ID: 1031003743

View in Genome Browser
Species Human (GRCh38)
Location 7:116448166-116448188
Sequence AGAGAGATAATGCAGCTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 301}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031003743_1031003744 3 Left 1031003743 7:116448166-116448188 CCATTAAGCTGCATTATCTCTCT 0: 1
1: 0
2: 2
3: 26
4: 301
Right 1031003744 7:116448192-116448214 TTTGAAGTTATCTTTTCCAAAGG 0: 1
1: 0
2: 1
3: 53
4: 452
1031003743_1031003746 19 Left 1031003743 7:116448166-116448188 CCATTAAGCTGCATTATCTCTCT 0: 1
1: 0
2: 2
3: 26
4: 301
Right 1031003746 7:116448208-116448230 CCAAAGGCCATTTTCAGTCCAGG 0: 1
1: 0
2: 2
3: 17
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031003743 Original CRISPR AGAGAGATAATGCAGCTTAA TGG (reversed) Intronic
903283248 1:22262238-22262260 AAAGAGATAATGCACTTGAAGGG + Intergenic
905911683 1:41659390-41659412 AGAGAAATAATGAATATTAATGG - Intronic
908037592 1:60073153-60073175 AAGGAGATAATGCATCTGAAGGG + Intronic
908445835 1:64198836-64198858 AAAAAGATAATGCAGTTTAATGG + Intergenic
909683809 1:78322852-78322874 TGAGAAACAATGCAGCTAAAAGG - Intronic
909726411 1:78841182-78841204 AGGGAGAGAATGCAGCTGGATGG - Intergenic
910123669 1:83817680-83817702 AGAGTAATGATGAAGCTTAAGGG - Intergenic
910353107 1:86322486-86322508 ACAGAGCTAGTGGAGCTTAAGGG - Intergenic
914568846 1:148895201-148895223 AGAGAAGTCAGGCAGCTTAAGGG - Intronic
914603982 1:149235055-149235077 AGAGAAGTCAGGCAGCTTAAGGG + Intergenic
915782986 1:158574429-158574451 ATAAAGATTATGCAGCTCAAAGG - Intergenic
916751795 1:167729890-167729912 AGAGAGATTGTGTAACTTAAGGG + Intronic
919530775 1:198717002-198717024 AGAGAGAGAATCCAGGATAACGG - Intronic
920670472 1:208000265-208000287 AGGGAGAGAGTGCTGCTTAAAGG + Intergenic
921195846 1:212756951-212756973 AGAAAAATAAAGCAGGTTAAAGG + Intronic
922932337 1:229400011-229400033 AAAGATATATTGCAGCTGAAGGG + Intergenic
923463684 1:234230137-234230159 AGAGAGATAATGTACTTTATTGG - Intronic
923828266 1:237524364-237524386 AGAGACATAAAGTAGCTTAGGGG + Intronic
1063783347 10:9351752-9351774 AGAGAGGTAATGAAGGCTAAAGG + Intergenic
1063940274 10:11121379-11121401 AAACAGAAAATGCTGCTTAATGG - Intronic
1065808480 10:29418557-29418579 ACAGAGACAAAGCAGATTAAAGG - Intergenic
1066521847 10:36228964-36228986 ACAGAGATCCTGGAGCTTAACGG + Intergenic
1069008084 10:63340258-63340280 AAAGATATATTGCAGCTAAAGGG - Intronic
1070817214 10:79332082-79332104 GGAGAGATAATGCACCTTCTGGG + Intergenic
1071467390 10:85953901-85953923 AGAGAGGTAATGAGGCTTAGGGG - Intronic
1072200624 10:93155228-93155250 ATAGATATAAAGCAGATTAATGG + Intergenic
1075912534 10:126137570-126137592 AGAGATAGAAAGCAGGTTAATGG - Intronic
1079516776 11:21278649-21278671 AGAGAGATAATCCATGTTTATGG + Intronic
1079796935 11:24815611-24815633 AGAGAGATACTACTGCTTTAAGG - Intronic
1079872108 11:25811376-25811398 AGAGAAATATTCCAGCTCAAAGG + Intergenic
1079979046 11:27129683-27129705 ATAGAAATAATGAGGCTTAAGGG - Intergenic
