:33206352-33206374 CTATGAGAATGGTGGGGAGAGGG - Intronic
1006653032 6:35567083-35567105 CGGTTACACTGGTGGGGGGTGGG + Intergenic
1006833292 6:36981923-36981945 ATGTAAGAATGTTGGGGTGTGGG - Intronic
1009972562 6:70640555-70640577 CTGCTCGAATGGTGGGGAAATGG - Intergenic
1011774529 6:90714599-90714621 CTGATAGAATCCTGGAGAGTTGG + Intergenic
1012429035 6:99144862-99144884 ATGTTGGCATGGTGGGGAGATGG + Intergenic
1012638788 6:101582224-101582246 CTGTTGGCCTGTTGGGGAGTAGG - Intronic
1012665820 6:101967927-101967949 CTGTTTATATGGTGGGGGGTGGG - Intronic
1013017709 6:106176148-106176170 CTGTTAACATGGTGGAGAGAAGG - Intergenic
1014192268 6:118510585-118510607 CTGTTAGCATGGCTGGGAGTTGG + Intronic
1014742682 6:125164686-125164708 CTGCTAGTATGGTTGGGAGATGG - Intronic
1018972390 6:168538278-168538300 CTGCTGGAATGTGGGGGAGTGGG + Intronic
1018972401 6:168538308-168538330 CTGCTGGAATGTGGGGGAGTGGG + Intronic
1018972438 6:168538426-168538448 CTGCTGGAATGTGGGGGAGTGGG + Intronic
1018972454 6:168538486-168538508 CTGCTGGAATGTGGGGGAGTGGG + Intronic
1018972463 6:168538516-168538538 CTGCTGGAATGTGGGGGAGTGGG + Intronic
1018972472 6:168538546-168538568 CTGCTGGAATGTGGGGGAGTGGG + Intronic
1018972500 6:168538636-168538658 CTGCTGGAATGTGGGGGAGTGGG + Intronic
1023083650 7:36548523-36548545 CTGCTATAATGGAGTGGAGTTGG + Intronic
1024815306 7:53261889-53261911 CTTATATAATGGTGGGGATTGGG - Intergenic
1025026323 7:55519207-55519229 CTCTTCCAATGGTGGGGAGAAGG - Intronic
1028512849 7:91644239-91644261 TTGTTACAACTGTGGGGAGTGGG - Intergenic
1028585015 7:92444195-92444217 CTGTTTGGATGGTGGAGATTGGG + Intergenic
1029790886 7:102841943-102841965 CTGGTAGAATGAAGGGTAGTGGG - Intronic
1030983900 7:116218025-116218047 CTGTTAGAATGGTGGGGAGTCGG + Intronic
1033943230 7:146681489-146681511 CAGGGAGAAGGGTGGGGAGTGGG + Intronic
1037253640 8:16926224-16926246 CTGTTAGAATGTTGTGAAGGAGG + Intergenic
1038603250 8:28970419-28970441 CTGTTTGCATGGTAGCGAGTTGG - Exonic
1041468927 8:58187184-58187206 ATTTTAAAATGGTGGGGAGGGGG - Intronic
1043138858 8:76562628-76562650 CTTTTAGAATCTTGGGGTGTGGG - Intergenic
1043738339 8:83775317-83775339 ATGTTAGCATGGTGGGGGGGTGG - Intergenic
1049466931 8:142755704-142755726 CTTTTAAACTGGTGTGGAGTTGG + Intergenic
1052728108 9:32254078-32254100 ATGTTAATATGCTGGGGAGTAGG - Intergenic
1053311837 9:37025413-37025435 CTGTTGGGATGGGGGGGAGCGGG + Intronic
1054743688 9:68833511-68833533 CTGTCAGAACTGAGGGGAGTAGG + Intronic
1055429489 9:76229236-76229258 TTGTTGGTATGGTGGGGAATTGG - Intronic
1056877549 9:90349321-90349343 CTATAAGTCTGGTGGGGAGTGGG - Intergenic
1058773146 9:108258468-108258490 CTGTCAGACTGGTGGGGTGAGGG - Intergenic
1059585459 9:115601308-115601330 CTGTGAGAATGGACTGGAGTAGG + Intergenic
1060356327 9:122912484-122912506 CTGTTGTAGTGGTGGGGAGTAGG - Intronic
1061604471 9:131698579-131698601 CTGTTAGAAGGGCGGGTAGAAGG + Intronic
1061779674 9:132988245-132988267 CTTGTAGAATGGGGGTGAGTCGG - Exonic
1192424602 X:71064239-71064261 CTGGTAGAATGGAGAGGATTTGG - Intronic
1194610239 X:96034829-96034851 CTCACAGAATGGTGGGGAATAGG - Intergenic
1198194482 X:134346135-134346157 CTGTTGGAAGGTAGGGGAGTAGG - Intergenic
1198762296 X:140045037-140045059 CTGTTAGAATACTGGGGGGGGGG + Intergenic
1199238539 X:145518784-145518806 ATGTTAGTATGGTTAGGAGTTGG - Intergenic
1199433766 X:147789687-147789709 CTGAGAGAAGGGAGGGGAGTGGG - Intergenic
1201696677 Y:16834085-16834107 CTGCTAGAATGAAGGGGACTGGG + Intergenic