ID: 1031025650

View in Genome Browser
Species Human (GRCh38)
Location 7:116676857-116676879
Sequence AGGTATTTCCCTACAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031025650_1031025656 26 Left 1031025650 7:116676857-116676879 CCTGTTTTTGTAGGGAAATACCT 0: 1
1: 0
2: 0
3: 11
4: 176
Right 1031025656 7:116676906-116676928 CATGTTAAAGATGAAGATACAGG 0: 1
1: 1
2: 7
3: 165
4: 1015

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031025650 Original CRISPR AGGTATTTCCCTACAAAAAC AGG (reversed) Intronic
904582130 1:31551970-31551992 AGGTATTTCCCCAAGAAATCTGG - Intergenic
906815854 1:48877725-48877747 TGGTATTTCACTACATGAACTGG - Intronic
907606397 1:55822056-55822078 AGTTATTTACCTACAAGAATTGG - Intergenic
908362041 1:63378183-63378205 AGGCATTTTCAGACAAAAACTGG - Intronic
909310935 1:74148190-74148212 AAGTACTTCCCTACAAAATTTGG - Intronic
911096444 1:94058953-94058975 AGGGCTTTCCATACCAAAACAGG - Intronic
911976194 1:104498375-104498397 AGGAGTTTCCCTACACAACCTGG - Intergenic
912942291 1:114056057-114056079 AGGTTTGTCCCTCCACAAACTGG + Intergenic
913274653 1:117125092-117125114 AGATATTATCCTACAAAAATGGG - Intergenic
915711175 1:157899708-157899730 AGACCTTTCCCTACAAATACTGG + Intergenic
915976895 1:160397360-160397382 AGGTATTTCCCAATATAGACTGG + Intergenic
916279118 1:163029209-163029231 TGAGATTTCCCTTCAAAAACTGG + Intergenic
917372685 1:174312639-174312661 GGGTAATACCCTACAAACACAGG - Intronic
924769617 1:247067482-247067504 AGGTAGTTCCCCACAAGCACAGG + Intronic
924866006 1:247981249-247981271 AGGTATTTTACTAGAAAGACTGG - Intronic
1063101886 10:2957325-2957347 AGGTTTTTCTCTACAGAAAATGG + Intergenic
1067274871 10:44825048-44825070 ATTTATCTCCCTCCAAAAACTGG + Intergenic
1070475747 10:76827473-76827495 ATGTATTTACCTTCAAAAACTGG + Intergenic
1071239668 10:83691785-83691807 AAATATTTCCCTACAGAAAGAGG - Intergenic
1074736907 10:116444877-116444899 ATGTATTTTCACACAAAAACAGG + Intronic
1078784506 11:14475564-14475586 AGTTATTTCCATAAAAACACTGG + Intronic
1082081418 11:48015248-48015270 AGGTATTTCTCTGGAACAACTGG + Intronic
1082247619 11:49942697-49942719 AGGCCAGTCCCTACAAAAACAGG + Intergenic
1087577578 11:100009363-100009385 AGGTATTTCCCCAGAAAAATGGG + Intronic
1088465550 11:110133493-110133515 ACTTATTTGCCTAAAAAAACTGG + Intronic
1091528908 12:1335304-1335326 AGGCATTCCCCTTGAAAAACTGG - Intronic
1092031675 12:5291490-5291512 ATGTTTTTCATTACAAAAACTGG + Intergenic
1093891679 12:24528876-24528898 GAATATTTGCCTACAAAAACAGG - Intergenic
1095070534 12:37838445-37838467 AGGTATTTTCAGATAAAAACTGG + Intergenic
1095325820 12:40890814-40890836 ATGTATGTCAGTACAAAAACTGG - Intronic
1097724253 12:63056633-63056655 AAACATTTCCATACAAAAACAGG - Intergenic
1102318452 12:111909995-111910017 GGGTAATACCCTACAAACACAGG + Intergenic