1080087236 11:28298520-28298542 AGACAGAAAAGGTAGCTTAAAGG - Intronic
1080111966 11:28578156-28578178 AGAGACATAAAGCAGATTAGTGG - Intergenic
1080251245 11:30236291-30236313 AGAGAGACAATGCAGTAAAATGG + Intergenic
1080315471 11:30942902-30942924 CGAGAATTAAAGCAGCTTAAAGG - Intronic
1080613143 11:33922650-33922672 AGAGACAGAAAGCAGATTAATGG + Intergenic
1081894903 11:46577420-46577442 AGAGACAGAATGCAGATTGATGG + Intronic
1083140848 11:60720240-60720262 AATGAGATCATGCAGCTGAAAGG - Intergenic
1086071911 11:82808943-82808965 GGACAGAGAATTCAGCTTAAAGG + Intergenic
1087164651 11:94989719-94989741 AGAGAGAGAAAGAAGGTTAAAGG - Intronic
1087999437 11:104858264-104858286 AGAGAGAGACTCCAGTTTAAAGG + Intergenic
1088674157 11:112175462-112175484 AAAGAGAGGACGCAGCTTAAGGG - Exonic
1089550535 11:119272879-119272901 AGAGAGACAATACAGCAAAACGG - Intronic
1089860984 11:121589899-121589921 AAAGAGATAAGGCAGCTTCATGG - Intronic
1090342714 11:126039708-126039730 AGAGTGATAATGCTGCTTTAGGG - Intronic
1091343027 11:134834752-134834774 AGAGATAGAAGGCAGATTAAAGG + Intergenic
1093203429 12:16217751-16217773 AATGAGATAATGCATATTAAGGG - Intronic
1096462888 12:51832337-51832359 AGAGATAGAATGTAGCTGAAGGG - Intergenic
1097349350 12:58531273-58531295 AGAGACAGAAAGCAGCATAAAGG - Intergenic
1098377271 12:69830298-69830320 AGAGAGATAATGTATCTGTATGG + Intronic
1098477730 12:70924578-70924600 AGAGATATAAAGCAGCAAAATGG + Intergenic
1099588106 12:84546791-84546813 AGAGAAGTAAAGCAGCTTAAGGG - Intergenic
1101125563 12:101630075-101630097 AGAGAGACAAAGCAGATTAATGG - Intronic
1103397164 12:120616913-120616935 AGAGACAGAATGCAGATTAGAGG - Intergenic
1103496903 12:121369923-121369945 AGAGAGAGAATTTAGATTAATGG - Intronic
1104032136 12:125072446-125072468 AGTGAGATAATTCAGCTCAGCGG + Intronic
1107447543 13:40482070-40482092 AAAGAGATTATTCAGCTAAAAGG - Intergenic
1107818561 13:44266162-44266184 AGAGAGATGATGCAGTGTGATGG + Intergenic
1109086604 13:57980928-57980950 AGCGAGATCATGTGGCTTAATGG - Intergenic
1109771705 13:66982951-66982973 AGAGAAAAAATGTAGCTTAATGG + Intronic
1110713692 13:78677580-78677602 AGAGATATAATACATGTTAAAGG + Intergenic
1112961343 13:105131164-105131186 CAAGAGATTATGCAACTTAACGG - Intergenic
1113225043 13:108150369-108150391 AGAAAGAAAATTCAGCTTAGAGG - Intergenic
1115841627 14:37477730-37477752 AAAGATATATTGCAGCTGAATGG - Intronic
1116992221 14:51288484-51288506 CGAGTTATAATGAAGCTTAAAGG - Intergenic
1117610507 14:57478400-57478422 AAAGAGATAATGCATATTAAAGG + Intronic
1118976426 14:70681367-70681389 AGAGACAGAAAGCAGCTTAGTGG + Intergenic
1120747632 14:88166409-88166431 AGAGAGAAAATGGAGGTTACAGG - Intergenic
1121187222 14:91984704-91984726 AGCAAGATAATGCATTTTAATGG + Intronic
1122004180 14:98688530-98688552 AGAAAAATAAAGCAGCTTTAGGG + Intergenic
1123126412 14:105949361-105949383 AGAGAGATAAGCCAGATGAAGGG - Intergenic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1125375171 15:39021078-39021100 AGAGAGATGAGGCAGGTAAAAGG - Intergenic
1125617622 15:41029666-41029688 AGAGAGATAATGAACTTCAACGG - Intronic
