ID: 1031025197

View in Genome Browser
Species Human (GRCh38)
Location 7:116672252-116672274
Sequence CGGCCCGGGCGCGTTGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 276}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031025197_1031025207 4 Left 1031025197 7:116672252-116672274 CCGGCCCCAACGCGCCCGGGCCG 0: 1
1: 0
2: 4
3: 22
4: 276
Right 1031025207 7:116672279-116672301 GGGCCGCGCGCGCCGATGCCCGG 0: 1
1: 0
2: 1
3: 14
4: 129
1031025197_1031025210 16 Left 1031025197 7:116672252-116672274 CCGGCCCCAACGCGCCCGGGCCG 0: 1
1: 0
2: 4
3: 22
4: 276
Right 1031025210 7:116672291-116672313 CCGATGCCCGGCTGAGTCACTGG 0: 1
1: 0
2: 1
3: 7
4: 36
1031025197_1031025211 20 Left 1031025197 7:116672252-116672274 CCGGCCCCAACGCGCCCGGGCCG 0: 1
1: 0
2: 4
3: 22
4: 276
Right 1031025211 7:116672295-116672317 TGCCCGGCTGAGTCACTGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 206
1031025197_1031025212 21 Left 1031025197 7:116672252-116672274 CCGGCCCCAACGCGCCCGGGCCG 0: 1
1: 0
2: 4
3: 22
4: 276
Right 1031025212 7:116672296-116672318 GCCCGGCTGAGTCACTGGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031025197 Original CRISPR CGGCCCGGGCGCGTTGGGGC CGG (reversed) Intergenic
900117186 1:1033783-1033805 GGGGCCGGGAGCGCTGGGGCTGG - Intronic
900201254 1:1407606-1407628 CGGCGCGGGCGGGGAGGGGCAGG + Intergenic
900349760 1:2228718-2228740 GGGCCCGGGCGCGCGGGAGCGGG + Exonic
900629289 1:3625159-3625181 CGGCCCGGGCGGGGGGCGGCCGG + Exonic
900647845 1:3717157-3717179 CGGCACGGGCAGGTTTGGGCAGG - Intronic
903044445 1:20554424-20554446 CGGCCGGGGAGAATTGGGGCCGG + Exonic
903211887 1:21823345-21823367 CGGCCTGGGCGCGGTGCTGCAGG + Exonic
903777059 1:25800141-25800163 CGGCCGGGGCGGGGAGGGGCGGG - Intergenic
903828834 1:26162858-26162880 CGGGCCGGGCGCGGTGGCTCAGG + Intergenic
904062987 1:27725928-27725950 GGACCCGGGCGGGCTGGGGCGGG - Intergenic
908241847 1:62194969-62194991 TGGCCCAGGCGCGTGGGGTCCGG + Intronic
910200145 1:84690553-84690575 CGGCGCCGGCGCGCGGGGGCGGG - Intronic
912955879 1:114153814-114153836 CGCCCCGGCCGCACTGGGGCGGG + Intronic
915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG + Exonic
915477396 1:156161146-156161168 CGGGCCTGGCGGGGTGGGGCGGG + Intronic
916548453 1:165828087-165828109 CGGCCTGGGGGCGCTGCGGCGGG + Intronic
917777055 1:178349078-178349100 CGGGCCGGGCGCGGTGGCTCAGG - Intronic
918450190 1:184650301-184650323 AGACCCGGGTGCCTTGGGGCTGG + Intergenic
919451190 1:197775106-197775128 GGGCCCGGGCGCGTCGGGGGCGG - Intronic
920045221 1:203128346-203128368 CGGGCCGCGCGCGGTAGGGCTGG - Intronic
920260626 1:204685558-204685580 CGCCCTGGGCGCGTCGCGGCCGG + Intronic
923744405 1:236686819-236686841 CCGCCCGCGCGTGGTGGGGCCGG + Intronic
924624587 1:245688205-245688227 CGGGCCGCGCGCTCTGGGGCTGG - Exonic
