ID: 1031011051

View in Genome Browser
Species Human (GRCh38)
Location 7:116525730-116525752
Sequence GCTGAAGGGCAGCTACGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 92}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031011051_1031011068 19 Left 1031011051 7:116525730-116525752 CCAACACGTAGCTGCCCTTCAGC 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1031011068 7:116525772-116525794 AGTGCCCTGAGGGTGGGTCGGGG 0: 1
1: 0
2: 0
3: 26
4: 195
1031011051_1031011055 -4 Left 1031011051 7:116525730-116525752 CCAACACGTAGCTGCCCTTCAGC 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1031011055 7:116525749-116525771 CAGCCACCCGCCCGCAGCCTGGG 0: 1
1: 0
2: 5
3: 21
4: 292
1031011051_1031011061 8 Left 1031011051 7:116525730-116525752 CCAACACGTAGCTGCCCTTCAGC 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1031011061 7:116525761-116525783 CGCAGCCTGGGAGTGCCCTGAGG 0: 1
1: 0
2: 3
3: 25
4: 296
1031011051_1031011062 9 Left 1031011051 7:116525730-116525752 CCAACACGTAGCTGCCCTTCAGC 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1031011062 7:116525762-116525784 GCAGCCTGGGAGTGCCCTGAGGG 0: 1
1: 0
2: 2
3: 31
4: 312
1031011051_1031011069 20 Left 1031011051 7:116525730-116525752 CCAACACGTAGCTGCCCTTCAGC 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1031011069 7:116525773-116525795 GTGCCCTGAGGGTGGGTCGGGGG 0: 1
1: 0
2: 2
3: 26
4: 288
1031011051_1031011054 -5 Left 1031011051 7:116525730-116525752 CCAACACGTAGCTGCCCTTCAGC 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1031011054 7:116525748-116525770 TCAGCCACCCGCCCGCAGCCTGG 0: 1
1: 0
2: 2
3: 31
4: 237
1031011051_1031011065 13 Left 1031011051 7:116525730-116525752 CCAACACGTAGCTGCCCTTCAGC 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1031011065 7:116525766-116525788 CCTGGGAGTGCCCTGAGGGTGGG 0: 1
1: 0
2: 6
3: 58
4: 427
1031011051_1031011067 18 Left 1031011051 7:116525730-116525752 CCAACACGTAGCTGCCCTTCAGC 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1031011067 7:116525771-116525793 GAGTGCCCTGAGGGTGGGTCGGG 0: 1
1: 0
2: 1
3: 32
4: 289
1031011051_1031011066 17 Left 1031011051 7:116525730-116525752 CCAACACGTAGCTGCCCTTCAGC 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1031011066 7:116525770-116525792 GGAGTGCCCTGAGGGTGGGTCGG 0: 1
1: 0
2: 2
3: 46
4: 356
1031011051_1031011063 12 Left 1031011051 7:116525730-116525752 CCAACACGTAGCTGCCCTTCAGC 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1031011063 7:116525765-116525787 GCCTGGGAGTGCCCTGAGGGTGG 0: 1
1: 0
2: 3
3: 53
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031011051 Original CRISPR GCTGAAGGGCAGCTACGTGT TGG (reversed) Intronic
900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG + Intronic
901233068 1:7651997-7652019 GCTGAGGGGCAGCTTCGTCTTGG - Intronic
903010121 1:20323848-20323870 GCTGAGGGTCTGCTATGTGTTGG + Intronic
903044108 1:20553056-20553078 GCTGGAGAGCAGCGACGTGTAGG - Exonic
903782498 1:25830346-25830368 TCTGATGGGCAGCTAGGTTTCGG - Intronic
910621387 1:89259631-89259653 GCTGCAGGGCAGCTAGGGGAGGG - Intronic
915936704 1:160093877-160093899 GCTGCAGGGGAGCTTCGTCTGGG - Exonic
920032286 1:203044689-203044711 GCTGCAGGGCAGACACCTGTAGG - Intronic
922225198 1:223640043-223640065 GCTGATGAGAAGCTATGTGTAGG - Intronic
1063224667 10:4004501-4004523 GCTGAAGGGTAGCTGGGAGTGGG + Intergenic
1063674618 10:8129555-8129577 GATGAAGGCCAGGTATGTGTAGG + Intergenic
1064432271 10:15281446-15281468 GCTGATGGGCCGATATGTGTGGG + Intronic
1068937979 10:62654885-62654907 GCTGAAGGTAAGCTCCGTGCAGG - Intronic
1069839179 10:71328387-71328409 GCTGTAGGGCAGGAACGTGATGG - Intronic
1070660544 10:78302761-78302783 GGTCAAGTGCAGCTATGTGTGGG + Intergenic
1072662928 10:97373564-97373586 GCTGCCAGGCAGGTACGTGTGGG - Exonic
1073048466 10:100653648-100653670 GGGGAAGGGCAGCTACATGGAGG - Intergenic
1074214857 10:111374371-111374393 TGTGAAGGGCAGCTAGCTGTTGG + Intergenic
1074857278 10:117482632-117482654 GCTAAAGGGCACATACCTGTTGG + Intergenic
1076076116 10:127535023-127535045 CCTGTAGGTCAGCCACGTGTTGG - Intergenic
1077909071 11:6558544-6558566 GGTGGAGGGCAGCTGCTTGTGGG - Exonic
1078065395 11:8075774-8075796 GCTGTAGGCCAGCTGCCTGTGGG + Intronic
1078387411 11:10904428-10904450 GGTGAAGGGCAGCAACCTTTGGG + Intergenic
1081770875 11:45650026-45650048 GCTCAAGGGCAAGTACATGTTGG - Exonic
1083080364 11:60086231-60086253 GCTGAAGGGAACCAAAGTGTGGG + Intergenic
1086129784 11:83389455-83389477 GTTGAAGGGAAGCTACGGGTTGG + Intergenic
1086892622 11:92275567-92275589 TTTGAAGGGCAGATAGGTGTTGG - Intergenic
1091128166 11:133120557-133120579 GCTGAAGTGCAGCTATGTTGAGG + Intronic
1092231633 12:6778802-6778824 GCTGAAGTGCAGCTGAGTGTGGG - Intergenic
1096080953 12:48832101-48832123 GAAGAAGGGCTGCGACGTGTTGG - Exonic
1096601402 12:52732421-52732443 GAAGAAGGGCTGCGACGTGTTGG + Intergenic
1097008168 12:55933524-55933546 GCTGAAGGGCAGCAAACTGTGGG - Intronic
1097446486 12:59678636-59678658 GCTCATGGGCAGCCACGGGTAGG + Intronic
1098722197 12:73914260-73914282 CCTGAAGGGAACCTATGTGTGGG + Intergenic
1107079819 13:36362720-36362742 GCTGAGGGGCAGCAAGCTGTGGG - Intronic
1107326289 13:39246633-39246655 GCTGTAGGTCAGCTTGGTGTGGG - Intergenic
1113571916 13:111363816-111363838 GCTGATGGGCAGCTATGGGAAGG + Intergenic
1114671720 14:24415210-24415232 GCGGAAGGGCAGCTGGGAGTTGG - Exonic
1114969863 14:28012861-28012883 ACTGGAGGGCAGCTGCCTGTGGG - Intergenic
1118442098 14:65821455-65821477 GGTGCAGGGCAGCTACGGGCTGG + Intergenic
1127030670 15:54858533-54858555 ACTGAAATGCAGCTAGGTGTAGG - Intergenic
1129338721 15:74871138-74871160 GCTGAAAGGCAGAAAGGTGTGGG + Intronic
1141186158 16:81788995-81789017 TCTGATGGGCAGCTAGGTTTGGG - Intronic
1149620115 17:58037994-58038016 GCTGAAGGGTAGATAGGTGGAGG + Intergenic
1152699358 17:81811458-81811480 GCTGAAAGCCAGCTCCGTGCTGG + Exonic
1161361475 19:3852372-3852394 CCTGGAGGGCAGCTACCTGTTGG + Intronic
925099149 2:1230739-1230761 GCTGAAGAGCTGCTGAGTGTGGG - Intronic
926115760 2:10212246-10212268 GCAGAAGGGCTGCTCCCTGTGGG - Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
937960121 2:127452120-127452142 TCTGAAGGGCAGCTGCGGCTTGG - Intronic
938402564 2:131005369-131005391 GCTGGAGGGCAGCCCTGTGTGGG - Intronic
943661400 2:190563216-190563238 GCAGGAGGGCAGGTGCGTGTGGG - Intergenic
944800471 2:203233412-203233434 GCTGCAGGGCAGATACGGCTGGG - Intergenic
946482482 2:220070410-220070432 GCTGAAGGGGAGCAAGGGGTTGG - Intergenic
1169077136 20:2768221-2768243 CCTGAAGGGCTGATTCGTGTAGG + Intergenic
1176030045 20:63007370-63007392 GCTGAGGGGCCGCTTCGGGTCGG + Intergenic
1176086220 20:63296750-63296772 GCTGAAAGGCAGGAATGTGTGGG - Intronic
