ID: 1030990927

View in Genome Browser
Species Human (GRCh38)
Location 7:116298978-116299000
Sequence TGATAGGGCTGGAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 7, 3: 60, 4: 470}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030990927 Original CRISPR TGATAGGGCTGGAGGGAAGT GGG Intronic
900417927 1:2543552-2543574 TGATGGGGCTGGAGCCCAGTGGG - Intergenic
900555440 1:3278133-3278155 TGATAGGGCTTTAGGGACCTGGG - Intronic
901638681 1:10682260-10682282 AGTGAAGGCTGGAGGGAAGTGGG + Intronic
902167296 1:14582952-14582974 TGATGGGGCTGCAGGGATGGAGG - Intergenic
902228032 1:15009075-15009097 AGCTAAGGCTGGAGGGAAGGGGG - Intronic
902372901 1:16016798-16016820 GGAGAGGGATGGAGGGATGTGGG - Intronic
902378113 1:16039744-16039766 TGGTGGTGCTGGAGGGATGTCGG - Intergenic
902383202 1:16062240-16062262 TGGTGGTGCTGGAGGGATGTCGG - Intronic
903925766 1:26829393-26829415 TGACATGCCTGGAGGGAAGACGG - Intronic
903945298 1:26959256-26959278 TTCAATGGCTGGAGGGAAGTGGG - Intronic
904155974 1:28483406-28483428 TGACTGGGCTGGAGTGCAGTGGG - Intronic
904300211 1:29549306-29549328 TGACACTGCAGGAGGGAAGTGGG - Intergenic
904692944 1:32308419-32308441 TGATAAGGCTGGATAGAAATAGG + Intronic
904856737 1:33503512-33503534 TGAAAGGGCTGCAGGGAGGTGGG - Intergenic
905204888 1:36337759-36337781 TGAGAGGGAGGGAGGGAAGGAGG + Intergenic
905538860 1:38744523-38744545 CAAAAGGGCTGGAGGGAACTAGG + Intergenic
905572550 1:39017207-39017229 TGATAGGGGTGCAAGGATGTAGG - Intergenic
905869617 1:41395553-41395575 CGGCAGGGCTGGATGGAAGTGGG + Intergenic
905872877 1:41415164-41415186 TGAGAGGCCTGGAAGGCAGTGGG - Intergenic
905961537 1:42046409-42046431 TGATGGGGATGGAAGGGAGTAGG + Intergenic
906222058 1:44088532-44088554 AGAAAGGGCTGCAGGGCAGTGGG - Intergenic
906541671 1:46591561-46591583 GGAAAGGGCTGGATGGGAGTGGG + Intronic
906928702 1:50147483-50147505 AGATAGGGCTGTGGGGAAATGGG + Intronic
906936887 1:50222092-50222114 TCATAGTGATGGGGGGAAGTTGG - Intergenic
907492858 1:54820048-54820070 AGATAGGGAGGGAGGGAAGAAGG - Intronic
907545881 1:55259466-55259488 TGATAGGGTAGGAGGGGAGGTGG + Intergenic
907866242 1:58402176-58402198 TGATACGGCTGGAGTGGAGTTGG - Intronic
908073294 1:60487548-60487570 TGATATGGATGTAGGGAAATTGG + Intergenic
908121643 1:60991525-60991547 TGGTAGAGCTGGTGAGAAGTAGG - Intronic
908542849 1:65137948-65137970 TGAGAGGGCTGAAGGGATATGGG - Intergenic
909556130 1:76956511-76956533 AGCTAGGGGAGGAGGGAAGTTGG - Intronic
909979304 1:82079515-82079537 TGAGTGGACTGGAGGAAAGTGGG - Intergenic
912382803 1:109256389-109256411 TGATGAGGCTGGAGGGTAGGTGG + Intronic
912390597 1:109300070-109300092 GGAGAGGGCTGGAGAGAAGCTGG + Intronic
913185025 1:116363058-116363080 GGATAGGGATGCAGGGAAGCTGG - Intergenic
913492815 1:119397474-119397496 TAAAAGGGCTTGAGGGAACTAGG - Intergenic
913993173 1:143634220-143634242 AGAGAGAGTTGGAGGGAAGTAGG + Intergenic
914024888 1:143903918-143903940 TGGGAGGGATGGAGGGAAGGAGG - Intergenic
914663317 1:149811638-149811660 TGGGAGGGATGGAGGGAAGGAGG - Intronic
914755438 1:150559398-150559420 TGACAGGGCTGCAGGGCAGGGGG - Exonic
915944051 1:160136886-160136908 TCATAGGTCTGGAGGGAGGGTGG - Exonic
917310078 1:173669703-173669725 GGGCAGGGCTGGAGGGGAGTGGG - Intronic
918334227 1:183491956-183491978 CGAAAGGGCTGGAGAGAATTAGG - Intronic
920526687 1:206672210-206672232 AGATAGGAGTGGAGGGAAGCGGG - Intronic
921774270 1:219078952-219078974 GGATAGGGCTAGCGGGAAGGAGG + Intergenic
921774782 1:219084403-219084425 TAATATGACTGGAGTGAAGTGGG - Intergenic
922210114 1:223479822-223479844 TGTTAAAGCTGGAGGGAAGTAGG - Intergenic
923126844 1:231040484-231040506 TGACGGGGCTGGAGGTGAGTCGG - Intergenic
1064250695 10:13704419-13704441 GGGTCTGGCTGGAGGGAAGTGGG - Intronic
1064479676 10:15726695-15726717 TGATGGGGCTGGAGGTAAGACGG + Intergenic
1065230761 10:23595916-23595938 TGATAGGGGTGGAGCCAAGACGG - Intergenic
1066593786 10:37025796-37025818 TGATAGGCCTGGAGTTGAGTTGG + Intergenic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067758844 10:49027600-49027622 GGGTCGGGCTGGAGGGAAGGTGG - Intronic
1068152882 10:53156691-53156713 TGGTGAGGCTGTAGGGAAGTAGG + Intergenic
1068726775 10:60311937-60311959 CTACAGGGCTGGAGGCAAGTAGG - Intronic
1068933888 10:62617693-62617715 TGATAGTCCTGCAGGGAAGCTGG - Intronic
1069305573 10:66964743-66964765 TGATAAGGCAGCATGGAAGTAGG + Intronic
1070311076 10:75274384-75274406 TGCTGGGGCTGGGGGGAAGGAGG - Intergenic
1070802739 10:79253073-79253095 TGACAGGGCTGGAAGGCAGTGGG + Intronic
1071603498 10:86970266-86970288 TGGTGGGGCTGGAGGGAGGCGGG + Intronic
1072528409 10:96295487-96295509 TGATGGGGGTAGGGGGAAGTAGG - Intergenic
1073051134 10:100668108-100668130 TGATGGGGCTGGGAGGAATTTGG + Intergenic
1073358837 10:102880074-102880096 TAATAGGGCTATAGAGAAGTAGG + Intronic