1066220755 10:33335115-33335137 CGCCCCGGTCGCGTGGGTGCGGG + Intronic
1067060920 10:43077517-43077539 CGGGCCGGGCGCCTCGGGCCGGG + Intronic
1068545078 10:58335444-58335466 GGGCCCGCGCGCGTTCGCGCCGG + Intronic
1069662543 10:70132899-70132921 CGGTCCTGGCACGCTGGGGCTGG + Exonic
1070280320 10:75043733-75043755 CGGGCGGGGCGAGTCGGGGCGGG + Intronic
1070975597 10:80603616-80603638 CGTCCCGGGCGCGCTGGGCTCGG - Exonic
1074772446 10:116742656-116742678 CGGCCCGAGCTCGGAGGGGCGGG - Intergenic
1075032047 10:119030074-119030096 CGGGCCTGGGGCGCTGGGGCCGG + Exonic
1076751595 10:132546167-132546189 CGTCCTGGGTGGGTTGGGGCTGG + Intronic
1077038550 11:507227-507249 CGGCGCGGGCGTGTTCGAGCCGG + Intronic
1077160071 11:1108661-1108683 CAACCCGGCCGCGTCGGGGCCGG - Intergenic
1083747636 11:64744645-64744667 CGGCGCGGGCGGGCTGGGGGCGG - Intronic
1083753869 11:64778573-64778595 CGGGCCGGGGGCGGCGGGGCCGG + Intronic
1084024753 11:66440992-66441014 CTGCCCGGGGCCGGTGGGGCCGG + Intronic
1084083359 11:66843352-66843374 GGGCCCGGGCGGGGCGGGGCGGG + Intronic
1084400804 11:68941817-68941839 CGGGCCGGGCGGGTGGGGGGTGG + Intergenic
1086888293 11:92226994-92227016 GGGCCGGGGCGGGTTGGGGGAGG - Intergenic
1089543809 11:119206747-119206769 CCGGCCGGGGGCGTGGGGGCAGG + Intronic
1089966212 11:122656402-122656424 CGGCGCGGGGGCGTTGGGCCAGG + Intronic
1091616202 12:2052926-2052948 GGGCGCGGGCGCGGCGGGGCTGG + Intronic
1091749718 12:3014780-3014802 CGGCCTGGGCAGGGTGGGGCAGG - Intronic
1092155384 12:6278755-6278777 CGGCCAGGGCGCGGCCGGGCGGG + Intergenic
1092160014 12:6310870-6310892 CGGCCCGGGGGCGGGGCGGCCGG + Intronic
1094653589 12:32399988-32400010 TGGCCCCGGCGCGTAGGTGCGGG + Intronic
1095533967 12:43224424-43224446 CTGCCCGGGGCCGGTGGGGCCGG - Intergenic
1095752253 12:45726964-45726986 CGGCCCTGGCGGGTCGCGGCCGG - Intergenic
1096494672 12:52033166-52033188 CGGGCTGGGCGGGGTGGGGCCGG - Intronic
1096674890 12:53221116-53221138 CGGCCTGGGCGGGGTGGGGCGGG - Intronic
1096741253 12:53695655-53695677 AGGCGAGGGCGCGCTGGGGCGGG + Intergenic
1097267655 12:57755316-57755338 CGGCCCGGGGGCGGCGGGGTGGG - Exonic
1098805936 12:75020202-75020224 AGGCCCAGGAGCGATGGGGCTGG + Intergenic
1102387246 12:112520148-112520170 CTGCCCGGGGCCGGTGGGGCCGG + Intergenic
1102457166 12:113077955-113077977 CGGCGCGGGCTCGGCGGGGCCGG - Exonic
1103085708 12:118060931-118060953 CGGGCTGGGCGGGGTGGGGCGGG - Intronic
1104929069 12:132328891-132328913 CACCCCGGGCGCGATGGGTCAGG - Intronic
1106242014 13:27920294-27920316 CGCCCTGGGCGCGCTGGAGCAGG + Exonic
1107086285 13:36431404-36431426 CGGCCCGGCCGCGTGGGGAGAGG - Intergenic
1108314132 13:49221183-49221205 AGGCCCGGCCGCCTCGGGGCGGG + Exonic
1109145396 13:58773419-58773441 CTGCCCGGGGTCGGTGGGGCCGG - Intergenic
1109506198 13:63306065-63306087 GGGACCGGGCGCGGTGGAGCAGG - Intergenic