1177732113 21:25040988-25041010 CATGAACGGCAGCTACGAGTGGG + Intergenic
1178908240 21:36653785-36653807 GCAGAAGGCCAGTTAGGTGTGGG - Intergenic
1179804847 21:43830706-43830728 CCTGAAGGGCAGCTGTGTGAAGG - Intergenic
1180806731 22:18718511-18718533 GCTGAAGGGCATCGAGGCGTAGG + Intergenic
1181178848 22:21053437-21053459 TCTGAAGGCCAACAACGTGTTGG + Exonic
1181495261 22:23283988-23284010 GCTGAAGGACAGCTTCATGGTGG + Exonic
1181852152 22:25757270-25757292 ACTGAAGGGCAGCTACTTCCAGG + Intronic
1184633108 22:45801714-45801736 GCTGAAGGACAGCTAGTGGTTGG + Intronic
950330225 3:12150359-12150381 CCTGAAAGGCAGCTACTTGCAGG + Intronic
959893164 3:111579317-111579339 GCTGCAGAGCAGCCACATGTGGG + Intronic
969349322 4:6589154-6589176 GCGGAAGGGCACGTACCTGTTGG - Exonic
969511237 4:7619209-7619231 GCTTAAGGGTAGCTAAGTATTGG - Intronic
969691304 4:8705635-8705657 GCTGAGGGGAAGCTACGGGGAGG - Intergenic
990173378 5:53080411-53080433 GATGAAGGGCAACTACGAGGTGG - Intronic
1001117110 5:168948971-168948993 CCTGAAGGGCAGCCAGGTGTGGG - Intronic
1005020552 6:21414065-21414087 GGTGATAGGCAGCTATGTGTTGG + Intergenic
1006841058 6:37028076-37028098 GCTGAAGGGCCGCTGGGTGAAGG + Exonic
1007779855 6:44246539-44246561 GCTGAGGGGCAGCTCAGCGTAGG - Intronic
1013849650 6:114498409-114498431 GCTGAAGGGCTCCTAGGAGTGGG - Intergenic
1015538498 6:134291132-134291154 GCTGCAGCTCAGCCACGTGTGGG + Intronic
1017114040 6:150960196-150960218 GCTGAAGTCCAGCTCCTTGTGGG + Intronic
1017350554 6:153436532-153436554 GCTGAAGGGCAGCAGCCTCTTGG - Intergenic
1017658103 6:156649093-156649115 GATGCAGGGCTGCTACGTTTTGG + Intergenic
1017775468 6:157676924-157676946 GATGAAGGGCAGCTCCTTCTGGG - Exonic
1018209918 6:161470791-161470813 CCTGAAGGGCTGCCACATGTAGG + Intronic
1020911492 7:14137544-14137566 GCAGAAGGGGAGCTCAGTGTCGG - Intergenic
1025028039 7:55534401-55534423 CCTGAAGGGCAGCTGCGTGTAGG + Intronic
1030274805 7:107709229-107709251 GCTGCAGGCCAGCCATGTGTGGG + Intronic
1031011051 7:116525730-116525752 GCTGAAGGGCAGCTACGTGTTGG - Intronic
1033282781 7:140017703-140017725 CCCGAAGGGCAGGTACGTGAAGG - Exonic
1033413943 7:141145960-141145982 GCTGAAGGGTAACTATTTGTTGG + Intronic
1037124417 8:15328411-15328433 GAGGAAGGGCAGCTACGTTTGGG - Intergenic
1038428356 8:27479916-27479938 GCTGAAGGGAAGGAACGAGTGGG - Intergenic
1038446065 8:27605123-27605145 GCTGAAGGGCAGGTAGTGGTAGG + Exonic
1039935234 8:42037527-42037549 CCTGAAGAGCTGCTAAGTGTTGG - Intronic
1044858636 8:96499947-96499969 GCTGAAGTGCAGATACCCGTGGG + Intronic
1047448541 8:124941820-124941842 GCAGAAGGGCAGCAACGTTTTGG - Intergenic
1048072734 8:131039599-131039621 GCTGTACTGCAGGTACGTGTGGG + Exonic
1053428567 9:38027054-38027076 CCTGAATTGCAGCTATGTGTAGG + Intronic
1056755836 9:89381592-89381614 GCTGGAGGGCAGGCACCTGTGGG - Intronic
1056914246 9:90730740-90730762 GCCAAAGGGCAGCTACTTATGGG - Intergenic
1057212426 9:93207369-93207391 GCTGAAGGTCTGCTGCCTGTAGG - Intronic
1062379318 9:136279544-136279566 GCTGCAGGACAGCCACGTCTTGG - Intergenic
1203793299 EBV:162977-162999 GGAGACGGGCAGCTACGTGGCGG - Intergenic
1187614903 X:20982106-20982128 GCAGCAGGGCAGCAACGTGTCGG - Intergenic
1187825708 X:23332854-23332876 AGTGAAGGGCCGCTAGGTGTAGG + Intergenic
1193102838 X:77635617-77635639 GCCTAAGGGCAGCTAGGGGTTGG - Intronic
1201368178 Y:13231581-13231603 GCTCAAATGCAGCTACGTGGTGG - Intergenic