1073645319 10:105295717-105295739 TGTTGGGGGTGGAGGGAAGGGGG - Intergenic
1074088765 10:110227450-110227472 GGAGACGGGTGGAGGGAAGTTGG + Intronic
1074195731 10:111183120-111183142 TGAAATGGCTGGAGGAGAGTGGG + Intergenic
1074637475 10:115337473-115337495 TTAGAGGGCTGGAGGGCAGGGGG - Intronic
1075448126 10:122527974-122527996 TGCTAAGACTGGAGGGAATTTGG + Intergenic
1075727464 10:124617926-124617948 GGAAAGGGCTGGAAGGAAGAAGG - Exonic
1075881854 10:125859352-125859374 TGAGCCTGCTGGAGGGAAGTTGG + Intronic
1077348777 11:2079466-2079488 TGATCGGGCAGGAGGGAGGGAGG - Intergenic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077478898 11:2803767-2803789 TGAGAGGGGAGGAGGGAAGTGGG - Intronic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1079345411 11:19647451-19647473 TGTTGGTGCTGGAGGGAGGTGGG - Intronic
1079394602 11:20050885-20050907 AGTTAGGGGTGCAGGGAAGTGGG + Intronic
1079502891 11:21121582-21121604 TGATAGAGCCTGATGGAAGTGGG + Intronic
1080606018 11:33865317-33865339 GGTTAGGGCTGGAGGGAGGATGG - Intronic
1080916381 11:36664667-36664689 TGATAGGGATGGAGGCTTGTGGG - Intergenic
1081651802 11:44828799-44828821 TGAGAGGGCTGGAGTGAAGCAGG - Intronic
1081882121 11:46462574-46462596 TGATGGGTCTGGAGAGCAGTGGG - Intronic
1081983422 11:47284496-47284518 TGCTAGAGCTGGAGCGCAGTGGG - Exonic
1081991377 11:47339409-47339431 GAACAGGGCAGGAGGGAAGTAGG + Intronic
1082835980 11:57650194-57650216 TGGCAGGGCTGGAGGAAAGGAGG + Intronic
1083346733 11:61998724-61998746 TAAAAGTGCTGGAGGGAAGTGGG - Intergenic
1083729141 11:64643531-64643553 TGAGAGGGCTGGAAGGGAGAGGG + Intronic
1083787205 11:64957980-64958002 TGCTTGGGCTGGAGTGCAGTGGG + Intronic
1083864053 11:65444143-65444165 TGATGGGGCTTGAGCAAAGTGGG + Intergenic
1084576108 11:69988966-69988988 AGACAGGGAAGGAGGGAAGTAGG + Intergenic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1084904400 11:72334730-72334752 TGAAAGGGCTGGATGGAGGTGGG + Intronic
1085326284 11:75609165-75609187 TTATAGGGCTGGAGAGTAGATGG + Intronic
1085444191 11:76589724-76589746 TAACAGGGCAGGAGGGCAGTGGG + Intergenic
1085498916 11:76999604-76999626 AGGTGGGGCAGGAGGGAAGTAGG - Intronic
1085894522 11:80622525-80622547 TGATAGGCCTGGAGTTGAGTTGG - Intergenic
1085998209 11:81947968-81947990 TGAGAGGGAGGGAGGGAAGCGGG + Intergenic
1087857470 11:103109549-103109571 TGGAAGGGGTGGAGGGAAGTTGG - Intronic
1087970217 11:104471763-104471785 TGCCAGGGCTTGAGGGAAGGAGG + Intergenic
1088066312 11:105724631-105724653 TGAAAGGGTTGGGGGGCAGTAGG + Intronic
1088079653 11:105895608-105895630 TGAGAGGGATGGAGGGAGGGAGG + Intronic
1088416120 11:109590819-109590841 AGATAGGGATAGAGGTAAGTGGG + Intergenic
1088811564 11:113396009-113396031 AGGTAGGGCTGGAGGGGAGCTGG - Intronic
1088907832 11:114168255-114168277 TCCTGGGGCTGGAGGGAAGCAGG - Intronic
1088921128 11:114260499-114260521 TGTGAGTGCTGGAGGGAAGTGGG - Intronic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1090362204 11:126181565-126181587 TCCTAGGGCTGGAGAGAATTGGG + Intergenic
1091228157 11:133970580-133970602 TGGTAGGGTAGGAGAGAAGTGGG - Intergenic
1091700262 12:2654334-2654356 TGAGAGGGAGGGAGGGAAGAAGG + Intronic
1093370874 12:18363651-18363673 TGAAAGAGCTGAGGGGAAGTAGG - Intronic
1093541908 12:20297830-20297852 TGAGAGGGAGGGAGGGAAGGAGG - Intergenic
1094009552 12:25792826-25792848 TGATAGGGTTGGAGAGAAGTGGG + Intergenic
1094360413 12:29624517-29624539 TGAGATGGCTGGAGCCAAGTGGG - Intronic
1095829647 12:46570308-46570330 GGAGAGTGCTGGAGGGCAGTGGG - Intergenic
1095832844 12:46605505-46605527 AGATAGAGCTTGAGGCAAGTCGG - Intergenic
1096048180 12:48582764-48582786 TGAAAGGGGTGGAGGGAATCTGG - Intergenic
1096087737 12:48877413-48877435 TGATAGAGCTGGAGGGGTCTTGG - Intergenic
1096331646 12:50718418-50718440 GGATTGGGGTGGAGGGAAGGAGG - Intronic
1096334806 12:50745957-50745979 TGATAGGCCAGGAAGGCAGTGGG + Exonic
1096742348 12:53703017-53703039 TGATAGGGATGGGGAGAAGAGGG + Intergenic
1097663617 12:62456346-62456368 TTATAGGTCTGGGGAGAAGTGGG - Intergenic
1097904062 12:64902236-64902258 AGAGAGGGAGGGAGGGAAGTAGG - Intergenic
1097955391 12:65480315-65480337 TAAAAGGGTTGGAGGGAACTAGG - Intronic
1099109112 12:78534954-78534976 TGATAGAGCTGGAAAGAAGGCGG - Intergenic
1100617627 12:96243278-96243300 TGAGAGGGGTGGAAGGAAGGAGG - Intronic
1101861802 12:108488522-108488544 TGATGGGGCTGCAGGGAAAAGGG + Intergenic
1102026813 12:109718383-109718405 AGAGGGGGCTGGAGGGAGGTTGG - Intronic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102696594 12:114804487-114804509 GCCTAGGGCTGGAGGGAAGAGGG - Intergenic
1103710615 12:122909917-122909939 TGAGAGGGCAGGAGGGAAGAGGG - Intergenic
1104278717 12:127354140-127354162 TGGTGGAGGTGGAGGGAAGTGGG + Intergenic
1104772874 12:131375161-131375183 AGAGAGGGATGGAGGGAAGATGG + Intergenic
1105623827 13:22093997-22094019 GGATGGTGCTGGAGGGAAGGTGG + Intergenic
1107102082 13:36604485-36604507 TGATGGGGCTGGAGGGGACTGGG - Intergenic
1107622002 13:42243170-42243192 TGTGAGGGCAAGAGGGAAGTAGG - Intronic
1108432557 13:50368693-50368715 TGGTATGGCTGGAGGCCAGTTGG - Intronic
1108703537 13:52964360-52964382 TGATAGGGTTGGAAGCAAGTGGG + Intergenic
1110385434 13:74905479-74905501 TGCCAGAGCTGGAGGGAAGGAGG + Intergenic
1111900768 13:94197111-94197133 TGCTAGGACTGTAGGGAAGATGG + Intronic
1112115512 13:96347813-96347835 TGAAAGGGGTGGAGTGAAGAGGG - Intronic
1112129288 13:96503654-96503676 TGACAGGGGTGGAGGGAGTTTGG + Intronic
1112206824 13:97332520-97332542 TGACAGGGCTGGAGGGACCCTGG + Intronic
1112324483 13:98434259-98434281 TGGCAGGGCTGGGGGGTAGTGGG - Intronic
1112788094 13:102973751-102973773 AAATACAGCTGGAGGGAAGTTGG - Intergenic
1113151542 13:107269283-107269305 TGATGTGGCTGGAGGAAAATGGG + Intronic
1114711309 14:24781171-24781193 TGATGGTGCAGGAGGGAAGTGGG + Intergenic
1114796866 14:25725783-25725805 GGATGGGGCTGGAGGGTTGTGGG + Intergenic
1115831775 14:37350708-37350730 GTTGAGGGCTGGAGGGAAGTGGG - Intronic
1116912187 14:50480435-50480457 TGATATGGTCGGAGGGGAGTGGG - Intronic
1117012777 14:51487858-51487880 TGATAGGTATAGAGGGAAGTAGG + Intergenic
1117594654 14:57314040-57314062 TGATAGGTTTGGGGGGAAATTGG - Intergenic
1117954240 14:61110555-61110577 TGGTGGGGCTGAAGCGAAGTTGG - Intergenic
1119151292 14:72361949-72361971 TAAGAGGGCTGCAGGGAAGCAGG + Intronic
1119188380 14:72661306-72661328 TGAAAGGACTGGCAGGAAGTCGG + Exonic
1119431205 14:74569141-74569163 AGATAGAGATGGAGGGAAGGAGG + Intronic
1121039076 14:90730242-90730264 AGATAGGGTTTGAAGGAAGTAGG - Intronic
1121405602 14:93717611-93717633 TGATGGGCCAGGAGGGATGTAGG - Intergenic
1121843621 14:97154867-97154889 AGGTGGGGCTGGAAGGAAGTGGG + Intergenic
1122260123 14:100513308-100513330 TAAAAGGGCTGGAGGGAACAAGG + Intronic
1122267765 14:100554648-100554670 GGACAGGGCTGGTGGGGAGTGGG - Intronic
1122609208 14:102969707-102969729 TGGTGGGGCTGGAGGGTAGCAGG - Intronic
1124856132 15:33391129-33391151 TGGTGGGGCTGGAGGGATGAGGG - Intronic
1125328694 15:38562717-38562739 TGCTAGGGGTGGAGGGGAGGTGG + Intronic
1125841503 15:42805608-42805630 TAATAGAGATGGAGGGAAATGGG - Intronic
1127110907 15:55669396-55669418 TGATGTGTCTGGAGGGCAGTAGG - Intronic
1127362685 15:58258991-58259013 TGAAAGGGCTGGAGGGAACTAGG - Intronic
1128427381 15:67555623-67555645 TGATGGGGTTGGAGGGAAATGGG - Intronic
1128452883 15:67817072-67817094 GCCTAGGGCTGGAGGGAAGTAGG + Intergenic
1128611741 15:69079359-69079381 TGAGAGGTCTGGAGGGAAGAGGG + Intergenic
1128706504 15:69840970-69840992 TGTTAGAGCTGGAAGGAAGCTGG - Intergenic
1128739638 15:70074600-70074622 TGCTGGTGCTGGAGGGAAGAGGG + Exonic
1129393263 15:75231143-75231165 GGTTAGGGCAGGAGGGAAGGTGG - Intergenic
1129519779 15:76178319-76178341 AGAGGGGGCTGCAGGGAAGTGGG + Intronic
1129935856 15:79449803-79449825 TGGTAGGGATGGAGAGAAGGAGG - Intronic
1130074683 15:80678604-80678626 GGATTGGGCAGAAGGGAAGTTGG - Intergenic
1130079730 15:80722059-80722081 TAACAGGGCTGCAGGGAAGATGG - Intronic
1130833645 15:87628586-87628608 GGAAAGGTCTGGAGGGAAGAGGG - Intergenic
1131330630 15:91496012-91496034 AGAGAGGGATGGAGGGAAGGAGG - Intergenic
1132263916 15:100449389-100449411 TGATGGGGCAGGAGGTAGGTTGG - Intronic
1132372226 15:101307008-101307030 TGAGAGGCCTAGAGGGAAGCTGG + Intronic
1133024226 16:2980685-2980707 TGCGAGGCCTGGAGGGCAGTGGG - Intergenic
1133657390 16:7879039-7879061 TGGTAGGCTTTGAGGGAAGTGGG + Intergenic
1134640346 16:15824934-15824956 TTACACAGCTGGAGGGAAGTTGG + Intronic
1134846682 16:17446659-17446681 TGATCAGGCTGGAAGGAGGTAGG + Intronic
1134890494 16:17837488-17837510 TACGAGGGCTGGAGGGGAGTCGG - Intergenic
1135602799 16:23797499-23797521 TGAAAGGGAAGGAGGGAAGCTGG + Intergenic
1135879961 16:26245562-26245584 TGAGAGGTTTGGAGGGAGGTGGG + Intergenic
1136248452 16:28988667-28988689 CTAGAGGGCTGGAGGGCAGTGGG - Intronic
1137484718 16:48881688-48881710 TAATAGGGCAGGAGTGGAGTTGG - Intergenic
1137765825 16:50976914-50976936 TGCTATGGCTGGTGGGAAGTGGG + Intergenic
1139218527 16:65154369-65154391 AGAAAAGGCTGGAGGGAAGGAGG - Intergenic
1139314262 16:66055087-66055109 TGATACGGCTGGAGAGCACTTGG + Intergenic
1139582223 16:67880442-67880464 AGACAGGGCAGCAGGGAAGTGGG - Intronic
1139627797 16:68205286-68205308 TGATCAGGCTGGAGTGCAGTGGG + Intronic
1139724062 16:68881816-68881838 TGTTATGGCTAGATGGAAGTAGG + Intronic
1140015165 16:71175420-71175442 TGGTAGTGCTGGAGGGTGGTGGG - Intronic
1141256887 16:82410841-82410863 TGAAAGAGGTGGAGAGAAGTGGG - Intergenic
1141517304 16:84554162-84554184 TGAAAGCCCTGGAAGGAAGTGGG + Intergenic
1141833363 16:86522232-86522254 GGAACGGGATGGAGGGAAGTGGG + Intergenic
1142641259 17:1287123-1287145 TGAGAGGGTGAGAGGGAAGTTGG + Intronic
1143155751 17:4834883-4834905 GGATATGGCTGGAGGGGAGAGGG + Intronic
1144444481 17:15314453-15314475 TCATAGGGTGGGATGGAAGTGGG + Intronic
1144761859 17:17711520-17711542 GGATGGAGCTGGAGGGAAGTGGG + Intronic
1145090324 17:19980451-19980473 GGATGGGGCGGGAGGGACGTAGG + Intergenic
1145194391 17:20876504-20876526 TAGAAGGGCTGGAGGGAATTAGG + Intronic
1145297647 17:21604559-21604581 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1146113449 17:30112576-30112598 TGACAGGCCTTGAAGGAAGTTGG + Intergenic
1146466563 17:33090956-33090978 TGACTGTACTGGAGGGAAGTGGG - Intronic
1146521548 17:33529260-33529282 TGATTGGACTGGAGTGAAGTGGG - Intronic
1146554821 17:33814212-33814234 TGATAGGGCTGCAGGAATTTAGG - Intronic
1146556205 17:33826507-33826529 TCACAGGGCTGGAGGAACGTTGG + Intronic
1146747679 17:35346494-35346516 GGAAAGGGCGGGAGGGAAATCGG - Intergenic
1147376302 17:40024107-40024129 TGGTAGGGCGGGGGGGAAGGTGG + Intronic
1147446985 17:40480491-40480513 TGAGAGGCCAGCAGGGAAGTGGG - Intronic
1148323010 17:46768882-46768904 AGAGAAGGCTGGAGGGAAGGGGG - Intronic
1148441760 17:47715150-47715172 TGTTTGGGGTTGAGGGAAGTGGG - Intergenic
1148781671 17:50125678-50125700 TGATGGGGGTGTAGGGAAGGGGG - Intronic
1149555699 17:57571914-57571936 TGAGAGGACATGAGGGAAGTGGG - Intronic
1151150553 17:72082098-72082120 TGAGAGAGATGGAGGGAAGAGGG - Intergenic
1151400524 17:73852921-73852943 TGATAGGTCTGGGTGGCAGTGGG - Intergenic
1151426253 17:74032799-74032821 TGGTTGAACTGGAGGGAAGTCGG - Intergenic
1151708810 17:75787946-75787968 TTATGGGGGTGGAGGGAAGCAGG - Intronic
1152205664 17:78973226-78973248 AGAAGGGGCGGGAGGGAAGTGGG + Intronic
1152542291 17:80982369-80982391 TCCTAGGGCTGGAGGGCCGTTGG - Intergenic
1153322093 18:3783613-3783635 GGGGAGGGCTGGAGGGAAATGGG + Intronic
1153723842 18:7936096-7936118 TCATGGGGCTGGCGGGAACTGGG + Intronic
1155059801 18:22218582-22218604 TGATAGGGTGTTAGGGAAGTAGG - Intergenic
1155142452 18:23055315-23055337 GGAAAGGGGTGGAGGGATGTAGG - Intergenic
1155376124 18:25159690-25159712 TGATAGGGCTGGACAGAATAAGG + Intronic
1155832484 18:30535142-30535164 TGAAAGGGATGAAGGGAAGCTGG + Intergenic
1155933563 18:31731217-31731239 TGACAGAGCTGGAGGGTAGGAGG - Intergenic
1156481072 18:37436751-37436773 GGCTGGGGCTAGAGGGAAGTCGG + Intronic
1156504749 18:37582717-37582739 TGATGGGGATGGAGGGAAAATGG - Intergenic
1156918432 18:42488977-42488999 CAATAGGGCTGGAGAGGAGTAGG - Intergenic
1157328446 18:46686013-46686035 GGATGGGGCTGGAGAGAAGAAGG + Intronic
1157495995 18:48157960-48157982 GAATAGGGCTTGAGGGAGGTGGG + Intronic
1158170839 18:54597475-54597497 TGTGAGGGCAGGAGGGATGTGGG + Intronic
1158836813 18:61339482-61339504 TGGGAAGGCTGGAAGGAAGTTGG - Intronic
1158900487 18:61957613-61957635 TGACAGGCCTGGAGGGAAGTGGG + Intergenic
1159056968 18:63475959-63475981 TGATTCGGCTGGAAGGGAGTAGG + Intergenic
1159061287 18:63517491-63517513 AGATGGGGCTGGAGTGCAGTGGG + Intergenic
1160015645 18:75138361-75138383 TGAAAGGGCTGGAGTGAGTTTGG - Intergenic
1160015655 18:75138432-75138454 TGAAAGGGCTGGAGGGAGTTTGG - Intergenic
1160609915 18:80076927-80076949 TGAAAGGGCTGGCGGGAACTAGG - Intronic
1160841106 19:1147413-1147435 TGAACGGGCTGGAGGGAGATGGG + Exonic
1161929889 19:7332094-7332116 TCATAGGACAGGAGGGAGGTGGG + Intergenic
1162145708 19:8611197-8611219 TGAGTGGGGTGGGGGGAAGTGGG + Intergenic
1162218731 19:9158126-9158148 TGACTGGGGTGGAGGGAGGTAGG + Intronic
1163463787 19:17454949-17454971 AGAGAGGGCTGGATGGAAGTCGG - Intronic
1164627154 19:29737335-29737357 TCAGAGGGCTGCAGGGAACTGGG + Intergenic
1164743525 19:30594482-30594504 AGCTAGTGCTGGAGGGAGGTAGG - Intronic
1164900807 19:31920652-31920674 TGATAGGGGGTGAGGGATGTGGG - Intergenic
1165104487 19:33460883-33460905 GGATGGGGGTGGAGGGAAGGTGG + Intronic
1165749693 19:38252385-38252407 GGAAGGGGCTGGAGGGGAGTAGG - Intronic
1166141236 19:40806531-40806553 TGGCAGGGATGGAGGGAGGTAGG - Intronic
1166344086 19:42154666-42154688 AGATAGTGGTGGAGGGGAGTTGG + Intronic
1167463043 19:49636307-49636329 TGCTGGGGCTGGTGGGAGGTTGG + Intronic
1167715594 19:51141239-51141261 TGACTGGGCTGGGAGGAAGTGGG - Intergenic
1168268975 19:55239518-55239540 GGTTAGGGCTGGAGGGAGTTGGG + Intronic
1168425948 19:56238875-56238897 GGAGAGGACTGGAGGGAATTGGG + Intronic
926038074 2:9650454-9650476 TGTTAGGTTTGGAGGGAACTTGG - Intergenic
926685350 2:15693732-15693754 TGCTAGGGGTTGAGGGAAGGAGG + Intronic
927278213 2:21279648-21279670 TGCTGGGGCTGGAGGGAGGGCGG + Intergenic
928336501 2:30402869-30402891 TCATAAGGCTGGTGGGAAGTAGG + Intergenic
930148394 2:48031760-48031782 GGATGGGGCAGGAGGGAAGGGGG - Intergenic
930218353 2:48720342-48720364 TGATGGGAGTGGAGTGAAGTAGG - Intronic
931424668 2:62159754-62159776 GGTAAGGGCAGGAGGGAAGTGGG + Intergenic
931719260 2:65055719-65055741 TGATGGAGTCGGAGGGAAGTGGG - Intergenic
932410771 2:71546183-71546205 TGAGGGGGCTGCAGGCAAGTCGG - Intronic
932688795 2:73895053-73895075 TGATAGGTTGGGAGGGAAGAGGG + Intronic
933477920 2:82816456-82816478 CGATAGTGCTGGAGTGGAGTAGG - Intergenic
933480748 2:82854133-82854155 AGACAAGGCTGGAGGGAAGCAGG - Intergenic
934120407 2:88832572-88832594 TGAAGGGGCTTGAGGCAAGTAGG - Intergenic
934650634 2:96089553-96089575 TGAAAGGACTGGAGGGGAGCTGG - Intergenic
934942168 2:98510593-98510615 TGAAAGGGCTGGAGGGAACTAGG - Intronic
935897124 2:107749520-107749542 TGATAGGGCAGGATGGCAATGGG - Intergenic
935943987 2:108269684-108269706 TGGTAGGGTTTGAAGGAAGTTGG - Intergenic
937223153 2:120353542-120353564 AGGGAGGGCTGGAGGGAAGAAGG - Intergenic
937642992 2:124235028-124235050 AGATAGGGCCTGAGGGAAGCAGG + Intronic
938939901 2:136161054-136161076 TGATTGGCGTGGAGGGAAGATGG + Intergenic
940668587 2:156639686-156639708 TAATTGGGGAGGAGGGAAGTGGG - Intergenic
941099995 2:161284863-161284885 TGAAAGGAGTGGAGAGAAGTGGG + Intergenic
941114323 2:161454277-161454299 TGGGAGGGATGGAGGGAAGAAGG - Intronic
943389772 2:187250783-187250805 TTATAGAGCTAGATGGAAGTTGG - Intergenic
943581340 2:189687102-189687124 TGGTGGGGCAGGAGGGAAGTGGG - Intronic
943668134 2:190632146-190632168 TGCTAGGTCTAGAGGGAAGTGGG + Intergenic
944261618 2:197684196-197684218 TGAGAAGGGTAGAGGGAAGTGGG + Intergenic
944941607 2:204634115-204634137 AGCTAGGGCAGGAGGGAGGTGGG - Intronic
946194788 2:218026654-218026676 GAAAAGGGCTGGAGGGAGGTAGG - Intergenic
947234988 2:227931839-227931861 TGATAGGGCAGGAGGAAGCTCGG - Intergenic
948297815 2:236875992-236876014 TCAGAGGGCTGCAGGGAAGTGGG + Intergenic
948741034 2:240046121-240046143 GGAAAGGGCTGCAGGGAAGCTGG + Intergenic
948790752 2:240375530-240375552 TGATGAGGCTGGAGAGAAATGGG - Intergenic
948793113 2:240389235-240389257 TGATAGGGCTCCAGGGAGGTGGG - Intergenic
1169248974 20:4045946-4045968 AGAAAGGGATGGAGGGAAGCAGG - Intergenic
1169506727 20:6219626-6219648 TGACAGGGAGGGAGGGAAGGGGG + Intergenic
1169545413 20:6645243-6645265 AGAGAGGGAGGGAGGGAAGTGGG - Intergenic
1169639852 20:7739622-7739644 TAAAAGGGCTAGAGGGAACTGGG - Intergenic
1169666505 20:8042499-8042521 TGATAAGGCTGTGGGGAAATGGG + Intergenic
1170007048 20:11680776-11680798 AGATAGGGAGGGAGGTAAGTCGG + Intergenic
1170106886 20:12761094-12761116 TAATAAGACTGGAGGGATGTAGG + Intergenic
1170438063 20:16350526-16350548 TGAGAAGGCGGGAGGGAAGGTGG + Intronic
1170510464 20:17071161-17071183 TGGTAAGGCTAGAGGGATGTGGG + Intergenic
1170614643 20:17938875-17938897 TGATGTGTCTGGAAGGAAGTTGG - Intergenic
1171498099 20:25571479-25571501 TGACAGGGCTGCAGGGAGGAAGG + Intronic
1171562925 20:26144159-26144181 TAGAAGGGCTGGAGGGAATTAGG + Intergenic
1171959941 20:31486025-31486047 TGAGAGGGCGGGAGGGAAGTGGG + Intergenic
1173417499 20:42869913-42869935 TAAAAGAGCTGGAGGGAACTAGG + Intronic
1173497362 20:43529215-43529237 GGATAAGGCTGGATGGAAGCTGG + Intronic
1174343745 20:49914927-49914949 TGCTAGGGCTGGAGTGGAGATGG - Intronic
1174391833 20:50222522-50222544 TGAAAGGGCTGGAGTGATGGTGG - Intergenic
1174618456 20:51855122-51855144 GGTTAGGCCTGGAGGGAAGTGGG - Intergenic
1174767432 20:53267196-53267218 GGATAGGCCTCGAGGGAAGATGG + Intronic
1174792450 20:53492790-53492812 AGAAAGGGCAGGGGGGAAGTGGG + Exonic
1175277031 20:57779181-57779203 AGAAAGGGCTGGAGGCAACTTGG + Intergenic
1177562831 21:22778902-22778924 TGAAAGGGCTGGAGGAAATTAGG - Intergenic
1178503588 21:33145435-33145457 TGGAAGGGCTGGAGGGGAGAGGG + Intergenic
1178868170 21:36347887-36347909 GGATAAGGCTGGAAGGAAGATGG + Intronic
1180649775 22:17368865-17368887 TGATTGAGCTGGAACGAAGTAGG - Intronic
1181036363 22:20171632-20171654 AGGGAGGGCTGGAGGGGAGTGGG + Intergenic
1181588782 22:23869926-23869948 TAAAAGGGCTGGAGGGAACTAGG - Intronic
1181954811 22:26580454-26580476 TGAGAGGGCTGGAGGGGGCTGGG - Intronic
1182049984 22:27305276-27305298 AGTCAGGGCTGGGGGGAAGTTGG - Intergenic
1182738583 22:32548998-32549020 GGATGGAGCTGGAGGGATGTTGG + Intronic
1183002839 22:34875921-34875943 TGATGAGGATGGAGGGAAGGGGG + Intergenic
1183248352 22:36711005-36711027 TGATTTGGCTGGAGGGAGGAAGG - Intergenic
1183352891 22:37343759-37343781 AGATAGGGCTGGAGGGACTGAGG - Intergenic
1183933837 22:41250543-41250565 TGATAGGGCTGGAGGGATATGGG + Intronic
1183943189 22:41308214-41308236 TGTGAGGGCTGCAGGGAAGGTGG + Intronic
1184544947 22:45161538-45161560 TTATAGGGCAGGAGGGGAATGGG - Intergenic
1184649979 22:45915268-45915290 TGATGAGGCTGTAGGGGAGTGGG - Intergenic
1185007662 22:48291927-48291949 TGATAGGAATGGAGGTAAATTGG - Intergenic
949298810 3:2559380-2559402 TTACAGGTCTAGAGGGAAGTAGG + Intronic
949649924 3:6145502-6145524 GGGTGGGGCAGGAGGGAAGTAGG - Intergenic
950358670 3:12434428-12434450 TGAGAGGGATGGAGGGAGGGAGG - Intergenic
950521733 3:13501599-13501621 TCATAGGTCAGGAGGTAAGTGGG - Intronic
950823385 3:15787549-15787571 AGATAGGGATGGAGGGTTGTGGG + Intronic
951752928 3:26057152-26057174 TGATTGGGAAGGAGTGAAGTGGG - Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952382437 3:32816096-32816118 TAATGGGGCTGGGGGGAAGCAGG - Intergenic
952885179 3:38007643-38007665 TGTTAGGGCTGAAGGCAATTTGG + Exonic
953477651 3:43219301-43219323 TTATAGGGCTGGAGTAGAGTAGG + Intergenic
953928476 3:46994309-46994331 TGACAGTGCTGGTGGGCAGTGGG - Intronic
953930952 3:47005409-47005431 TGCTGTGGCTGGAGGGAAGAAGG - Intronic
954421669 3:50422143-50422165 AGCTAGGGCTGCAGGGATGTCGG - Intronic
954423750 3:50432483-50432505 TGAGGGGTCTGGAAGGAAGTGGG + Intronic
954618546 3:51983118-51983140 GGATAGGGCGGGAGGAAAGGGGG - Intronic
955058314 3:55474886-55474908 AGGTAGGGCTGGGGGGAGGTTGG + Intronic
957800536 3:85074152-85074174 TAATGTGGCTGGAGAGAAGTGGG - Intronic
958941894 3:100326076-100326098 GGTAAGGGCTGGAGGGAAGAGGG - Intergenic
959211407 3:103387848-103387870 TGATAGGCATGCAGGTAAGTGGG - Intergenic
959849333 3:111070214-111070236 GGAAAGGGCTGGAGGGAAAAAGG + Intronic
959893887 3:111585500-111585522 TAATAGGGATGAAGGGAAGCTGG + Intronic
960046969 3:113208468-113208490 TGAAAGGGGAGGAGGGAATTAGG + Intergenic
961806871 3:129495848-129495870 TGACAGGGCTGGATGGCTGTGGG + Intronic
962087645 3:132208720-132208742 AGATAGGGTTGGGGTGAAGTAGG - Intronic
962630356 3:137269560-137269582 TGATGGGGGTGGAGGGAGGCAGG + Intergenic
964408413 3:156373951-156373973 TGAAAGATCTGGAGGGAAGCAGG + Intronic
965685895 3:171302099-171302121 TAAAAGGGGTGGAGGGGAGTGGG + Intronic
966097394 3:176220609-176220631 TGAAAGGGAGGGAAGGAAGTGGG + Intergenic
967889757 3:194356772-194356794 GGCCAGGGCTGGAGGGAGGTGGG - Intronic
968087074 3:195878650-195878672 TGGATGGGCTGGAGGGAAGGCGG - Intronic
968603981 4:1522872-1522894 TGCTAGGGATGGAGGGCAGATGG - Intergenic
969905495 4:10390712-10390734 TGATAAGGGTGTAGGGAAATAGG - Intergenic
970211640 4:13716046-13716068 TTATAGAGCTGGTGGGAAGATGG + Intergenic
970403433 4:15739867-15739889 AGAAAGGGAGGGAGGGAAGTCGG + Intergenic
971714310 4:30155583-30155605 TGAAAGTGTTGGAGGGAACTAGG - Intergenic
972053479 4:34770186-34770208 GGATAGGGCTCAAGGGAATTAGG - Intergenic
973304729 4:48633145-48633167 TCTTTGGGCTGGAAGGAAGTGGG - Intronic
974095496 4:57359467-57359489 AGAGAGGGATGGAGGGAAGTTGG + Intergenic
975331750 4:73123788-73123810 TGCTATGACTGGGGGGAAGTGGG + Intronic
976519229 4:86006921-86006943 TGAGAGGGCTGCAGGGAAGATGG - Intergenic
977021641 4:91767634-91767656 TGTCAGGGCTGGAGGGAGGTGGG - Intergenic
978588833 4:110302286-110302308 TCTTAGGGCTGGAGGCAAGGAGG - Intergenic
978827868 4:113046512-113046534 TAAAAGGGGTGGAGGGAACTAGG + Intronic
980030210 4:127819636-127819658 GGAGAGGGCTGAAGGGAAATGGG - Intronic
982201271 4:152963308-152963330 CTATAGGGCTGAAGGGAAGTGGG + Intronic
984033023 4:174628584-174628606 TGATAGAGTTGGAGGGAATTTGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985069408 4:186153182-186153204 TGATAGAAATGGAGGGAAGGTGG + Intronic
985817114 5:2135321-2135343 AGATAGTGCTGGAGGGAAGGGGG + Intergenic
986694371 5:10338980-10339002 GGGAAGGGCAGGAGGGAAGTTGG + Intergenic
988186311 5:27867884-27867906 AGAAAGGGAAGGAGGGAAGTGGG + Intergenic
988469672 5:31526638-31526660 TGATTGGGCAGGGGGGAAGAGGG + Exonic
989463598 5:41728805-41728827 AGGCACGGCTGGAGGGAAGTTGG + Intergenic
990474811 5:56152054-56152076 TTATAGGGTTGGAGGAGAGTGGG + Intronic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
992303424 5:75408896-75408918 GGACAGGGGTGGAGGGAAGAGGG - Intronic
992408371 5:76481022-76481044 TAAAAGGGCTGGAGGGAACTAGG - Intronic
993616529 5:90118929-90118951 TGATGGGGCTGGGTGGATGTGGG + Intergenic
994718221 5:103349168-103349190 TGAAAGGGTTTGAGGGAAGGGGG + Intergenic
995913133 5:117212039-117212061 TGATAGGGATGGGGAGAATTGGG - Intergenic
996191392 5:120547077-120547099 TCATGGTGCTGGAGGGAAGTGGG + Intronic
997750090 5:136336007-136336029 AGATGTGGCAGGAGGGAAGTTGG - Intronic
997977668 5:138449786-138449808 TGCTTGGCCTGGAGGGAGGTAGG + Intergenic
998449094 5:142220672-142220694 GAATTGGGCTGTAGGGAAGTCGG - Intergenic
998449377 5:142222567-142222589 TGATGGAGCTGGTGGGGAGTGGG + Intergenic
998636260 5:143958268-143958290 TGATGGGGTTGGAGAGAAGGGGG + Intergenic
999422900 5:151460114-151460136 TGATAAGGTTGGAGGAAAGAGGG - Intronic
1000821969 5:165996011-165996033 TGATGGGGTTGGGGGGAAGGAGG + Intergenic
1001708921 5:173762378-173762400 AGATAAGGTTGGAGAGAAGTGGG + Intergenic
1001896229 5:175383845-175383867 TGTTAGTGCTGGATGGAGGTGGG - Intergenic
1002708779 5:181181406-181181428 TGCTAAGGCTGGAGAGCAGTGGG + Intergenic
1002846369 6:948689-948711 TGGTGGTGCTGGAGGGAATTAGG + Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003773312 6:9331984-9332006 TGATAGAGCTGGGGGGAAATTGG + Intergenic
1004624357 6:17360845-17360867 AGACAGGGAGGGAGGGAAGTGGG + Intergenic
1006606312 6:35259932-35259954 TGCTAGGGCCGGAGGGAGGTGGG - Intronic
1006785938 6:36667339-36667361 TTTCAGGGCTGCAGGGAAGTGGG + Intergenic
1007022588 6:38536825-38536847 TGCTGGGGGTGGAGGAAAGTGGG + Intronic
1007247368 6:40472192-40472214 TGAAGGGGCTGGAGGGAAGGTGG - Intronic
1009333710 6:62458579-62458601 TGCCAGGGCTGGAGTGCAGTAGG + Intergenic
1009686403 6:66963194-66963216 TAAAAGGGCTGAAGGGAACTAGG + Intergenic
1009935978 6:70234893-70234915 TGAGAGGGCCTGAGGGAAGTCGG - Exonic
1010263452 6:73842211-73842233 TCATGGGGATGGGGGGAAGTGGG - Intergenic
1011007277 6:82660266-82660288 TGATAGTGGTAGAGGGAAGCAGG + Intergenic
1011764881 6:90610359-90610381 TGCGAGGGCTGGAGGAACGTCGG - Intergenic
1012083183 6:94785887-94785909 GGATAGGGCTCGAGGCAAGATGG - Intergenic
1012469588 6:99556259-99556281 TGGTAGGGCTGGAGGAAGGGTGG - Intronic
1013184926 6:107749248-107749270 TGACTGGGTTGGAGGGTAGTGGG + Intronic
1013299351 6:108789199-108789221 TGGTTGGGTTGGAGGGAAATTGG - Intergenic
1013954027 6:115819600-115819622 TCATAGGGAGGGACGGAAGTGGG - Intergenic
1016181503 6:141153264-141153286 AGACAGGGCTGCAGGGAAGGGGG + Intergenic
1017009267 6:150052372-150052394 TCATTGAGCTGGAGGGAAGCTGG - Intergenic
1017069408 6:150560778-150560800 TGACAGGGCTCTAGGGAATTTGG - Intergenic
1017729743 6:157304940-157304962 TGGCAGGGCTGGAGTGCAGTGGG + Intronic
1017816694 6:158021538-158021560 TGGGAGGGCTGGAGGGAGGAGGG + Intronic
1017992298 6:159502012-159502034 TGATGGGTCTGCAGAGAAGTGGG - Intergenic
1019154639 6:170030953-170030975 TGACTGGGGTGGAGGGATGTGGG + Intergenic
1021209754 7:17834043-17834065 TGATGGGGATGGAGGTAAGGTGG - Exonic
1021312005 7:19107761-19107783 GGAAAGAGCAGGAGGGAAGTTGG - Intronic
1022384549 7:29889097-29889119 TGGTTGGGATGGAGGGAAGCAGG - Intronic
1022522844 7:31019148-31019170 GGGTAGGGCAGGAGGGAGGTGGG + Intergenic
1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG + Intronic
1023311729 7:38894445-38894467 GGCTAGGGTTGGGGGGAAGTGGG + Intronic
1023905247 7:44517171-44517193 TGGCTGGGCTGGAGGGAGGTGGG - Intronic
1023978101 7:45047695-45047717 TGCTAGGGGTGGAGAGAAGTAGG + Intronic
1024261275 7:47576010-47576032 GGACAGGGCTGGAGGAAAGGGGG - Intronic
1028096888 7:86771977-86771999 GGATAGGACTGAAGGAAAGTAGG - Intronic
1028531264 7:91841275-91841297 TGCTGGGGATGGAGGGAGGTGGG - Intronic
1028716419 7:93976274-93976296 TGAAGGGGTTGGAGGGAAGCAGG - Intronic
1029335780 7:99898119-99898141 TGGTGGTGCTGAAGGGAAGTGGG - Intronic
1029385830 7:100242943-100242965 TGGTAGGGGTGAAAGGAAGTTGG - Intronic
1030054504 7:105571138-105571160 GGATAGGGCTGTAGTGAAATTGG - Intronic
1030608288 7:111661561-111661583 TGTTAGGGCTGGGGAGAGGTTGG - Intergenic
1030990927 7:116298978-116299000 TGATAGGGCTGGAGGGAAGTGGG + Intronic
1031100499 7:117474111-117474133 TGAATGGGGTGGAGGGAAGATGG + Intronic
1031268385 7:119611836-119611858 TGACAGGGCTCGAGGGAAGGTGG - Intergenic
1032335427 7:131020480-131020502 TGAAGGAGCAGGAGGGAAGTGGG + Intergenic
1033407010 7:141079656-141079678 GGAGAGGGCAGGAGGGAAGAAGG - Intronic
1034413918 7:150955287-150955309 GGAGAGGGCTGCTGGGAAGTAGG - Intronic
1034586857 7:152101538-152101560 TGACAAGGCTGGAGGGAGGCAGG + Intronic
1035819079 8:2572068-2572090 AGACTGGGCTGGAGGGAAGCGGG + Intergenic
1035882484 8:3257538-3257560 TGAGAGTGCTGGGGGGCAGTTGG + Intronic
1036156893 8:6350464-6350486 AGATAGGGCTGGAGGCAGATGGG + Intergenic
1036633043 8:10528957-10528979 TGAGAGGGGTGGAGGGAAGCAGG - Intronic
1036699828 8:11005394-11005416 TGGAAGGGCTGGAGGGAAGTGGG + Intronic
1036757808 8:11482950-11482972 TGACAGGGCAGGAGGTCAGTAGG + Intergenic
1036980676 8:13466620-13466642 TGATGGGGCTCCAGGGAAGATGG - Intronic
1037518362 8:19656023-19656045 TGATAGGGCAGAATGGAAGGGGG + Intronic
1038359066 8:26859743-26859765 TGATATGACAGGAGGGAAGTAGG - Intronic
1038577758 8:28719819-28719841 TGATAGGGATGTAGAGAAGCTGG + Intronic
1038591899 8:28846913-28846935 TACTAGAGCTGGAGGGAAGCTGG + Intronic
1040488310 8:47895624-47895646 GGGAAGGGCTGGAGGGCAGTGGG - Intronic
1040864248 8:52032198-52032220 TTTTAGGGCTGGAGAAAAGTGGG + Intergenic
1040880400 8:52198923-52198945 TGGTGGGGCTGGAAGGAGGTGGG - Intronic
1041039569 8:53833760-53833782 TGATTGGGAGGGAGGGAAGATGG - Intronic
1041249803 8:55923025-55923047 TGACAGGGCTTGAGGGAGGGTGG + Intronic
1041500419 8:58533632-58533654 TGATTGGGGTGGAGGGAATGTGG - Intergenic
1042368059 8:67959234-67959256 TGGCAGGACTTGAGGGAAGTGGG + Intronic
1044568337 8:93689826-93689848 TGGGAGGTCTGGAGGGAAATAGG + Intergenic