1109563168 13:64077753-64077775 CTGCCCGGGGCCGGTGGGGCCGG + Intergenic
1112752558 13:102597220-102597242 GGGCCCGGGCGCGGGGGCGCGGG + Intronic
1113906255 13:113820659-113820681 GGGCCCGGGCGCGGGGAGGCCGG - Exonic
1113994782 14:16056810-16056832 CCGCCCGCTCCCGTTGGGGCTGG + Intergenic
1114270706 14:21098425-21098447 CGGGCCGGGGGCGGGGGGGCCGG - Exonic
1118854703 14:69611843-69611865 CGGCCCGGGGGCGGCGGGGCCGG + Intronic
1121711005 14:96039297-96039319 CGGGCGGGGCGGGGTGGGGCGGG - Intergenic
1123630767 15:22258262-22258284 CGGCCGGGGCGCGCCGGGACCGG - Intergenic
1123716737 15:23039304-23039326 GGGTCGGGGCGCGCTGGGGCAGG - Intronic
1124002383 15:25770145-25770167 CGACCCGGGCGAGGTGGGGAGGG + Intronic
1124002400 15:25770198-25770220 CGACCCGGGCGAGGTGGGGAGGG + Intronic
1124927624 15:34086708-34086730 CTGGCCGGGCGCGGTGGCGCAGG - Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1129894264 15:79091771-79091793 TGGCCCGGGCGCTTTGCAGCGGG + Intergenic
1132480639 16:164831-164853 CGGCCGGGGCCCGGCGGGGCGGG + Intronic
1132547567 16:540345-540367 GGGCCCGGGGCCGTGGGGGCTGG - Intronic
1132558616 16:583552-583574 GGGCCCGGGCCCGCTGGGGACGG - Exonic
1132956638 16:2597806-2597828 CGGCCAAGCCGCGCTGGGGCAGG - Exonic
1134554645 16:15154816-15154838 CGGACGGGGCGCGGTGGGGGCGG + Intergenic
1136236130 16:28914640-28914662 CGGCCAGGGGGCGCTGGGGAAGG - Intronic
1136408915 16:30065364-30065386 CGGGCCGCGCGCGCTGGGCCTGG + Intronic
1137426393 16:48384870-48384892 CCTCCCGGGCGCGCGGGGGCCGG + Intronic
1137787440 16:51150738-51150760 CGGGCCGGGTGCCCTGGGGCCGG + Intronic
1140113249 16:72021244-72021266 CAGCCCGGCAGTGTTGGGGCTGG - Exonic
1141132159 16:81444399-81444421 CGGCCCGGGGGCGGCGGGGGTGG + Intergenic
1141660085 16:85436879-85436901 CGGCCCGGGACTGTGGGGGCGGG + Intergenic
1141800430 16:86304194-86304216 CGGGCAGGGAGCGTGGGGGCGGG + Intergenic
1141959253 16:87393039-87393061 CGTCCCGGGCGCGGCGAGGCCGG - Intronic
1141972277 16:87492311-87492333 CGGCCGGGGCGCGCCGGGACCGG + Intergenic
1142474077 17:179768-179790 CTGCCCTGGGGCGTGGGGGCTGG - Intronic
1142637727 17:1268414-1268436 CGGCCCGGGCGGGGGCGGGCGGG - Intergenic
1142712783 17:1732506-1732528 GGGCCAGGGCGGGCTGGGGCGGG + Intronic
1143375414 17:6464197-6464219 CGGCCCCGGCGCCTGGGGGTTGG - Exonic
1143496425 17:7315242-7315264 CCGCCCGCGCGCGGTGGGACTGG - Intronic
1143708664 17:8718335-8718357 CTGCCCGGGCCCGGTGGGGCCGG + Intergenic
1143876735 17:9997234-9997256 GGGGCCGGGCGGGTGGGGGCGGG + Intronic
1144847052 17:18225566-18225588 CGGCCCGGGCGCGGGCGCGCGGG - Exonic
1145094836 17:20016572-20016594 CTGCCTGGGGCCGTTGGGGCCGG - Intronic
1145962922 17:28897746-28897768 CGGGGCCGGCGCGTTGAGGCAGG + Intergenic
1146053309 17:29568665-29568687 CGGCGCGGGGGCGCTGGGGCTGG + Exonic
1146283228 17:31558835-31558857 CGGCCCGGGAGCGGAGCGGCCGG + Intergenic