1126357454 15:47811619-47811641 AGAGAGATTTTGCAGTTAAAAGG + Intergenic
1126892582 15:53222425-53222447 AGAAAGATAAGGCAGCATCAGGG + Intergenic
1128715786 15:69906966-69906988 AGAGACAGAAAGCAGATTAATGG + Intergenic
1129619450 15:77130747-77130769 AGTGAGATAATGCATATGAAAGG - Intronic
1130121784 15:81056160-81056182 AGAGACAGAAAGCAGATTAATGG - Intronic
1131731381 15:95285309-95285331 AGTGAGATACTGCAGCTTTCAGG - Intergenic
1131780715 15:95855231-95855253 GGTGATATAATGCAGCTCAAGGG - Intergenic
1131993360 15:98111505-98111527 AGAGAGAGAGAGAAGCTTAAAGG + Intergenic
1133135997 16:3712479-3712501 AGAGAGGGAATGCAGCTTGCGGG - Intronic
1133184203 16:4083815-4083837 AGAGACAGAAAGCAGCTTAGGGG + Intronic
1133648130 16:7783591-7783613 AGAGAGAAAAAGCAGATTAGCGG + Intergenic
1133858630 16:9573484-9573506 AGGGAGATAATTAAGGTTAAAGG + Intergenic
1133863448 16:9618960-9618982 AGAGAGAGAGAGAAGCTTAAGGG + Intergenic
1135347838 16:21704519-21704541 AATGAGATAATGCAGGTAAACGG + Intronic
1135361109 16:21815647-21815669 CGAGAGATACTAGAGCTTAAAGG + Intergenic
1136261422 16:29079749-29079771 CGAGAGATACTAGAGCTTAAAGG - Intergenic
1138144903 16:54599639-54599661 AGAGAGATAATGCTTTTGAAGGG + Intergenic
1138218523 16:55227273-55227295 TGTGAGATAATGCTGCTTGAGGG + Intergenic
1138980613 16:62263422-62263444 ATAGAGATAGTGCATCCTAAAGG - Intergenic
1139244993 16:65433015-65433037 GGAGAGAAAAAGCAGCTTACTGG - Intergenic
1140033012 16:71353537-71353559 AGAGAGGTAATGCATGTTAAGGG - Intergenic
1141605103 16:85148312-85148334 AGAGACAGAAGGCAGCTTAGTGG - Intergenic
1144019172 17:11224631-11224653 AGAGAGAAAAGGTAGCTTAAAGG - Intergenic
1144029909 17:11310373-11310395 AGGGAAATAATGCAGGTTAGGGG + Intronic
1144031598 17:11327890-11327912 AGAGAGAAAATGCTTCTGAATGG - Intronic
1144117838 17:12117434-12117456 AAAGATATATTGCAGCTAAAGGG - Intronic
1146080739 17:29778267-29778289 AGAGAGAAAGTCCAGCTGAAAGG + Intronic
1147225212 17:38971279-38971301 AGAGATATAAGGCATCTCAAGGG - Intergenic
1148292025 17:46460805-46460827 AGAGAGAGAATACCGTTTAAAGG + Intergenic
1148314213 17:46678502-46678524 AGAGAGAGAATACCGTTTAAAGG + Intronic
1151257245 17:72887439-72887461 AGAAAGATGATGCAGATGAAAGG - Intronic
1151865366 17:76798377-76798399 AGAGATTTTATGCAGCTTAATGG + Intergenic
1152670174 17:81598911-81598933 ACAGAGAAAATGAAACTTAAAGG + Intronic
1155223123 18:23703344-23703366 AAAGAGAAAATGGAGCTCAAGGG + Intronic
1156219568 18:35038028-35038050 AGAGAGATACTACAGCTGTAGGG - Intronic
1156381514 18:36566000-36566022 AGAGATATAATCCCGTTTAAGGG - Intronic
1156637954 18:39053722-39053744 AGAAGGAGAAAGCAGCTTAAGGG - Intergenic
1157030565 18:43902085-43902107 AGAGACAGAAAGCAGATTAATGG - Intergenic
1157942741 18:51946653-51946675 GGAGAGACAATGCAGGTTAGTGG + Intergenic
1158089755 18:53696902-53696924 AAAAAGATAGTGCAGCTAAAGGG + Intergenic
1159187699 18:64998796-64998818 TGACAGATAATGCGGTTTAATGG - Intergenic
1160089893 18:75816803-75816825 ACAGAGATAATCAAGTTTAAAGG - Intergenic
