ID: 1031009663 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:116512759-116512781 |
Sequence | CTCTACAGTGATTAGGAGTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1031009663_1031009667 | 24 | Left | 1031009663 | 7:116512759-116512781 | CCACACTCCTAATCACTGTAGAG | No data | ||
Right | 1031009667 | 7:116512806-116512828 | TGTGTCCATGGCTGTTCTTATGG | No data | ||||
1031009663_1031009665 | 12 | Left | 1031009663 | 7:116512759-116512781 | CCACACTCCTAATCACTGTAGAG | No data | ||
Right | 1031009665 | 7:116512794-116512816 | TTCCTGAAAGAATGTGTCCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1031009663 | Original CRISPR | CTCTACAGTGATTAGGAGTG TGG (reversed) | Intergenic | ||