1146654275 17:34626148-34626170 CGGCCCCGGCGGGCTGGGGCTGG - Exonic
1147636353 17:41966830-41966852 CGGCCCCGGAGCGCTGGTGCCGG + Exonic
1147740795 17:42670102-42670124 CGGGCCCGGCGCGGCGGGGCCGG - Exonic
1148048650 17:44758898-44758920 CGGCCCGGGCCCTGCGGGGCTGG + Intergenic
1148722534 17:49764023-49764045 GGGCCGGGGCGCGGAGGGGCCGG - Exonic
1148945655 17:51260061-51260083 CGGCGCAGGCGCGCTGGGGAGGG - Exonic
1149994641 17:61400145-61400167 CGGCCCAGGCGCCCGGGGGCCGG - Exonic
1150643592 17:66965067-66965089 CGCCGCGGGCGCGGCGGGGCGGG - Exonic
1151559165 17:74861549-74861571 GAGCCCGGGCGCGGCGGGGCGGG + Intergenic
1151679204 17:75614877-75614899 AGGCCCCGGGGGGTTGGGGCAGG - Intergenic
1151854393 17:76710755-76710777 CGGCTCGGGGGCGCAGGGGCGGG + Exonic
1152407878 17:80107905-80107927 CGGCCCGGGCGCTGGGCGGCGGG - Intergenic
1152571359 17:81122641-81122663 GGGCCCGGGCCCGGTGCGGCGGG - Exonic
1152697497 17:81804314-81804336 CGGGGCGGGCGCGGCGGGGCCGG + Intronic
1153480591 18:5543405-5543427 CCGCCCGGGCGGGTGGCGGCTGG - Intronic
1153688388 18:7567911-7567933 CGGCCCGCGCGCCTCGGGGGCGG - Intronic
1153805447 18:8705821-8705843 CGGGCCGGGCGCGGCGGGCCGGG - Intronic
1155570350 18:27185380-27185402 CTGCCCGGGCGGGCGGGGGCGGG - Intergenic
1159221666 18:65472952-65472974 CGGGCCGGGCGCGGTGGCTCAGG - Intergenic
1160003924 18:75054018-75054040 AGGCCCGGGCTCTTTGAGGCAGG - Intronic
1160178173 18:76612761-76612783 TGGCCAGGGTGCGATGGGGCGGG + Intergenic
1160204514 18:76822317-76822339 GGGCGCGGGCGCGGTGGGGGCGG - Intergenic
1160597758 18:79988799-79988821 CGGGGCGGGAGCGTGGGGGCAGG - Intronic
1160967547 19:1753307-1753329 CCGCCCGCGCCCGCTGGGGCAGG - Exonic
1161215620 19:3094038-3094060 CGGCCCAGGCGCGGTGGCGGAGG - Intergenic
1161490002 19:4556516-4556538 CGGGCCGGGGGCGTGGGGGGCGG + Intronic
1161949447 19:7459707-7459729 ATGCCCTGGCGCTTTGGGGCGGG + Intronic
1161959555 19:7516208-7516230 CGGCGCGGGCGCGGCGGGCCGGG + Exonic
1162957336 19:14106825-14106847 CGGCACGGGCTCCTTCGGGCGGG - Exonic
1163118462 19:15201422-15201444 CGGACCGGGCGCGGTGGCTCCGG + Intergenic
1163551180 19:17967171-17967193 GGGCCCGGGGGCGGCGGGGCCGG - Intronic
1163807173 19:19406225-19406247 CGGCCCGGGCACGTGGGGGCCGG + Intronic
1164583575 19:29450519-29450541 CTGCCTGGGGGCGCTGGGGCAGG - Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1165058609 19:33194391-33194413 CGGCCCGGGGACGCCGGGGCCGG + Intronic
1165157860 19:33798568-33798590 GGGCCAGGGCGCACTGGGGCTGG + Exonic
1165355161 19:35299864-35299886 CGGGCGGGGCGGGGTGGGGCGGG + Intronic
1166107058 19:40602611-40602633 TGGCACAGGCACGTTGGGGCTGG - Intronic
1166524964 19:43504905-43504927 CGGGCCGGGGCCGGTGGGGCCGG - Exonic
1166986184 19:46661076-46661098 GGGCCCGGCCGGGCTGGGGCGGG - Exonic
1167633453 19:50639707-50639729 CGGCCCCGGCGCATGGGGGCGGG - Intronic