1103652709 12:122445310-122445332 ACATATATCCATACAAAAACTGG + Intergenic
1106866429 13:33969366-33969388 AGCGATTTTCCTACAGAAACTGG + Intergenic
1108873493 13:55016439-55016461 AACTATTTTTCTACAAAAACTGG + Intergenic
1110396409 13:75034513-75034535 GGGTATTGCCCTCCAAAACCTGG + Intergenic
1110562303 13:76922532-76922554 ATGTATTTCCCTATAAAATTTGG + Intergenic
1111218581 13:85176629-85176651 ATGTATTTCCCCACAGAAGCAGG - Intergenic
1111220433 13:85197973-85197995 AGGTACTTCCTTATGAAAACAGG - Intergenic
1113020572 13:105881230-105881252 AAGTATTTCCCTAGAACAATTGG + Intergenic
1115713770 14:36079529-36079551 AGATATTTCCAGACAAAAACCGG + Intergenic
1118220205 14:63848626-63848648 AAGTATTTGCCTAATAAAACTGG - Intergenic
1119360114 14:74042224-74042246 AGGTTATTCCATACACAAACTGG - Intronic
1119543088 14:75453213-75453235 AGACATTCCCCTACATAAACAGG - Intronic
1121542778 14:94741140-94741162 AGGGATCTCCCTGCAACAACTGG + Intergenic
1124599034 15:31116185-31116207 TGGTATTTCCCTTCCAACACTGG - Intronic
1131811256 15:96175959-96175981 AGGTATTTTACTATAAAAAAGGG - Intergenic
1132420623 15:101663993-101664015 GGGTTTTTCCCTAAAAAAGCAGG - Intronic
1133794654 16:9035977-9035999 AGGTATTGCCCTGCAAAAAGAGG - Intergenic
1134413869 16:14027075-14027097 ATGTATGTCTGTACAAAAACCGG + Intergenic
1134872004 16:17660602-17660624 TGGTGTTTCCCTTCCAAAACTGG - Intergenic
1135224192 16:20641347-20641369 AGCTTTTTCCCTACAAAAAGAGG - Intronic
1135287097 16:21203115-21203137 AGGTCTTTACCTATAGAAACGGG + Exonic
1135576313 16:23588542-23588564 AGGCATTTCCCTATAGAAAGTGG + Intronic
1135910413 16:26555609-26555631 AGGTAGTTCCCTAAAAAAGTGGG - Intergenic
1137436454 16:48458061-48458083 AGGTATATACCTAATAAAACTGG - Intergenic
1138209862 16:55154535-55154557 AGCACTTTCCCTACAATAACTGG + Intergenic
1139564246 16:67763407-67763429 GGTTATTTTCCTGCAAAAACCGG - Intronic
1143140623 17:4740016-4740038 AGGTATTTACCTTCGAAAAGTGG + Exonic
1149760572 17:59225626-59225648 AAGTATCTCCCTCCAAAAATTGG - Intronic
1150157514 17:62866463-62866485 AAGTATTTTCCCTCAAAAACAGG - Intergenic
1153081230 18:1227667-1227689 ATGTATATCCACACAAAAACTGG - Intergenic
1157831382 18:50859853-50859875 AGATGTTTCCCTATAAAAAGAGG + Intergenic
1157866204 18:51187170-51187192 GGGTATTTCCTTACATAATCTGG + Intronic
1159556264 18:69948339-69948361 AAGTATACCCCTACAAAAAGAGG + Intronic
1165536551 19:36452033-36452055 AAGAATTTCCATACAAAAATGGG + Intronic
926926191 2:17990059-17990081 AAGTATTTCACCACAAAAAAGGG + Intronic
927010194 2:18896127-18896149 ATATATTTCCCTACAAAATAAGG - Intergenic
927049989 2:19318362-19318384 AAGTCATTCCATACAAAAACTGG + Intergenic
929971644 2:46583255-46583277 AGGAATTTGTCTACACAAACTGG + Intronic
