ID: 1031025067

View in Genome Browser
Species Human (GRCh38)
Location 7:116671737-116671759
Sequence ATTTGGGCACCGCAGAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031025067_1031025069 -8 Left 1031025067 7:116671737-116671759 CCTTGTTTCTGCGGTGCCCAAAT No data
Right 1031025069 7:116671752-116671774 GCCCAAATCTCTCTAAACCCGGG No data
1031025067_1031025080 13 Left 1031025067 7:116671737-116671759 CCTTGTTTCTGCGGTGCCCAAAT No data
Right 1031025080 7:116671773-116671795 GGTGGGCGCGGGGCGGTTAGCGG No data
1031025067_1031025073 -4 Left 1031025067 7:116671737-116671759 CCTTGTTTCTGCGGTGCCCAAAT No data
Right 1031025073 7:116671756-116671778 AAATCTCTCTAAACCCGGGTGGG No data
1031025067_1031025082 22 Left 1031025067 7:116671737-116671759 CCTTGTTTCTGCGGTGCCCAAAT No data
Right 1031025082 7:116671782-116671804 GGGGCGGTTAGCGGAGACGTGGG No data
1031025067_1031025083 27 Left 1031025067 7:116671737-116671759 CCTTGTTTCTGCGGTGCCCAAAT No data
Right 1031025083 7:116671787-116671809 GGTTAGCGGAGACGTGGGAGAGG No data
1031025067_1031025074 1 Left 1031025067 7:116671737-116671759 CCTTGTTTCTGCGGTGCCCAAAT No data
Right 1031025074 7:116671761-116671783 TCTCTAAACCCGGGTGGGCGCGG No data
1031025067_1031025077 6 Left 1031025067 7:116671737-116671759 CCTTGTTTCTGCGGTGCCCAAAT No data
Right 1031025077 7:116671766-116671788 AAACCCGGGTGGGCGCGGGGCGG No data
1031025067_1031025075 2 Left 1031025067 7:116671737-116671759 CCTTGTTTCTGCGGTGCCCAAAT No data
Right 1031025075 7:116671762-116671784 CTCTAAACCCGGGTGGGCGCGGG No data
1031025067_1031025068 -9 Left 1031025067 7:116671737-116671759 CCTTGTTTCTGCGGTGCCCAAAT No data
Right 1031025068 7:116671751-116671773 TGCCCAAATCTCTCTAAACCCGG No data
1031025067_1031025072 -5 Left 1031025067 7:116671737-116671759 CCTTGTTTCTGCGGTGCCCAAAT No data
Right 1031025072 7:116671755-116671777 CAAATCTCTCTAAACCCGGGTGG No data
1031025067_1031025081 21 Left 1031025067 7:116671737-116671759 CCTTGTTTCTGCGGTGCCCAAAT No data
Right 1031025081 7:116671781-116671803 CGGGGCGGTTAGCGGAGACGTGG No data
1031025067_1031025076 3 Left 1031025067 7:116671737-116671759 CCTTGTTTCTGCGGTGCCCAAAT No data
Right 1031025076 7:116671763-116671785 TCTAAACCCGGGTGGGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031025067 Original CRISPR ATTTGGGCACCGCAGAAACA AGG (reversed) Intergenic
No off target data available for this crispr