ID: 1031025070

View in Genome Browser
Species Human (GRCh38)
Location 7:116671753-116671775
Sequence ACCCGGGTTTAGAGAGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031025070_1031025082 6 Left 1031025070 7:116671753-116671775 CCCAAATCTCTCTAAACCCGGGT No data
Right 1031025082 7:116671782-116671804 GGGGCGGTTAGCGGAGACGTGGG No data
1031025070_1031025083 11 Left 1031025070 7:116671753-116671775 CCCAAATCTCTCTAAACCCGGGT No data
Right 1031025083 7:116671787-116671809 GGTTAGCGGAGACGTGGGAGAGG No data
1031025070_1031025080 -3 Left 1031025070 7:116671753-116671775 CCCAAATCTCTCTAAACCCGGGT No data
Right 1031025080 7:116671773-116671795 GGTGGGCGCGGGGCGGTTAGCGG No data
1031025070_1031025077 -10 Left 1031025070 7:116671753-116671775 CCCAAATCTCTCTAAACCCGGGT No data
Right 1031025077 7:116671766-116671788 AAACCCGGGTGGGCGCGGGGCGG No data
1031025070_1031025081 5 Left 1031025070 7:116671753-116671775 CCCAAATCTCTCTAAACCCGGGT No data
Right 1031025081 7:116671781-116671803 CGGGGCGGTTAGCGGAGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031025070 Original CRISPR ACCCGGGTTTAGAGAGATTT GGG (reversed) Intergenic
No off target data available for this crispr