ID: 1031015659

View in Genome Browser
Species Human (GRCh38)
Location 7:116573732-116573754
Sequence CCTTCCACAGCCCCTTGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 375}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031015659_1031015663 1 Left 1031015659 7:116573732-116573754 CCCAGTCAAGGGGCTGTGGAAGG 0: 1
1: 0
2: 3
3: 23
4: 375
Right 1031015663 7:116573756-116573778 AGAGGAAGTTAATCTGAGACAGG No data
1031015659_1031015664 12 Left 1031015659 7:116573732-116573754 CCCAGTCAAGGGGCTGTGGAAGG 0: 1
1: 0
2: 3
3: 23
4: 375
Right 1031015664 7:116573767-116573789 ATCTGAGACAGGATTGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031015659 Original CRISPR CCTTCCACAGCCCCTTGACT GGG (reversed) Intergenic