ID: 1030988590

View in Genome Browser
Species Human (GRCh38)
Location 7:116272123-116272145
Sequence ATGCAGAATGATCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030988590_1030988594 22 Left 1030988590 7:116272123-116272145 CCCAGCTCCAGATCATTCTGCAT No data
Right 1030988594 7:116272168-116272190 AACCCAAGCTCTTCATTTGTTGG No data
1030988590_1030988597 29 Left 1030988590 7:116272123-116272145 CCCAGCTCCAGATCATTCTGCAT No data
Right 1030988597 7:116272175-116272197 GCTCTTCATTTGTTGGCAGCTGG No data
1030988590_1030988593 -2 Left 1030988590 7:116272123-116272145 CCCAGCTCCAGATCATTCTGCAT No data
Right 1030988593 7:116272144-116272166 ATCTGTGCTTGCTCAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030988590 Original CRISPR ATGCAGAATGATCTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr