ID: 1031001314

View in Genome Browser
Species Human (GRCh38)
Location 7:116418462-116418484
Sequence CTGTTCTATCTGTTCTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031001314 Original CRISPR CTGTTCTATCTGTTCTAAGG AGG (reversed) Intronic
902660908 1:17902944-17902966 CTGGTCTGTCTGTACTAAAGAGG + Intergenic
905058252 1:35117637-35117659 CTGTTTTCTCTTTTTTAAGGTGG - Intergenic
905445517 1:38026230-38026252 CTGCTCTAGCTGTGCCAAGGGGG + Intergenic
905474864 1:38218930-38218952 GTATTCTATCTGTCCGAAGGAGG - Intergenic
906974526 1:50555558-50555580 CTGTTCTTACTGGTGTAAGGTGG - Intronic
909137446 1:71819372-71819394 CTGTTCTATTTGGTCTATAGTGG - Intronic
912639824 1:111334173-111334195 CTTTTCTACCTGTTCTCAGCTGG - Intergenic
916742305 1:167656825-167656847 CTTTTCCATCTGCTCTAAAGGGG + Intronic
919570261 1:199239743-199239765 TTGTTCTATTTGTTTTAATGGGG + Intergenic
922579456 1:226686163-226686185 CAGTTCTGTCTGCTCTAATGAGG + Intronic
924736226 1:246759090-246759112 CTGATGTGTCTGTTGTAAGGAGG + Exonic
1063581356 10:7310513-7310535 ATTCTCTATCTGTTCTAATGAGG + Intronic
1063782189 10:9338247-9338269 ATGAACTATCTATTCTAAGGGGG - Intergenic
1067981156 10:51086610-51086632 CTGTTCTCCATTTTCTAAGGGGG - Intronic
1069083235 10:64110649-64110671 CTGTTCTCTCTGTTGTAAAATGG + Intergenic
1070347005 10:75554056-75554078 GTGTTCTATCTGTTCTTGGAGGG + Intronic
1071681764 10:87713053-87713075 CTGTTTTATCTGTTCTGAACAGG + Exonic
1081863720 11:46348193-46348215 CTGTTCTATCAGTGCCAAGAAGG - Intronic
1084340819 11:68499299-68499321 CTGGAGGATCTGTTCTAAGGTGG + Intronic
1088578877 11:111298142-111298164 CTGCTCTATCTGTGGGAAGGAGG + Intergenic
1090286294 11:125502427-125502449 TAGTTCTATCAGCTCTAAGGAGG - Intergenic
1091842512 12:3631052-3631074 CTGTTATATCTCTTTAAAGGGGG + Intronic
1092404940 12:8214413-8214435 CTGTTCTATTTGTCCTACTGTGG - Intergenic
1092769773 12:11885908-11885930 CTGTTCTGTTTGTTCAAAGGAGG - Exonic
1092782801 12:12002941-12002963 CTGTTTTATTTGTTGGAAGGTGG + Intergenic
1093428997 12:19062856-19062878 CTGTTATATCTGTTCCTAGGAGG - Intergenic
1094017395 12:25879663-25879685 TTGTTCTCTGAGTTCTAAGGGGG - Intergenic
1095042461 12:37457364-37457386 CTCTTGTATCTGTTCTTAGAAGG + Intergenic
1095705744 12:45235344-45235366 TTGTGCTGTCTGTTCTAAGTAGG + Intronic
1098893623 12:76032828-76032850 CTAATCTATCTGTTCCAACGTGG - Exonic
1098956746 12:76696207-76696229 GTGTTCTACCTGTTCCAGGGTGG + Intergenic
1100077185 12:90800128-90800150 CTGTTCTAACTGGTGTGAGGTGG - Intergenic
1100383161 12:94080863-94080885 CTGTTCTATCTGAACAAAAGAGG + Intergenic
1100976615 12:100129370-100129392 ATGTTCTATGTATTCTATGGAGG + Intronic
1107005516 13:35605312-35605334 CTGATATATCTGTTTTAAGTGGG - Intronic
1109380981 13:61558941-61558963 TTGTTTTATCTGTTTTAGGGAGG + Intergenic
1112251818 13:97788362-97788384 CTGTTATATCTGTTCTCTGCAGG + Intergenic
1114898340 14:27023219-27023241 CTGATTTCTCTGTTCTCAGGAGG - Intergenic
1118435498 14:65767459-65767481 CTGTATAATCTGTTCTCAGGTGG - Intergenic
1119084304 14:71725814-71725836 CTGTTCTCTAGGTTCTTAGGTGG + Intronic
1123951276 15:25278505-25278527 CTTTTCTATCTCTTCGAAGAGGG + Intergenic
1125770382 15:42161504-42161526 CTGTTCTATCTGTTGGGAGTGGG - Intronic
1128442999 15:67730969-67730991 CTCTTCTATCTGATTAAAGGAGG + Intronic
1129180448 15:73871112-73871134 CTGTTATATCTGTTCCAGGTGGG - Intergenic
1133650400 16:7807265-7807287 CTGTGCTAGCTGGTCTAAGATGG + Intergenic
1133761188 16:8799459-8799481 ATTTCCTATCTGTGCTAAGGTGG + Intronic
1133776663 16:8901720-8901742 CCTTTCTGTCTGTACTAAGGCGG - Intronic
1135042351 16:19127601-19127623 CTGATCTCTCTGGTCTTAGGTGG - Intronic
1138160391 16:54747745-54747767 CTTTACTATGTGTTCTATGGTGG + Intergenic
1144139031 17:12329335-12329357 TTGTTCTAGCTGTTCTCAGTGGG + Intergenic
1149044518 17:52228920-52228942 GTGTTCTATCTGTTCTTCAGTGG + Intergenic
1149814554 17:59710389-59710411 GTGTTCTTTCTGTTCTAACAAGG + Intronic
1150452850 17:65283655-65283677 CTGTTCAGTGTGTTCTGAGGTGG + Intergenic
1151536952 17:74744598-74744620 CTGTTCACTCTGCTCTAATGGGG - Intronic
1151903560 17:77033568-77033590 CTGCTCTATCTGTTCCCAGTGGG - Intergenic
1155514781 18:26613722-26613744 CTCTTCTCTCTGTTCAAAGTAGG - Intronic
1162720827 19:12661611-12661633 CTATGCTATCTCTTCTAATGAGG + Intronic
1164310275 19:24040041-24040063 GTGTTCTATCTTTTCTAAGCTGG - Intronic
1168257416 19:55174301-55174323 GTGTCCTATCTGCTCTAAGCGGG - Intronic
925564543 2:5235900-5235922 CTGTTCCATCTGTGCCAATGAGG + Intergenic
925841121 2:7993477-7993499 CTGTTCTATCAACTCTAAGATGG + Intergenic
927756150 2:25709715-25709737 CTTTTTTCTCTGTTTTAAGGGGG - Intergenic
928281679 2:29951995-29952017 CTTTTCAACCTGTTCTAATGGGG + Intergenic
929959588 2:46486382-46486404 CAGTTCTGTCTGCTCTAAGAAGG - Intergenic
930720595 2:54633892-54633914 CTGAACTATATGTTCTAGGGTGG + Intronic
931140620 2:59453616-59453638 CTGGTCAATGTGTTCTAAGTAGG + Intergenic
935388255 2:102523807-102523829 CTGTTCTCTCACCTCTAAGGTGG + Intronic
941601566 2:167549323-167549345 CTGCTCTATCTCTTCCAAGATGG - Intergenic
945317426 2:208385033-208385055 CTTTTATTTCTGTTCTAAGAAGG - Intronic
1169037069 20:2462445-2462467 CTGCTCTAACTTTTCTAAGAGGG + Intronic
1170415428 20:16133938-16133960 TTGTTCTATCTGGCCTTAGGGGG + Intergenic
1177086423 21:16710805-16710827 GTATTCTAGCTGTTCAAAGGTGG - Intergenic
1183889612 22:40915803-40915825 CTGAACTATGTGTTCTGAGGAGG + Intronic
949239078 3:1848213-1848235 CTGTTCTATCTTTTTAAAGAAGG + Intergenic
949533013 3:4976193-4976215 CTGTTTTGTCTCTTCTAAGTGGG - Intergenic
950788191 3:15452844-15452866 CTGTGCTCTCTCTTCCAAGGGGG - Intronic
952775785 3:37044726-37044748 CTCTTCTTCCTGATCTAAGGGGG + Intronic
953615090 3:44482791-44482813 CTGCTATATCTGTTCTCAGTGGG - Intergenic
955263925 3:57423426-57423448 CTGTTCAATATCTTCTAAAGCGG + Intronic
955650971 3:61193406-61193428 CTGTTGTATCTGTGCAAAGAAGG - Intronic
960577815 3:119244793-119244815 TTTGTCTATCTGTTCTAAGATGG + Intergenic
964359564 3:155880246-155880268 TTTTTGTATCTTTTCTAAGGTGG + Intronic
965646622 3:170889080-170889102 GGTTTCTACCTGTTCTAAGGAGG + Exonic
966450449 3:180053415-180053437 CTTTTATGTCTGTTCTAATGGGG + Intergenic
969047151 4:4344679-4344701 CTGATTCATCTGCTCTAAGGCGG + Intergenic
972371970 4:38432888-38432910 CTGTTCTAACTGTTGTGAGATGG + Intergenic
974117413 4:57596894-57596916 ATGTTCAATCTGTTTTTAGGAGG + Intergenic
974136566 4:57825688-57825710 TTTTTTAATCTGTTCTAAGGTGG + Intergenic
975442713 4:74431305-74431327 CTGTACAGTCTGTTCTAAGCAGG - Intergenic
977148945 4:93484204-93484226 ATGTTCTATCTTTTCCTAGGTGG - Intronic
983724503 4:170903711-170903733 CTGTTATATCTTTTCTAAAATGG - Intergenic
984978016 4:185247642-185247664 CTGTTCTCTCTTTTCTAAAATGG + Intronic
988407953 5:30848906-30848928 GTGCTTTATCTATTCTAAGGAGG - Intergenic
988964376 5:36401728-36401750 CTGATCTAGGTGTTCTAGGGTGG - Intergenic
989642269 5:43594213-43594235 CTATTCTTACTGTCCTAAGGTGG + Intergenic
991376169 5:65969852-65969874 CAGTTCTGTTTGTTCCAAGGTGG + Intronic
991392172 5:66157515-66157537 CTGTTTTATCTGTTATAAATTGG - Intronic
992158443 5:73977665-73977687 CTGTTTTCTCAGTTCTAAGGTGG + Intergenic
994020445 5:95017526-95017548 CTGTTCTATTTTCTCTAAAGGGG + Intronic
996096948 5:119409062-119409084 GTTTTCTAGCTCTTCTAAGGTGG + Intergenic
996167122 5:120237890-120237912 CTGTCGTTTCTGCTCTAAGGAGG + Intergenic
996189801 5:120526057-120526079 CTAGTCTTTCTGTTCTGAGGTGG + Intronic
998687263 5:144543062-144543084 GTGTTTTATCTCTTTTAAGGAGG + Intergenic
999546870 5:152638931-152638953 CTGTTCTTTCTGTTCTTCAGTGG - Intergenic
1004619572 6:17321180-17321202 CTGTTATACCTGCTATAAGGAGG + Intergenic