936382720 2:112001160-112001182 AGATACTTCACTATAAAAACAGG - Intronic
937886712 2:126904415-126904437 AGGTATACCCCAAAAAAAACAGG + Intergenic
938163987 2:129010130-129010152 AGGGAGGTCCCTTCAAAAACTGG + Intergenic
938562068 2:132481869-132481891 AAGTATTTCCTGACAAAATCAGG - Intronic
940575424 2:155497445-155497467 AGTTATTGCCCTCCAAAATCAGG + Intergenic
942495007 2:176530980-176531002 ATGTATTTGCCTAAAAAAACTGG + Intergenic
943308645 2:186299224-186299246 AAGTAGTTCCCTCCAAAAAAAGG + Intergenic
944181100 2:196895305-196895327 AGGTATATTCCTAAAAAAATTGG - Intronic
944312940 2:198254980-198255002 AGGAATTTCCCTGCACGAACAGG - Intronic
948863130 2:240762581-240762603 AGGTCTTTCCCTAAAGAGACAGG + Intronic
1169457189 20:5762276-5762298 AGGTATTTCTAAACCAAAACTGG - Intronic
1170102843 20:12721233-12721255 AGGCATCTCCCTAAAGAAACAGG + Intergenic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1173061187 20:39662825-39662847 AGGTATTTCCCAAAGCAAACGGG - Intergenic
1175262460 20:57683281-57683303 TGATGTTTCCCTCCAAAAACTGG - Intronic
1175454503 20:59101286-59101308 AGGTCTTTCCCCACAAAGCCAGG - Intergenic
1178022654 21:28427736-28427758 ATGTATTTGCCTACACAAGCTGG + Intergenic
1179149892 21:38800864-38800886 AGGTATTTCCTTGCTAGAACTGG + Intergenic
949808498 3:7980623-7980645 TGGTCTTTTCCTAAAAAAACGGG + Intergenic
951856219 3:27200178-27200200 AGATATCATCCTACAAAAACAGG + Intronic
952101509 3:30018270-30018292 AGGTATCTCCTGAGAAAAACAGG - Intergenic
952774641 3:37032975-37032997 AGGCATTTCCCTGCCAAAATCGG - Intronic
953479206 3:43234991-43235013 AAGTATTTCCCTGCTGAAACAGG + Intergenic
954233927 3:49240698-49240720 AAGTATTTCAGTACAAAAATTGG + Intronic
956108781 3:65850302-65850324 AGGTTTTTCCATACTAAAAGTGG - Intronic
956914933 3:73861012-73861034 AAGTATTTCCTTCCAGAAACAGG + Intergenic
957447037 3:80326250-80326272 AAGTATTTCCATTCCAAAACAGG - Intergenic
958581744 3:96034766-96034788 AGGTATGTCCACAAAAAAACGGG - Intergenic
960259437 3:115549134-115549156 AGGTTTGTCCATAGAAAAACAGG + Intergenic
962477045 3:135764047-135764069 AGGCATTTACCTTCAAAATCTGG + Intergenic
965099179 3:164274422-164274444 AGGCATTACCCTAAAAAAACAGG + Intergenic
969095253 4:4728001-4728023 AGTTATTTCCTTTCCAAAACAGG - Intergenic
970063825 4:12068234-12068256 ATGTATTTCCATATACAAACTGG - Intergenic
971260147 4:25049448-25049470 ATGTAATTCACTACATAAACAGG - Intergenic
972762249 4:42118427-42118449 ACGTATTTCCCAACCAAAAGCGG + Intronic
974764474 4:66324327-66324349 AGATATTTCCCTCCAAAATGTGG - Intergenic
974790903 4:66687573-66687595 AGGTATTTCCACCCAAATACAGG - Intergenic
976136937 4:81947799-81947821 AGTTTATTCACTACAAAAACAGG - Intronic
981694430 4:147545786-147545808 AGCTATTTTCCTACTAAAGCAGG + Intergenic
982699875 4:158648669-158648691 AGAAATTTCACTACAAAAATGGG - Exonic