1168240654 19:55087269-55087291 CAGCCCGGGCGCGGTCAGGCCGG - Intronic
1168316029 19:55485160-55485182 CAGACCGCGCGCGGTGGGGCGGG - Exonic
927696989 2:25245642-25245664 CGGCCTGGGAGGATTGGGGCAGG - Intronic
936174244 2:110205059-110205081 CGGCCCGGGCGGGGCGGGGCTGG - Intronic
937208455 2:120252371-120252393 CCGCCCGGGGGTCTTGGGGCGGG - Intronic
937932882 2:127219708-127219730 CGGGGCGGGGGCGTTGGGGAGGG - Intronic
937993098 2:127674984-127675006 CGGCCCGGGGGCGTGGGTGGGGG + Intronic
938364670 2:130725669-130725691 GGGCCCGGGGGCGGGGGGGCTGG + Intergenic
941104901 2:161341135-161341157 CGGCTCGGGGGCGCAGGGGCGGG + Intronic
942178150 2:173354827-173354849 CGACCCGGGCCCGGAGGGGCGGG - Intronic
942464018 2:176189149-176189171 CTTCCCGGGCGTGCTGGGGCGGG + Exonic
944154050 2:196592856-196592878 CGGCCCCGGCGCCCTGCGGCCGG + Intronic
946391260 2:219418253-219418275 CGGCCCGTGGCCGTGGGGGCGGG - Intergenic
947860466 2:233354422-233354444 CGGGCCGGGGGCGGTGGGGGCGG - Intergenic
948963248 2:241356403-241356425 CGGCCTGGGCGCGTGGGGCAGGG + Intronic
949004281 2:241636812-241636834 CGGCCGGGGCGCGGGGGAGCGGG - Intronic
949009728 2:241671630-241671652 CTGCCCGGGCGCTGTGGAGCTGG + Intronic
949080102 2:242089288-242089310 CGGCCCAGGAGGGTGGGGGCGGG - Intergenic
1168773831 20:432606-432628 CGGCCCTGGAGAGTTGGTGCTGG - Intergenic
1169345154 20:4823327-4823349 CGGCGCGGGCGCGATGCAGCTGG - Intronic
1172037363 20:32019330-32019352 CGGGTCGAGCGGGTTGGGGCCGG - Exonic
1172547332 20:35772107-35772129 CGGCCGGGCCGGGTTGGGCCGGG + Intronic
1173279697 20:41617902-41617924 GGGCCCAGCCGCGCTGGGGCGGG - Intronic
1174247033 20:49188917-49188939 TGGCCCGGGCGCGTTGGCTCAGG + Intergenic
1175266949 20:57709178-57709200 CGGCGCGGGAGGGTTGGGGCGGG - Intronic
1175399679 20:58693154-58693176 CGGCCCGGCCTCGTTGGGCCCGG - Intronic
1176243002 20:64083740-64083762 CGGCCGGGGCGGGGCGGGGCGGG - Intronic
1176549957 21:8216880-8216902 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1176568883 21:8399914-8399936 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1176576797 21:8444149-8444171 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1178082221 21:29077375-29077397 CTGCCCGGGGCCGGTGGGGCCGG + Intergenic
1178610310 21:34073807-34073829 CGGCCAGGGCGCGCGGGGGACGG - Intronic
1178948389 21:36966675-36966697 CGGGCCTGGGGCGCTGGGGCGGG - Intronic
1179279978 21:39925753-39925775 CTGCCCGGGAGTGATGGGGCTGG + Intronic
1179423251 21:41252642-41252664 CGGCCTGGTGGCGTTGGGGAAGG - Intronic
1179626896 21:42653935-42653957 GGGGCCGGGCGCGGCGGGGCGGG + Intronic
1180014637 21:45074383-45074405 GGGCGCGGGGCCGTTGGGGCTGG - Intronic
1180312310 22:11250599-11250621 CCGCCCGCTCCCGTTGGGGCTGG - Intergenic
1181094324 22:20495534-20495556 GGGCGCGGGCGCGTAGGGGCCGG - Intronic
