ID: 1031023550

View in Genome Browser
Species Human (GRCh38)
Location 7:116654427-116654449
Sequence CCTTAGATGCAAAGGAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031023545_1031023550 1 Left 1031023545 7:116654403-116654425 CCCAAAACTGTGTCCTATGGCAA No data
Right 1031023550 7:116654427-116654449 CCTTAGATGCAAAGGAATGCAGG No data
1031023546_1031023550 0 Left 1031023546 7:116654404-116654426 CCAAAACTGTGTCCTATGGCAAT No data
Right 1031023550 7:116654427-116654449 CCTTAGATGCAAAGGAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031023550 Original CRISPR CCTTAGATGCAAAGGAATGC AGG Intergenic
No off target data available for this crispr