1162226677 19:9228441-9228463 AGAGAGAAAGTGTAGCCTAACGG - Intergenic
1166119878 19:40679775-40679797 AGAGAGACAAAGCAGATTAGTGG + Intronic
1166986649 19:46664117-46664139 AGAGAGAGAATGCAAATGAAAGG + Intergenic
928190162 2:29157762-29157784 AGTGAGATTATGCAGGTTCACGG - Intronic
928193093 2:29192153-29192175 GGAGAGAAAACGCAGGTTAACGG + Intergenic
928403738 2:30998220-30998242 AGAGAAATTAAGCAACTTAACGG - Intronic
928740142 2:34342030-34342052 AGAGAGAGAAAGCAGATTAGTGG + Intergenic
928924020 2:36557866-36557888 ACAAAGATAATGCACCTTCAAGG - Intronic
929291652 2:40198900-40198922 AGAGAGATTTTGCAGCTTAATGG + Intronic
929938738 2:46314526-46314548 AGAGAGATCATCCAGCTGATTGG - Intronic
930376873 2:50579016-50579038 AAATAGGAAATGCAGCTTAAGGG - Intronic
930403938 2:50929983-50930005 AAAGAGAAAATGAAGCATAAAGG + Intronic
930413812 2:51063535-51063557 AGAGAGAGAATGCAGATTGGTGG + Intergenic
931403608 2:61954660-61954682 AGAGAGAGAGTGAAGCATAATGG - Intronic
932543947 2:72687647-72687669 AGGCAGAAAATGAAGCTTAAAGG + Intronic
933223492 2:79717831-79717853 AGAGAGTGAATGCTGCTTCATGG + Intronic
933316149 2:80718156-80718178 ACAAAGATAATGCAGATGAATGG + Intergenic
935442723 2:103121297-103121319 AGGGAGATAATGGGGCTGAAAGG - Intergenic
935882740 2:107582451-107582473 AAAAAAATAATGCAGCTTCATGG + Intergenic
937857044 2:126679893-126679915 AGACAGAAAAAGCATCTTAATGG + Intronic
939035034 2:137120592-137120614 AAAGAGATAATGCAGCCTAATGG - Intronic
939206485 2:139111435-139111457 AAAGACATAATGTAGCTAAATGG - Intergenic
940594779 2:155776563-155776585 AGAGAGAAAATAAAGCTAAATGG - Intergenic
941555212 2:166970498-166970520 ACAGAAATAATGCAGCAGAATGG + Intronic
942341513 2:174953266-174953288 AGTGTGATATTGCAGTTTAAAGG - Intronic
942645250 2:178103322-178103344 AGAGACAGAATGCAGATTAGTGG + Intronic
942752722 2:179306055-179306077 AGAGTGAGAAAGCAACTTAAGGG - Intergenic
943090046 2:183363483-183363505 AGAAAGAGAAAGCAGCATAATGG - Intergenic
944218619 2:197280030-197280052 AGAGAGATAAGGTGGTTTAAAGG - Intronic
944879144 2:203993712-203993734 AGAGAGATAATGAATATCAAGGG - Intergenic
944940201 2:204616941-204616963 ACAGAGATAATGAAGTTTAAGGG - Intronic
947155518 2:227159370-227159392 AGAAAAATACTGCAGCTTGATGG + Intronic
947233267 2:227911016-227911038 AGAGAGATAATGCAGATATAGGG - Intronic
948530711 2:238601707-238601729 AGAGAGCAAATGCAGATGAAAGG + Intergenic
1168872349 20:1141130-1141152 AGAGATAGAAAGCAGATTAATGG + Intronic
1168964503 20:1891144-1891166 AGTGAGATAATGTATCTCAAAGG + Intergenic
1172013571 20:31860611-31860633 AGAGAGATCAGGCAGCTTGCCGG - Intronic
1173304646 20:41836678-41836700 AGAGAGAGAAAGCAGATTAGTGG - Intergenic
1175068799 20:56314489-56314511 AGAGACAGAAAGCAGATTAATGG + Intergenic
1175515988 20:59570198-59570220 AGAAACATAAAGTAGCTTAATGG - Intergenic
1177330992 21:19662454-19662476 AAAGATATACTGAAGCTTAAGGG - Intergenic
1177431455 21:20997077-20997099 AGAGAGAAAGTGCAGATGAAAGG + Intergenic
1177555625 21:22684104-22684126 AGAGAGAAAAAGCAGCTTCCTGG - Intergenic
