ID: 1031009667

View in Genome Browser
Species Human (GRCh38)
Location 7:116512806-116512828
Sequence TGTGTCCATGGCTGTTCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031009663_1031009667 24 Left 1031009663 7:116512759-116512781 CCACACTCCTAATCACTGTAGAG No data
Right 1031009667 7:116512806-116512828 TGTGTCCATGGCTGTTCTTATGG No data
1031009662_1031009667 25 Left 1031009662 7:116512758-116512780 CCCACACTCCTAATCACTGTAGA No data
Right 1031009667 7:116512806-116512828 TGTGTCCATGGCTGTTCTTATGG No data
1031009664_1031009667 17 Left 1031009664 7:116512766-116512788 CCTAATCACTGTAGAGATGATTT No data
Right 1031009667 7:116512806-116512828 TGTGTCCATGGCTGTTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031009667 Original CRISPR TGTGTCCATGGCTGTTCTTA TGG Intergenic
No off target data available for this crispr