1182211322 22:28679720-28679742 CGGCCCGGGCCCCGTGGGGATGG - Exonic
1182472186 22:30555364-30555386 CGGCACGGGCGAGTCGCGGCGGG + Exonic
1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG + Intronic
1184233515 22:43171034-43171056 GGGTCGGGGAGCGTTGGGGCTGG + Intronic
1184711169 22:46250301-46250323 TGGCCGGGCCGCGGTGGGGCGGG - Exonic
1185381158 22:50508010-50508032 CGGGCGGGGCGGGGTGGGGCGGG - Intergenic
1203254847 22_KI270733v1_random:133206-133228 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1203262903 22_KI270733v1_random:178285-178307 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
950902993 3:16513695-16513717 CGGCGGGGGCGCGTCGGGGCTGG - Exonic
952713308 3:36453447-36453469 CTGCCCGGGGCCGGTGGGGCCGG - Intronic
954437490 3:50503733-50503755 CGGCGGGGGCGCGCGGGGGCGGG - Intronic
955003827 3:54951458-54951480 CGGCCCGGGGGCAGTGGGGTGGG + Intronic
960199414 3:114812912-114812934 CTGCCCGGGGCCGGTGGGGCAGG + Intronic
961077121 3:123992347-123992369 CGGGCTGGGGGCGTTGGGGGTGG + Intergenic
961307455 3:125968953-125968975 CGGGCTGGGGGCGTTGGGGGTGG - Intergenic
961574407 3:127823044-127823066 CGGCACTGGCGGGCTGGGGCAGG + Intronic
964482801 3:157159637-157159659 CGGCCGGGGCGTGCCGGGGCGGG - Intronic
966866659 3:184261892-184261914 CTGGCCGGGCGCGTTGGGGCGGG + Intronic
966886463 3:184380207-184380229 CGGGCCGGGGGCGGTGCGGCGGG - Exonic
968815327 4:2818662-2818684 CGGGCCGGGCGCGGTTGGGCGGG + Intronic
968965548 4:3767494-3767516 GCGCCGGGGCGCGTTGCGGCGGG + Exonic
969726231 4:8920099-8920121 CGGCCCGGGCTCGGTGGCCCAGG - Intergenic
971280544 4:25239490-25239512 CTGCCCGGGGCCGGTGGGGCCGG + Intronic
974134069 4:57792335-57792357 CGGGCCGGGCGCGGTGGCTCAGG - Intergenic
978749532 4:112231710-112231732 GGGCCTGGGCGCGCTGGGGGCGG + Intergenic
983940227 4:173529397-173529419 GGGCCCGGGCGCCCGGGGGCTGG - Exonic
984901739 4:184592011-184592033 CTGCCCGGGGCCGGTGGGGCCGG - Intergenic
985520996 5:373838-373860 CTGCCCGGGCGGGCGGGGGCGGG + Intronic
985696605 5:1344638-1344660 GGGGCCGGGCGGGTTGGGGTGGG - Intronic
985727541 5:1523957-1523979 CGGGCCGGGCGCGCAGGCGCGGG + Exonic
985963788 5:3324583-3324605 CTGACCCGGCGCGGTGGGGCTGG + Intergenic
985995713 5:3595965-3595987 CCGGCCGGGCGCGCTCGGGCGGG - Intergenic
986288501 5:6378635-6378657 CGGGACGGGCGTGTTGGGGCGGG + Intergenic
986330703 5:6714210-6714232 CGCGGCGGGCGCGGTGGGGCCGG - Intergenic
986661738 5:10065592-10065614 CTGCCCCGGCCCGCTGGGGCCGG - Intergenic
987709524 5:21490884-21490906 CGGGCCGGGCGCATTGGTTCAGG + Intergenic
988489142 5:31692227-31692249 CTGCCCGGGGCCGGTGGGGCCGG + Intronic
988750089 5:34183276-34183298 CGGGCCGGGCGCATTGGTTCAGG - Intergenic
989592223 5:43121858-43121880 CGGCCCCGGAGCGTTGAGACCGG - Exonic
990557553 5:56951610-56951632 CAGCCCGGGCCCGGTGGGCCGGG + Intronic