983205687 4:164908447-164908469 ATGTTCTTCCCTACAAAAAGAGG - Intergenic
985182143 4:187276435-187276457 AGCTATGTCCCAACAAAAAAAGG - Intergenic
988474289 5:31569468-31569490 TGGTACTTTCCTACTAAAACTGG + Intergenic
989487858 5:42012796-42012818 AGTTTTTTCCCAAGAAAAACAGG + Intergenic
990201054 5:53375103-53375125 AGTTATTTCTCTGCATAAACTGG - Intergenic
990470524 5:56111227-56111249 AGGTATTTTCCTACAAAGTTTGG - Exonic
990783448 5:59393224-59393246 AGGTATTTGACAACAAAAAAAGG + Intronic
992760987 5:79950772-79950794 AGGTGGTTCCCTAAGAAAACTGG - Intergenic
997854545 5:137361805-137361827 AGGTTTTCACCTATAAAAACAGG + Intronic
998283873 5:140839306-140839328 AGGTATTTCCCAATATAAATAGG - Intronic
1000013382 5:157254938-157254960 AGGGAGTTCTCTACAAACACAGG - Exonic
1000507098 5:162134741-162134763 TGGTATTTCTCTAGAAAAAGTGG - Intronic
1004549549 6:16633391-16633413 AGGGCTTTCCCTTCCAAAACTGG - Intronic
1004610464 6:17234839-17234861 AAGTATTTCCCTGGAGAAACTGG - Intergenic
1004899341 6:20180077-20180099 AGTAATTTCCCCACAAGAACCGG + Intronic
1006682076 6:35804569-35804591 ATGTATTTACCTATAAAATCAGG + Intergenic
1007558553 6:42786369-42786391 AGTGACTTCCCTTCAAAAACTGG - Intronic
1011682304 6:89795128-89795150 AAGTAATTACCTACAAAATCGGG + Intronic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1014243032 6:119039308-119039330 ATATATGTCCATACAAAAACTGG + Intronic
1015454310 6:133408205-133408227 AGGTATTCCCCAACAAAAGATGG - Intronic
1015762097 6:136674146-136674168 AGATATTTTCAGACAAAAACTGG + Intronic
1015873800 6:137802590-137802612 AGTGATTTGCCTATAAAAACAGG - Intergenic
1016661538 6:146586668-146586690 AGGTATTTACCTAAGAAAACTGG - Intergenic
1017293021 6:152763099-152763121 AGCTATTTCCCTGAGAAAACAGG - Intergenic
1017791560 6:157804471-157804493 AGGGTTTTCCCTATAAACACAGG + Intronic
1018038152 6:159899029-159899051 AGGTTTTTCCCTCTAAAAAGGGG + Intergenic
1018954526 6:168399717-168399739 AAATTGTTCCCTACAAAAACAGG + Intergenic
1019097395 6:169594075-169594097 ATAAATTTCCCTTCAAAAACTGG + Intronic
1021177205 7:17462837-17462859 AGTTATTTTCCTACATAAAAGGG + Intergenic
1022423845 7:30248727-30248749 AGTTATTTCCCTGAAAAAAGAGG + Intergenic
1023320059 7:38986409-38986431 GGTTATTTCCTTCCAAAAACAGG + Intronic
1023364305 7:39448178-39448200 ACGTCTTTCCTTAGAAAAACAGG - Intronic
1026246453 7:68624465-68624487 GGGTATTTTCCTACATTAACAGG + Intergenic
1028261048 7:88665793-88665815 ATGTATTTACCTTCTAAAACAGG + Intergenic
1028332853 7:89618147-89618169 ATGTATTTCCCAAAAAAAAGTGG + Intergenic
1031025644 7:116676824-116676846 AGGTATCTCCCTCCAAAATCAGG - Intronic
1031025650 7:116676857-116676879 AGGTATTTCCCTACAAAAACAGG - Intronic
1031664645 7:124469037-124469059 AGGTATTTACCTAAAAGAAAAGG - Intergenic
