ID: 1031009662 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:116512758-116512780 |
Sequence | TCTACAGTGATTAGGAGTGT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1031009662_1031009665 | 13 | Left | 1031009662 | 7:116512758-116512780 | CCCACACTCCTAATCACTGTAGA | No data | ||
Right | 1031009665 | 7:116512794-116512816 | TTCCTGAAAGAATGTGTCCATGG | No data | ||||
1031009662_1031009667 | 25 | Left | 1031009662 | 7:116512758-116512780 | CCCACACTCCTAATCACTGTAGA | No data | ||
Right | 1031009667 | 7:116512806-116512828 | TGTGTCCATGGCTGTTCTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1031009662 | Original CRISPR | TCTACAGTGATTAGGAGTGT GGG (reversed) | Intergenic | ||