1178546028 21:33493669-33493691 AGAGATATAAGGCACCTTACTGG - Intergenic
1179322960 21:40310425-40310447 AGTGAGATAATGCAGCCTAGAGG - Intronic
1179905529 21:44420827-44420849 AGCGAGATGATGCAGGTGAAGGG - Intronic
1181014040 22:20058235-20058257 AGAGACAGAAAGCAGATTAAAGG - Intronic
1181723700 22:24796142-24796164 AGAGACAGAAAGCAGATTAATGG + Intergenic
1183363413 22:37394620-37394642 AGAGCGATCCCGCAGCTTAAAGG + Intronic
949966166 3:9358264-9358286 AGAGACAGAAAGCAGGTTAATGG - Intronic
950156634 3:10725975-10725997 AATGAGATAATGCATTTTAAGGG + Intergenic
951165514 3:19481128-19481150 AGAGAGATAAAGAAGATTGAGGG - Intronic
951311899 3:21137026-21137048 AGAAAGATAATGTAGCATAATGG - Intergenic
952631015 3:35467300-35467322 AGAGTTAAAATGAAGCTTAAGGG + Intergenic
952767130 3:36963667-36963689 AGAGACAGAATGCAGATTGATGG - Intergenic
953085492 3:39661940-39661962 AGAGATAAAATACAGATTAATGG + Intergenic
953546026 3:43864109-43864131 AGGGAGATGATGCAGCCTAGAGG + Intergenic
953787331 3:45921119-45921141 AGAAAGAGAGTGCAGCTTAGAGG + Exonic
955503669 3:59609835-59609857 AGACAGATGATCCAGCTAAAGGG + Intergenic
955537866 3:59943308-59943330 AGAGAGATTAGGCAGCTGGATGG + Intronic
955583753 3:60453926-60453948 AGGGAGATAATGCTGAGTAATGG + Intronic
956283506 3:67584344-67584366 AGGGACACAATGCAGATTAATGG + Intronic
956919971 3:73917872-73917894 AGAGAGACAAAGTAGATTAATGG + Intergenic
957582393 3:82091074-82091096 ACAGAGATAATGCAGCATTAGGG + Intergenic
960178284 3:114543437-114543459 TAAGTGATAATGCAGCTTATTGG - Intronic
960485195 3:118243485-118243507 TGAGAGATGATATAGCTTAATGG + Intergenic
962041367 3:131710833-131710855 TCAGAGGTAATGTAGCTTAAAGG + Intronic
962590859 3:136888744-136888766 AGAGACAGAAGGCAGATTAATGG - Intronic
963600204 3:147372010-147372032 AGAGAGATCCTGCAGGTTGAAGG + Intergenic
964005502 3:151822691-151822713 AGAGATAGAATGTAGATTAATGG + Intronic
964225275 3:154391644-154391666 AAAGACATAATGTAGCTGAATGG + Intronic
964598518 3:158466998-158467020 AGAGACTTAATCCAGCTCAATGG - Intronic
965416187 3:168395873-168395895 AGAGAGATAATTAAGGCTAAAGG - Intergenic
966319564 3:178686059-178686081 AGAGAGATAATAAACCTTGATGG + Intronic
966379733 3:179332067-179332089 AGAGAGACATGGCACCTTAATGG + Intronic
967031503 3:185611580-185611602 ACAGAGATAATGCATATTAATGG + Intronic
967250497 3:187532710-187532732 AGAGAAATAATCCAGATTAAAGG + Intergenic
967562214 3:190929312-190929334 TGAGAGAAAATGCAGCACAAAGG + Intergenic
969197827 4:5577258-5577280 GGAGAGACAATGTAGCTTAGTGG - Intronic
970068471 4:12127024-12127046 AGAGAAATAATTCAGATTACTGG + Intergenic
970721130 4:18989762-18989784 AGAGAGAGAATACAGATCAAAGG + Intergenic
970726003 4:19045454-19045476 AGAGAGATAAAGCGTCTGAAAGG - Intergenic
970756540 4:19433796-19433818 TGAGAGAAAATGCTGCATAATGG - Intergenic
974568827 4:63616736-63616758 GGAAATATAATGCTGCTTAAAGG - Intergenic
974783653 4:66588561-66588583 AGAGAAATAATCCAGATTACAGG - Intergenic
976880280 4:89914086-89914108 AGAGATATAATGAAGGTTCAAGG - Intronic