1044850230 8:96420129-96420151 AGACAGGGATGGAGGGAACTAGG + Intergenic
1046044682 8:108949642-108949664 TATTTGGGCTGGAGGGTAGTGGG - Intergenic
1046079320 8:109352000-109352022 TATTAGTGCTGGAGAGAAGTGGG - Intergenic
1046526756 8:115390625-115390647 TAACAGGGCTGGGAGGAAGTGGG - Intergenic
1046845663 8:118912784-118912806 GGATATGGCTGGAGCAAAGTAGG + Intergenic
1047535269 8:125713512-125713534 GGACAGGGCTGGGGGGAAGCTGG + Intergenic
1047646902 8:126879062-126879084 GGATGGGGTTGGAGGGGAGTGGG - Intergenic
1047694827 8:127393304-127393326 TGAAAGGGAAGGAGGGAAGAAGG + Intergenic
1048228594 8:132614588-132614610 TGAGAGGGCAGCAGGGAAGAAGG + Intronic
1049003742 8:139841920-139841942 AGACAGGGCAGGAGGGAAGCTGG + Intronic
1049012410 8:139896121-139896143 TTACAGGGCTGAAAGGAAGTCGG - Intronic
1049052579 8:140210422-140210444 TGCTGCTGCTGGAGGGAAGTGGG + Intronic
1049072521 8:140367822-140367844 TGCAAGGGCAGGAGGTAAGTGGG + Intronic
1049609922 8:143550146-143550168 AGGTTGGGCTGGAGAGAAGTGGG - Intergenic
1049693951 8:143974678-143974700 GGGGAGGGCAGGAGGGAAGTGGG - Intronic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1050550209 9:6742714-6742736 TGAGTAGGCTGGAGGGCAGTGGG + Intronic
1051104198 9:13559366-13559388 TGATGGGGCTTTTGGGAAGTAGG + Intergenic
1051361297 9:16283879-16283901 TCATAGGGATGCAGGGAATTTGG - Intergenic
1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG + Intergenic
1052155809 9:25188736-25188758 AGAGAGGGCTAGAGGGAACTTGG - Intergenic
1055616870 9:78082158-78082180 TAAAAGGGCTCGAGGGAACTAGG + Intergenic
1055957351 9:81786492-81786514 TGCCAAGGCTGGAGTGAAGTGGG - Intergenic
1056089977 9:83195897-83195919 TGATAGGAGTAGTGGGAAGTGGG + Intergenic
1056590615 9:87963546-87963568 TGGTAGGACTGGAGGAAACTGGG - Intergenic
1056873460 9:90305950-90305972 TGAGAAGGCTGCAGGGAGGTGGG - Intergenic
1056925564 9:90831244-90831266 TGAGGGGGCTGGAGGGGAGGAGG + Intronic
1057023644 9:91719502-91719524 TGCTAGGGGTGGAGGGAACTTGG - Intronic
1057401702 9:94728936-94728958 GGATAGGGATTGAGGAAAGTTGG + Intronic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057852280 9:98574942-98574964 TCAGAGGGATGGAGGGAGGTGGG - Intronic
1058986344 9:110211604-110211626 TGCCAGGGATGTAGGGAAGTGGG - Intergenic
1059008939 9:110435467-110435489 AGATGGGGGTGGAGGGAAGCAGG + Intronic
1059100927 9:111470708-111470730 TGATGGGGTTGTGGGGAAGTGGG - Intronic
1059880593 9:118684696-118684718 TCATAGGGGTGGAGGGGAGGAGG - Intergenic
1061403435 9:130381039-130381061 TGGTAGGGTTGGAGGTAAGTGGG - Intronic
1061996651 9:134189596-134189618 TGAGAGTGGTGGAGGGAGGTTGG + Intergenic
1203626136 Un_KI270750v1:25127-25149 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1187527430 X:20066754-20066776 TCATAGGGCTGGGGGACAGTGGG - Intronic
1188120477 X:26299957-26299979 TGATAGGCTGGGTGGGAAGTGGG - Intergenic
1188309164 X:28596390-28596412 TGATAGAGGTGGAAGGAAGGGGG - Intronic
1189177581 X:38973391-38973413 GGACAGGGAAGGAGGGAAGTGGG - Intergenic
1189924637 X:45939691-45939713 TGAAAGGGATGGTGGGATGTGGG + Intergenic
1190076375 X:47320271-47320293 GCATGGGGCTTGAGGGAAGTTGG - Intergenic
1190323836 X:49194405-49194427 TGATTGGGCTGGAGGGTTGAGGG - Intronic
1192484955 X:71517036-71517058 TAAAAGGGCGGGAGGGAACTGGG + Intronic
1192502831 X:71664771-71664793 TGATAGGAGTGGAGGGGAGAGGG - Intergenic
1192503943 X:71669732-71669754 TGATAGGGGTGGAGGGGAGAGGG + Intergenic
1192510037 X:71716156-71716178 TGATAGGGGTGGAGGGGAGAGGG - Intronic
1192516660 X:71765397-71765419 TGATAGGGGTGGAGGGGAGAGGG + Intronic
1192529168 X:71871279-71871301 TGATAGGGGTGGAGGGGAGAGGG - Intergenic
1192706976 X:73536906-73536928 TGTTTGGGGTGGAGGGAAGGGGG - Intergenic
1193216343 X:78868752-78868774 TGAAATGGCTGGAGGAAAGAGGG - Intergenic
1193278264 X:79617322-79617344 TTAAATGGCTGCAGGGAAGTGGG + Intergenic
1193324011 X:80157441-80157463 TTATAGGGCTGGAGCCAAGATGG - Intergenic
1195000592 X:100639614-100639636 TGGTAGGGATGGAGGGAGGCTGG - Intronic
1197290786 X:124654648-124654670 AGTTAGGGCTGGAGGGAAGAAGG + Intronic
1197309836 X:124891145-124891167 TGAAAAGGGTAGAGGGAAGTGGG + Intronic
1198169353 X:134090635-134090657 AGATAGGGCTGGAGACAACTAGG - Intergenic
1199136782 X:144262807-144262829 AGAAAGGGGTGGAGTGAAGTAGG + Intergenic
1199717739 X:150518295-150518317 TGCTAGGGCTTGTGGGAAGTGGG + Intergenic
1199866114 X:151851791-151851813 GGAGAGGGAGGGAGGGAAGTGGG - Intergenic
1199894879 X:152119114-152119136 TGAGATTGGTGGAGGGAAGTGGG - Intergenic
1199940740 X:152625227-152625249 TGACAGGGCTGGGGGGAAGGGGG + Intergenic
1201104623 Y:10754313-10754335 TGATTGGAGTGGAGTGAAGTGGG - Intergenic
1201557181 Y:15274853-15274875 TGCTCAGGCTGGAGTGAAGTGGG - Intergenic
1201933565 Y:19380957-19380979 TGTTGGGGTTGGAGGGAAGATGG - Intergenic