ID: 1031009663

View in Genome Browser
Species Human (GRCh38)
Location 7:116512759-116512781
Sequence CTCTACAGTGATTAGGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031009663_1031009667 24 Left 1031009663 7:116512759-116512781 CCACACTCCTAATCACTGTAGAG No data
Right 1031009667 7:116512806-116512828 TGTGTCCATGGCTGTTCTTATGG No data
1031009663_1031009665 12 Left 1031009663 7:116512759-116512781 CCACACTCCTAATCACTGTAGAG No data
Right 1031009665 7:116512794-116512816 TTCCTGAAAGAATGTGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031009663 Original CRISPR CTCTACAGTGATTAGGAGTG TGG (reversed) Intergenic
No off target data available for this crispr