992105539 5:73447291-73447313 CGGCCCGGGCGCCTCAGCGCTGG - Exonic
994461194 5:100068362-100068384 CGGGCCGGGCGCATTGGTTCAGG - Intergenic
994485344 5:100381808-100381830 CGGGCCGGGCGCATTGGTTCAGG - Intergenic
994935279 5:106246356-106246378 CTGCCCGGGGCCGGTGGGGCTGG - Intergenic
997581087 5:135017551-135017573 CGGGCCGGGCGCGGTGGCTCAGG + Intergenic
997584058 5:135034349-135034371 CGGCGCGGGCGGCTTGGGGCTGG - Intronic
1001734910 5:173989609-173989631 GGGACCGGGCGCGGCGGGGCGGG + Intronic
1002927115 6:1611071-1611093 CGGACCGGGCGCGTTGCCGTCGG - Exonic
1003290735 6:4776482-4776504 GGGGCCGGGCGGGCTGGGGCGGG - Exonic
1004262067 6:14117537-14117559 CGGCCCGGGCGCGCGGGGGCGGG + Intronic
1004562009 6:16760677-16760699 CGGCCTCGGCGCCCTGGGGCGGG - Intronic
1005548153 6:26889609-26889631 CGGGCCGGGCGCATTGGTTCAGG - Intergenic
1005928924 6:30466381-30466403 AGGCCCGGGCGAGCTCGGGCGGG + Intergenic
1007785249 6:44276083-44276105 CGGCCCGGGCGCGGCGGGCGTGG + Exonic
1009018913 6:57930706-57930728 CGGGCCGGGCGCATTGGTTCAGG - Intergenic
1010229394 6:73521390-73521412 CGGTCGGGGCGGGTTGGGGGGGG + Intronic
1013225584 6:108117847-108117869 CGGCCTCGGGGCGGTGGGGCAGG - Intronic
1013978215 6:116100828-116100850 CGGGCCGGACGCGGCGGGGCGGG - Exonic
1014205285 6:118650767-118650789 CGGCCCGGGCGCGTCTCGGAGGG - Intronic
1015898484 6:138039701-138039723 AGGCCCGGGCGCGGTGGCTCAGG - Intergenic
1015995020 6:138988223-138988245 TGGTGCGGGCGCGTCGGGGCCGG - Exonic
1017497599 6:154995461-154995483 CGCGCCGGGCTCGGTGGGGCCGG - Intronic
1017919028 6:158855585-158855607 AGGGCCGGGCGCGGTGGTGCAGG - Intergenic
1018025880 6:159805258-159805280 CGGACCGGGGGCCTTGGGGCTGG + Intronic
1019279488 7:192814-192836 CGGCCGGGGCGCGACGGGCCTGG - Intergenic
1019381724 7:727475-727497 CGGGCGGGGTGCTTTGGGGCAGG - Intronic
1019456581 7:1130704-1130726 GGCCCCGGGCGGGTGGGGGCGGG + Intronic
1020016526 7:4834918-4834940 AGGCCCGGGCGGGCAGGGGCTGG + Exonic
1020037622 7:4974306-4974328 AGGCCCGGGCGGGATCGGGCCGG + Intergenic
1020105360 7:5420184-5420206 CTGCCCAGGCGCGGTGGGGACGG - Intronic
1021761287 7:23904968-23904990 CTGCCCGGGGCCGGTGGGGCCGG + Intergenic
1022018446 7:26376225-26376247 CGGCCCGGGCGGGACGCGGCGGG - Intergenic
1023038397 7:36152843-36152865 GGGCCAGGGCGCGATGGGGTAGG - Intergenic
1023791861 7:43758890-43758912 GGGCCCGGGCGGGGCGGGGCGGG - Intronic
1024707187 7:51973176-51973198 CGGGCGGGGCGGGTGGGGGCGGG - Intergenic
1026850375 7:73719747-73719769 GGGCCCGGGCGGGGTGGGGCGGG - Intergenic
1029537002 7:101162959-101162981 CGGCGGGGGCGCGCGGGGGCGGG + Exonic
1029903956 7:104071902-104071924 CTGCCCGGGGCCGGTGGGGCCGG - Intergenic
1030018088 7:105244610-105244632 CGGCCCTGGCGCGCTGGGGCTGG - Intronic
1030138931 7:106285333-106285355 CGGCACGGGCGCGGGAGGGCGGG + Intronic