1031841942 7:126752881-126752903 AAGTATTTCCATGCAGAAACAGG - Intronic
1034603012 7:152280954-152280976 AGATATTTTCCTAAAAAAATAGG + Intronic
1035175492 7:157047078-157047100 AGGTTCTTGGCTACAAAAACAGG - Intergenic
1039033496 8:33333929-33333951 AGGTCTTTCCCTATATAACCTGG - Intergenic
1039126043 8:34203097-34203119 AGGTATTTTTCTATAAAAAAGGG - Intergenic
1040555414 8:48473705-48473727 ACCTATTTCCCCAGAAAAACTGG + Intergenic
1040885486 8:52258800-52258822 AAGTATTTCCCCATAAAATCAGG - Intronic
1041435249 8:57831996-57832018 AGGCATTTCCATACCAAAAGGGG - Intergenic
1042981791 8:74537777-74537799 AGGTATATTCCTTCAAAACCTGG + Intergenic
1045801012 8:106101119-106101141 AAGTAATGCCCTACAAACACAGG + Intergenic
1046144728 8:110143539-110143561 AAGTATTTCTCTACAAATATAGG - Intergenic
1047223377 8:122937041-122937063 GGGTCTTTCTCTAGAAAAACTGG + Intronic
1050675624 9:8049514-8049536 AGGCATTTCCCTTGAAAACCAGG - Intergenic
1051539421 9:18197756-18197778 TGGTATTTCCCTTTGAAAACTGG - Intergenic
1052008027 9:23374001-23374023 AGTTATTTACCTATAAAAATAGG - Intergenic
1052371200 9:27666394-27666416 AGGTATTCCCATACACAAACTGG + Intergenic
1053148991 9:35731171-35731193 AAGGATTTCCCTACAAAAGAAGG + Intronic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1057054702 9:91951269-91951291 AGATATTTCCCTACACAAATTGG - Intergenic
1057970088 9:99546570-99546592 AGGTATATACCCACAAAAAAGGG - Intergenic
1059167297 9:112090263-112090285 AGGTAATTCCTTGCAAAATCTGG + Intronic
1062140212 9:134952334-134952356 AGGTATATGCTCACAAAAACTGG - Intergenic
1186370299 X:8939831-8939853 AGGTATTTTGCTACAGCAACAGG - Intergenic
1187043446 X:15621633-15621655 AGATATTTCCCTATATAAATAGG - Intergenic
1187233266 X:17442753-17442775 ATTTATTTCTCTATAAAAACTGG + Intronic
1188077786 X:25800058-25800080 AAGTAATACCCTACAAACACAGG - Intergenic
1189745529 X:44165068-44165090 TTGTATTTTCCTTCAAAAACTGG - Intronic
1190596473 X:52056671-52056693 AGGTTTTTCCCTCATAAAACGGG + Intergenic
1190612351 X:52197402-52197424 AGGTTTTTCCCTCATAAAACGGG - Intergenic
1193432847 X:81432597-81432619 AGCTGTTTCCTTACAAAAAAAGG + Intergenic
1193534993 X:82703653-82703675 ATGTATTTCAAAACAAAAACAGG + Intergenic
1193549945 X:82879380-82879402 AGGTATTTCCAGAGAAATACAGG - Intergenic
1194462594 X:94190864-94190886 AGGTGTTTCACTAAAAAAAAAGG + Intergenic
1195636736 X:107125493-107125515 AGGTATTACACTTTAAAAACTGG - Intronic
1196333943 X:114507471-114507493 ATGTATGTCTATACAAAAACTGG + Intergenic
1196400010 X:115305269-115305291 AGGTTTTTCAGTACAAAAGCTGG + Intronic
1198593155 X:138206904-138206926 AGGCATTTACCCACAAAAATTGG - Intergenic
1199152961 X:144510942-144510964 AGGTCTTTCCCTTCAAAGAAAGG - Intergenic
1201900017 Y:19039505-19039527 AGTTATTTTCCTAAAATAACTGG - Intergenic