ID: 1031025065

View in Genome Browser
Species Human (GRCh38)
Location 7:116671721-116671743
Sequence AACAAGGAGTTCATTGTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031025065_1031025077 22 Left 1031025065 7:116671721-116671743 CCTCTAACAATGAACTCCTTGTT No data
Right 1031025077 7:116671766-116671788 AAACCCGGGTGGGCGCGGGGCGG No data
1031025065_1031025073 12 Left 1031025065 7:116671721-116671743 CCTCTAACAATGAACTCCTTGTT No data
Right 1031025073 7:116671756-116671778 AAATCTCTCTAAACCCGGGTGGG No data
1031025065_1031025076 19 Left 1031025065 7:116671721-116671743 CCTCTAACAATGAACTCCTTGTT No data
Right 1031025076 7:116671763-116671785 TCTAAACCCGGGTGGGCGCGGGG No data
1031025065_1031025072 11 Left 1031025065 7:116671721-116671743 CCTCTAACAATGAACTCCTTGTT No data
Right 1031025072 7:116671755-116671777 CAAATCTCTCTAAACCCGGGTGG No data
1031025065_1031025069 8 Left 1031025065 7:116671721-116671743 CCTCTAACAATGAACTCCTTGTT No data
Right 1031025069 7:116671752-116671774 GCCCAAATCTCTCTAAACCCGGG No data
1031025065_1031025075 18 Left 1031025065 7:116671721-116671743 CCTCTAACAATGAACTCCTTGTT No data
Right 1031025075 7:116671762-116671784 CTCTAAACCCGGGTGGGCGCGGG No data
1031025065_1031025080 29 Left 1031025065 7:116671721-116671743 CCTCTAACAATGAACTCCTTGTT No data
Right 1031025080 7:116671773-116671795 GGTGGGCGCGGGGCGGTTAGCGG No data
1031025065_1031025074 17 Left 1031025065 7:116671721-116671743 CCTCTAACAATGAACTCCTTGTT No data
Right 1031025074 7:116671761-116671783 TCTCTAAACCCGGGTGGGCGCGG No data
1031025065_1031025068 7 Left 1031025065 7:116671721-116671743 CCTCTAACAATGAACTCCTTGTT No data
Right 1031025068 7:116671751-116671773 TGCCCAAATCTCTCTAAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031025065 Original CRISPR AACAAGGAGTTCATTGTTAG AGG (reversed) Intergenic
No off target data available for this crispr