1031025197 7:116672252-116672274 CGGCCCGGGCGCGTTGGGGCCGG - Intergenic
1031317277 7:120273379-120273401 CGGCGTTGGCGCGGTGGGGCCGG - Intergenic
1033165616 7:139036163-139036185 CGGCCCCGGCGCGTGGAAGCAGG + Intergenic
1033299814 7:140176339-140176361 AGCCCCGGGCGCGGCGGGGCGGG + Intronic
1034272128 7:149808461-149808483 CTGCCAGGGCGTGTTGGGGGCGG - Intergenic
1034436071 7:151063244-151063266 CGGGCCGGGGGCCTGGGGGCTGG + Intronic
1034951087 7:155297644-155297666 CGGCCCGCGCGCACTCGGGCGGG - Intergenic
1035538145 8:407551-407573 CGGCCCAGGAGGGTGGGGGCGGG - Intronic
1035747545 8:1973483-1973505 CGGCCCCCGCGCGTGGGCGCGGG + Intergenic
1036930472 8:12951538-12951560 CTTCCCGGGCACGTTCGGGCGGG + Intronic
1037830924 8:22188532-22188554 CAGCCCGGAAGCGGTGGGGCAGG + Intronic
1037888019 8:22605115-22605137 GGGCCCGGGAGCGTGGGAGCAGG + Intronic
1038644042 8:29348897-29348919 CGGGCAGGGCGCGTGGGGTCCGG - Intronic
1044820751 8:96154241-96154263 TGGCCCCGGCGCCTGGGGGCGGG - Intronic
1045510716 8:102810442-102810464 CGGCCCGGGCGCGGCGGGACAGG + Intergenic
1049621066 8:143598548-143598570 GGGCCGGGGCGCGGTCGGGCAGG - Exonic
1049654384 8:143791374-143791396 CAGCCCTGGTGAGTTGGGGCCGG - Exonic
1049792706 8:144479334-144479356 CAGCCCGGGGGACTTGGGGCAGG - Intronic
1050539198 9:6655649-6655671 CATCCCAGGCGCGATGGGGCAGG - Intergenic
1051130148 9:13851532-13851554 CGGGCCGGGCGCGGTGGCTCAGG + Intergenic
1056475097 9:86945887-86945909 CTGCCCGGGCGCGGTGGGTGCGG + Exonic
1059414873 9:114156230-114156252 CTGCCCGATCCCGTTGGGGCGGG + Intronic
1060594242 9:124838969-124838991 TGGCCCGGGGCCGGTGGGGCCGG + Intergenic
1061007235 9:127935141-127935163 CAGCCCTGGGGCTTTGGGGCTGG + Exonic
1061580012 9:131530901-131530923 GGGCCGGGGCGGGCTGGGGCGGG - Intronic
1061843823 9:133375866-133375888 CGGCCCGGGCGGCCTGGGTCGGG + Intronic
1061922791 9:133791324-133791346 GGGCCCAGGCTCGGTGGGGCCGG - Intronic
1062548934 9:137077274-137077296 CGGACCGGACGCGGGGGGGCTGG + Intergenic
1062548974 9:137077383-137077405 GGGACCGGGCGGGATGGGGCGGG + Intergenic
1203471248 Un_GL000220v1:116351-116373 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1203479069 Un_GL000220v1:160323-160345 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1186496348 X:10015238-10015260 CGGCCCGGGCGAGCAGGGGCAGG - Intergenic
1189325249 X:40107710-40107732 CGGCTCGGGCGCAGCGGGGCTGG - Intronic
1195894699 X:109733423-109733445 CGTCCCGGGCGAGCGGGGGCGGG - Intergenic
1197754310 X:129983713-129983735 CGGGCCGGGCGCGGCGGGGAGGG + Intronic
1199772711 X:150984317-150984339 CGGCCCGGGCGGGGCGGGGCGGG + Intronic
1199772830 X:150984703-150984725 CGGCCCGGGCGGGGCGGGACCGG - Intronic
1200086880 X:153611414-153611436 CGGCCCGGGGGGGTGGGGGGTGG - Intergenic
1200216740 X:154371460-154371482 CGGGCGGGGCGGGGTGGGGCAGG - Intronic