1007947287 6:45837911-45837933 CTGGTCTATGCGTTCTTAGGAGG + Intergenic
1009856809 6:69275031-69275053 CTGTTCTATCTTTCCTTGGGTGG - Intronic
1011059048 6:83242165-83242187 CTGTACTATCAGTTTTAAAGAGG + Intronic
1022064416 7:26836640-26836662 CTGTTCTAACTGGTGTAAGATGG - Intronic
1028426795 7:90698561-90698583 ATGTCCTATCTGATCAAAGGAGG - Intronic
1028726510 7:94093659-94093681 CTGATATAGCTGTTCTGAGGTGG + Intergenic
1029519688 7:101052175-101052197 ATGTCCTCTCTGTGCTAAGGAGG + Intronic
1031001314 7:116418462-116418484 CTGTTCTATCTGTTCTAAGGAGG - Intronic
1033437051 7:141342646-141342668 CTCTTCTCTCTGTTCAAGGGAGG - Intronic
1036271286 8:7305412-7305434 CTGTTCTATTTGTCCTACTGTGG + Intergenic
1036845338 8:12165443-12165465 CTGTTCTATTTGTCCTACTGTGG - Intergenic
1036866707 8:12407764-12407786 CTGTTCTATTTGTCCTACTGTGG - Intergenic
1036919658 8:12839775-12839797 GTGTTGTCTCTGTTCTAAGTGGG + Intergenic
1039322819 8:36451554-36451576 CTGTTCCATTTGTTATTAGGTGG - Intergenic
1039727199 8:40231372-40231394 TTGTGCTATCTGTTCTGAGTTGG + Intergenic
1041102944 8:54414971-54414993 CTGTTCTGTCTGTTCTAACAAGG - Intergenic
1041370388 8:57153475-57153497 CTCTTCTCTCTGTTCTCATGAGG - Intergenic
1043494103 8:80781186-80781208 CTGATTTATCTGGTCTGAGGTGG + Intronic
1044885340 8:96770922-96770944 CTGTTCTTTGGGTTATAAGGAGG - Intronic
1045148993 8:99381593-99381615 CTGTTCTATCTGGTGTGAGATGG + Intronic
1045297414 8:100884156-100884178 CTGGTGTATATGTTCTAAGGTGG + Intergenic
1045880857 8:107038399-107038421 CTTTTTTATATGTTTTAAGGTGG - Intergenic
1046964397 8:120147787-120147809 CTGTTCTCTCTGTTTCTAGGTGG + Exonic
1051852520 9:21526320-21526342 CTTTTCTATATGGTATAAGGAGG + Intergenic
1052144673 9:25034183-25034205 CAGTTCTAACAGTTTTAAGGTGG - Intergenic
1059692870 9:116702656-116702678 CTTTTTTATCTAATCTAAGGGGG - Intronic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1062100109 9:134723569-134723591 CTCTTCTATCTGTTAAATGGAGG + Intronic
1185831625 X:3308698-3308720 CTTGTCCATCTGGTCTAAGGTGG - Exonic
1188946863 X:36315963-36315985 GCGTTATATCTGTTTTAAGGAGG + Intronic
1190605350 X:52136244-52136266 CTCTTCTTTCTGTACTAGGGTGG - Intergenic
1192354797 X:70391451-70391473 CTGTTCTTCCTGATCTTAGGGGG + Intronic
1199602952 X:149553761-149553783 CTGTTATCACTGTTCTAATGTGG - Intergenic
1199647437 X:149925714-149925736 CTGTTATCACTGTTCTAATGTGG + Intergenic
1200276561 X:154738421-154738443 GTGTTCTGTATATTCTAAGGAGG + Intronic
1200801783 Y:7393607-7393629 CTGTTGGAGCTTTTCTAAGGAGG - Intergenic
1201244372 Y:11988429-11988451 CTTGTCCATCTGGTCTAAGGTGG + Intergenic