976963898 4:91011952-91011974 AGGGAGATAATACAGCTCCAGGG + Intronic
977117357 4:93047221-93047243 AAAGAGATATTCCAGCTAAATGG + Intronic
977133763 4:93275097-93275119 AGAAAGATAAAGTAGATTAATGG - Intronic
977170071 4:93751015-93751037 TGAGAGATATTGTAGCATAATGG - Intronic
977436443 4:97001728-97001750 AGAGAGAAATTTCAGCTTTAAGG + Intergenic
977570283 4:98621811-98621833 AGAGACAGAAAGCAGATTAATGG - Intronic
978729810 4:112012602-112012624 AAAGATATACTGCAGCTAAAGGG + Intergenic
979073151 4:116237526-116237548 AGAGAAATCATGCTGCTTTATGG - Intergenic
979205888 4:118037511-118037533 AGAGAGACAATGTAGTATAACGG - Intronic
979715612 4:123833640-123833662 AAAGAGTTAATGCATGTTAAAGG - Intergenic
980488278 4:133489632-133489654 AGAGAGATAAAGTAGGATAATGG + Intergenic
982108596 4:152032817-152032839 AGAGAAATAAAGCAGGGTAAGGG + Intergenic
983568740 4:169181860-169181882 AGAGAAATAAAGCAGGATAAGGG - Intronic
983986465 4:174065785-174065807 AGAGAAAGAAAGCAGCTAAAAGG - Intergenic
984423856 4:179558719-179558741 AAAGAGACAATGAAGCTAAATGG - Intergenic
984932025 4:184856553-184856575 AGAGTGATAATGCATTTTAAAGG + Intergenic
985974253 5:3402791-3402813 AAAGAGAGAATAAAGCTTAAAGG + Intergenic
987517286 5:18928142-18928164 AGAGATATAAGGCAGATTAATGG - Intergenic
991053501 5:62297582-62297604 AAAGATATAAAGCAGCTTAGGGG - Intergenic
991442271 5:66663422-66663444 AGAAAAATAAAGCAGGTTAAGGG + Intronic
992418416 5:76575772-76575794 AGGGGGAAAATGCAGCTAAAAGG + Intronic
992961879 5:81964015-81964037 AATGAGATAATGCAGATGAAGGG + Intergenic
993206042 5:84879520-84879542 AGAAAAATAATCCAGCTGAAAGG + Intergenic
993779862 5:92053282-92053304 AAAGATACATTGCAGCTTAAGGG + Intergenic
994489010 5:100417606-100417628 TGAGAGATAAAGTAGCTTAGTGG + Intergenic
996047743 5:118894404-118894426 AGAGAAAGAATAGAGCTTAAGGG + Intronic
997627403 5:135340300-135340322 TGTGAGATAATGCAGATAAAGGG + Intronic
997988428 5:138523757-138523779 AGTGAAATAATGCACTTTAAAGG + Intronic
998699095 5:144677126-144677148 AGTGACAGAATGCAGATTAATGG + Intergenic
999232844 5:150072158-150072180 AGGGAGACAGTACAGCTTAAGGG - Intronic
999577058 5:152990503-152990525 AAAAATATAATGCAGCATAAGGG - Intergenic
999695901 5:154188977-154188999 AAAGAGGTAATGCATCTCAAGGG + Intronic
999796282 5:154992620-154992642 AGAGACAGAAAGCAGCTTAGTGG + Intergenic
1000037643 5:157460862-157460884 AGTGAGATAATGCGGGTAAAGGG - Intronic
1002013463 5:176304122-176304144 AGAGTGAAAAGGCAGCTTATGGG + Intronic
1004856290 6:19753957-19753979 TGAGAGCTAATGTGGCTTAAAGG - Intergenic
1004965856 6:20850267-20850289 AGAAAGAAAATGCCGCTTTAAGG - Intronic
1005134500 6:22552252-22552274 AAAGAGATAATGCAGGGTAAAGG - Intergenic
1007707495 6:43799695-43799717 AGAGAGAGGAGGCAGCTTCAAGG - Intergenic
1008371980 6:50743097-50743119 AGAGAGATGATGTAACTAAATGG - Intronic
1009352685 6:62701768-62701790 ATAAAGAAAAAGCAGCTTAATGG - Intergenic
1009514995 6:64604019-64604041 AGAGAAATAATGCAGATTAGGGG - Intronic
1009648020 6:66433541-66433563 ACATAGCTAATGTAGCTTAAAGG + Intergenic
