ID: 1031023546

View in Genome Browser
Species Human (GRCh38)
Location 7:116654404-116654426
Sequence ATTGCCATAGGACACAGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031023546_1031023550 0 Left 1031023546 7:116654404-116654426 CCAAAACTGTGTCCTATGGCAAT No data
Right 1031023550 7:116654427-116654449 CCTTAGATGCAAAGGAATGCAGG No data
1031023546_1031023551 1 Left 1031023546 7:116654404-116654426 CCAAAACTGTGTCCTATGGCAAT No data
Right 1031023551 7:116654428-116654450 CTTAGATGCAAAGGAATGCAGGG No data
1031023546_1031023548 -8 Left 1031023546 7:116654404-116654426 CCAAAACTGTGTCCTATGGCAAT No data
Right 1031023548 7:116654419-116654441 ATGGCAATCCTTAGATGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031023546 Original CRISPR ATTGCCATAGGACACAGTTT TGG (reversed) Intergenic
No off target data available for this crispr