ID: 1031025077

View in Genome Browser
Species Human (GRCh38)
Location 7:116671766-116671788
Sequence AAACCCGGGTGGGCGCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031025063_1031025077 28 Left 1031025063 7:116671715-116671737 CCTCCGCCTCTAACAATGAACTC No data
Right 1031025077 7:116671766-116671788 AAACCCGGGTGGGCGCGGGGCGG No data
1031025065_1031025077 22 Left 1031025065 7:116671721-116671743 CCTCTAACAATGAACTCCTTGTT No data
Right 1031025077 7:116671766-116671788 AAACCCGGGTGGGCGCGGGGCGG No data
1031025064_1031025077 25 Left 1031025064 7:116671718-116671740 CCGCCTCTAACAATGAACTCCTT No data
Right 1031025077 7:116671766-116671788 AAACCCGGGTGGGCGCGGGGCGG No data
1031025067_1031025077 6 Left 1031025067 7:116671737-116671759 CCTTGTTTCTGCGGTGCCCAAAT No data
Right 1031025077 7:116671766-116671788 AAACCCGGGTGGGCGCGGGGCGG No data
1031025070_1031025077 -10 Left 1031025070 7:116671753-116671775 CCCAAATCTCTCTAAACCCGGGT No data
Right 1031025077 7:116671766-116671788 AAACCCGGGTGGGCGCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031025077 Original CRISPR AAACCCGGGTGGGCGCGGGG CGG Intergenic
No off target data available for this crispr