1009712440 6:67342453-67342475 AGAGAGATAATAGAACTAAAGGG + Intergenic
1010084486 6:71900767-71900789 AGAGATATTAAGCAGGTTAAAGG + Intronic
1011422994 6:87193968-87193990 AGGGAGATAAAACATCTTAAAGG + Intronic
1012293598 6:97491028-97491050 AGGAAGATAATGGAGCTTCAAGG - Intergenic
1012328850 6:97958871-97958893 TGAGAGATTCTGCAGCCTAATGG + Intergenic
1012581637 6:100877259-100877281 AGTGATATACTGCAGATTAAGGG + Intronic
1013898923 6:115128707-115128729 AGAGACAGAATGGAGCTTAGTGG + Intergenic
1014990772 6:128073363-128073385 AGAAAGATAAAGCAGGCTAAGGG + Intronic
1018200606 6:161391275-161391297 AGAGGTATTATGCAGCTTAAGGG - Intronic
1018356100 6:163019379-163019401 AAAGAGAAAATCCAGCTAAAAGG - Intronic
1020597894 7:10232804-10232826 AGAGAGATAAGCCATCTTCATGG - Intergenic
1022290824 7:29000872-29000894 AGAGACAGAAAGCAGATTAATGG - Intronic
1022883335 7:34613835-34613857 AGAGAAATTCTGAAGCTTAAAGG + Intergenic
1023755022 7:43408223-43408245 AAATAGATAATGAAGCCTAATGG + Intronic
1026176134 7:67998714-67998736 AGAGACACAATGCAGTTTAGAGG - Intergenic
1026343592 7:69454926-69454948 AGAGGTATAATGCAGGTTCATGG - Intergenic
1028770763 7:94618149-94618171 AGTGAGATAATGCATTTGAAAGG - Intronic
1029226125 7:99029842-99029864 GGACAGATAATGCAGCAAAAGGG + Exonic
1030081526 7:105782680-105782702 AGAGAGATACTGGAGCTTCACGG + Intronic
1030097252 7:105911338-105911360 AGAGACAGAAAGCAGATTAATGG + Intronic
1030150073 7:106395556-106395578 AGAGAGATAAACCAGCCTATAGG + Intergenic
1030885340 7:114929790-114929812 AGAGAGAAAATGAAGATGAAAGG + Intronic
1030905631 7:115178605-115178627 ACAGAGACACTGCAGCTTCAAGG - Intergenic
1031003743 7:116448166-116448188 AGAGAGATAATGCAGCTTAATGG - Intronic
1031158654 7:118140227-118140249 AAAGAGAAAATTCATCTTAATGG + Intergenic
1031752545 7:125595136-125595158 AGAGATAGAATACAACTTAATGG - Intergenic
1031781496 7:125973030-125973052 AGAGCCATAATGCAGTATAATGG - Intergenic
1031915288 7:127557094-127557116 AGAGATAGAAAGCAGATTAATGG - Intergenic
1032977160 7:137238770-137238792 AGTGAGACAATGCAGGCTAACGG + Intronic
1033213435 7:139477543-139477565 AGAGAGAAAAGGCAGCTTGGTGG + Intronic
1034077403 7:148245509-148245531 AGAAAGAAAATGCTGCTGAAAGG - Intronic
1035162079 7:156958574-156958596 AGAGAGATAATAAAACTTGAAGG - Intronic
1036509826 8:9389936-9389958 AGAGAGAAAATGCTGCTCAAGGG + Intergenic
1037174555 8:15931419-15931441 AGAGACTTAAAGCAGCTAAAGGG - Intergenic
1040416460 8:47200272-47200294 AGAAAGATAATTAAACTTAATGG + Intergenic
1040806280 8:51400232-51400254 AAAGATATATTGCAGCTGAAGGG + Intronic
1040821657 8:51565257-51565279 AAAGATATATTGCAGCTGAAGGG - Intronic
1042375633 8:68048212-68048234 ATAAAGAAAATTCAGCTTAAAGG + Intronic
1042396618 8:68298871-68298893 AGAGAGAGAATGCAGAGTAGTGG + Intergenic
1044794574 8:95883969-95883991 AGAGACAGAATGAAGCTGAAAGG - Intergenic
1044959819 8:97519368-97519390 AGTGAGATAACGCTGCTTTATGG - Intergenic
1045165494 8:99600204-99600226 AGAGTGATTATGAAGATTAAAGG - Intronic
