ID: 1031009662

View in Genome Browser
Species Human (GRCh38)
Location 7:116512758-116512780
Sequence TCTACAGTGATTAGGAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031009662_1031009667 25 Left 1031009662 7:116512758-116512780 CCCACACTCCTAATCACTGTAGA No data
Right 1031009667 7:116512806-116512828 TGTGTCCATGGCTGTTCTTATGG No data
1031009662_1031009665 13 Left 1031009662 7:116512758-116512780 CCCACACTCCTAATCACTGTAGA No data
Right 1031009665 7:116512794-116512816 TTCCTGAAAGAATGTGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031009662 Original CRISPR TCTACAGTGATTAGGAGTGT GGG (reversed) Intergenic