1045777985 8:105828753-105828775 AGAGAGACAATGAGGCTTGAGGG + Intergenic
1046862911 8:119114775-119114797 TGGGAGATAATGCAGACTAATGG + Intergenic
1050127289 9:2371011-2371033 AAAGAAATAATGAAGATTAAAGG + Intergenic
1051101505 9:13527685-13527707 AGGCAGAGAATGCAGCTTGATGG - Intergenic
1051408989 9:16769549-16769571 AGGGAGGCCATGCAGCTTAAAGG + Intronic
1052003757 9:23321062-23321084 ACACAGAGAATGCAGCATAATGG + Intergenic
1053371020 9:37561789-37561811 AGAGAAATAAAGCAGGTTAAGGG + Intronic
1055168325 9:73223675-73223697 ATAGAGTCAATGCAGCTGAAAGG - Intergenic
1055334375 9:75218294-75218316 ATAGAGGCAATGCAGCTTGATGG - Intergenic
1055546144 9:77375967-77375989 AGAAAAATAAAGCAGATTAAAGG + Intronic
1056828658 9:89895914-89895936 AGAGAGAGAATGGAACTGAAAGG - Intergenic
1057831597 9:98411244-98411266 AAGGAGAAAATGCAGCTTTATGG - Intronic
1058169412 9:101662066-101662088 AAAGATTTAAGGCAGCTTAAAGG + Intronic
1058676347 9:107403538-107403560 AGAGAGAAAATACAGCTTCCAGG - Intergenic
1059790027 9:117631991-117632013 AGAAAGAAACTGCAGATTAAAGG + Intergenic
1059881194 9:118691140-118691162 AGAGAGAGAAGACAGCCTAAGGG - Intergenic
1185806963 X:3066851-3066873 AGAGAGATAATACGGCTGATAGG + Intronic
1185907770 X:3952328-3952350 AGAAAGACAATGCAGATTCATGG + Intergenic
1186356435 X:8796318-8796340 AAATAGATAAAGCAGCTTACAGG - Exonic
1186578579 X:10792695-10792717 AGAGACAAAAAGCAGCTTAGTGG + Intronic
1186658890 X:11647531-11647553 AGAAAGAGAATCCAGCTGAAGGG + Intronic
1187311302 X:18146027-18146049 AGAGTTATTATGAAGCTTAAAGG - Intergenic
1188764006 X:34068223-34068245 AGAGAAATAATGCTGCTCCAAGG - Intergenic
1189720326 X:43909318-43909340 ATAAAGATAATGCAGCTGAGAGG - Intergenic
1189760626 X:44318336-44318358 AGAGACAGAAGGCAGATTAATGG + Intronic
1190109650 X:47581923-47581945 AGGGAGATAAGGCAGGTGAAAGG - Intronic
1190593778 X:52032656-52032678 AGAGATATAATGCTTCTGAAAGG - Intergenic
1193577421 X:83217193-83217215 AGACAGAAAATGAAGATTAAAGG + Intergenic
1193927600 X:87507704-87507726 AGAGAGAGAGTGCAGATTAGTGG - Intergenic
1194171154 X:90584492-90584514 AGAGAAATAATACAGCATAGTGG + Intergenic
1195056013 X:101145552-101145574 AGAGAAGTAAGGCAGCTGAAAGG - Intronic
1195781141 X:108465945-108465967 AGAGACAGAATGCAGATTGATGG - Intronic
1195891321 X:109698634-109698656 AAAGAGATAATACAGCATCAAGG + Intronic
1196705032 X:118710055-118710077 AGAAAAATAAAGCAGGTTAAGGG - Intergenic
1197563270 X:128050172-128050194 TGAGAGGTAATGCAGCTGGAAGG - Intergenic
1198171740 X:134113287-134113309 AGAGACATAAAGTAGCTTAATGG - Intergenic
1198873050 X:141195720-141195742 AGACACATAATCTAGCTTAAAGG - Intergenic
1200385482 X:155886063-155886085 AAAAAGATAATGCAACATAAAGG - Intronic
1201799119 Y:17935380-17935402 AGAGAAAAAATGCAGATTATTGG + Intergenic
1201802434 Y:17970576-17970598 AGAGAAAAAATGCAGATTATTGG - Intergenic
1202043218 Y:20709098-20709120 AGAGAGATAAGACAATTTAATGG + Intergenic
1202362538 Y:24126943-24126965 AGAGAAAAAATGCAGATTATTGG - Intergenic
1202508243 Y:25543960-25543982 AGAGAAAAAATGCAGATTATTGG - Intergenic