ID: 1031026521

View in Genome Browser
Species Human (GRCh38)
Location 7:116685765-116685787
Sequence ACCGACATGCAGACTCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031026521_1031026525 22 Left 1031026521 7:116685765-116685787 CCAACCAGAGTCTGCATGTCGGT 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1031026525 7:116685810-116685832 GTTAAAAAAGTCAAAATCCTTGG 0: 1
1: 0
2: 2
3: 36
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031026521 Original CRISPR ACCGACATGCAGACTCTGGT TGG (reversed) Intronic
900716111 1:4145448-4145470 ACTGACATGCTGTCTGTGGTTGG + Intergenic
910156474 1:84225128-84225150 ACACAGATACAGACTCTGGTAGG + Intronic
912459805 1:109823031-109823053 AAGGACATGCAGAATGTGGTGGG + Intergenic
916571524 1:166032372-166032394 ACCTACAGGCAGAAACTGGTTGG - Intergenic
1067763914 10:49070951-49070973 ACCCACAGCCAGACTCGGGTGGG - Intronic
1079005590 11:16789395-16789417 ACACACATGCACACTCTAGTTGG + Intronic
1085464841 11:76716447-76716469 ATCCACATGCAGCCTCTGGAGGG + Intergenic
1086018703 11:82199404-82199426 ACAGACATGGAGACTCTGAAAGG + Intergenic
1090006389 11:123006371-123006393 ACCGAGAAACAAACTCTGGTTGG - Intergenic
1092275880 12:7060693-7060715 TCAGACATGCACACTCGGGTAGG + Intronic
1092471081 12:8781703-8781725 ACAGACATGCACACTCTCTTAGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1107117591 13:36763545-36763567 ACAGACATGCAGAACCTGGGTGG - Intergenic
1110129391 13:71988449-71988471 ACCTATATTCAGACTGTGGTTGG - Intergenic
1113698213 13:112364061-112364083 ACCAGCATGCAGACCCCGGTGGG - Intergenic
1121719115 14:96097035-96097057 ACCCTCATGCAGACTTTGGCTGG - Intergenic
1122704007 14:103608750-103608772 ACAGCCATGCAGACACTGGGAGG + Intronic
1129411882 15:75354801-75354823 GGCGACAGGCAGCCTCTGGTGGG + Exonic
1135377384 16:21960075-21960097 AACGACAAGCTGACTCTTGTTGG - Intronic
1136716299 16:32286437-32286459 ACCCACAGGCAGACCCTGGGAGG - Intergenic
1136834685 16:33492715-33492737 ACCCACAGGCAGACCCTGGGAGG - Intergenic
1142354388 16:89595496-89595518 ACCGACATGCAGGTCCTGGACGG + Exonic
1203010118 16_KI270728v1_random:231317-231339 ACCCACAGGCAGACCCTGGGAGG + Intergenic
1203144854 16_KI270728v1_random:1793003-1793025 ACCCACAGGCAGACCCTGGGAGG - Intergenic
1148198183 17:45729833-45729855 ACAGAGATGCAGACACTGGCAGG - Intergenic
1153227193 18:2907926-2907948 AGGGACATGCAGACACTGGCAGG + Intronic
1159439421 18:68458074-68458096 ACATACATGCATACTCTGGATGG + Intergenic
1163626621 19:18393790-18393812 ACAGACATGGAGGCTCTGGGAGG - Intronic
1165444274 19:35848383-35848405 ACCGCCATGCAGTCCCTGGCAGG + Exonic
1167832431 19:52036583-52036605 ACAGACATCAAGAATCTGGTTGG + Intronic
925360676 2:3278277-3278299 CACCACATGCAGACTGTGGTTGG + Intronic
925580588 2:5406347-5406369 ACCGAGATGCAGACTCTTACAGG - Intergenic
931946557 2:67315378-67315400 CCATACATCCAGACTCTGGTAGG + Intergenic
934303937 2:91805284-91805306 ACCGACATTCATATTCTGGAAGG + Intergenic
934329317 2:92047466-92047488 ACCGACATTCATATTCTGGAAGG - Intergenic
934467536 2:94277387-94277409 ACCGACATTCATATTCTGGAAGG - Intergenic
941220656 2:162776225-162776247 ACCTACATGTAGCCTCTGGATGG + Intronic
942384940 2:175432581-175432603 ACCGACATTCTGACTCAGGGTGG + Intergenic
942638166 2:178031773-178031795 ACACACATGCACACTCTGATAGG - Intronic
945923976 2:215784781-215784803 AACGACATGCAGCCTCTGGCTGG - Intergenic
948897022 2:240932397-240932419 ACCGACCTGCAGAACCTGGTTGG + Intronic
1175218482 20:57403986-57404008 ACCGACATGCAGTGTCTGCAAGG + Intronic
1178131627 21:29579729-29579751 AATGACAAGCAGAGTCTGGTTGG + Intronic
1179507449 21:41851405-41851427 ACACACACTCAGACTCTGGTGGG + Intronic
1180102472 21:45595263-45595285 ACCCAACTGCAGACTCTGGGAGG + Intergenic
1180450450 22:15457339-15457361 ACAAACATTCAGACTCTCGTAGG - Intergenic
949369258 3:3317297-3317319 GCCTACATGAAGACTATGGTGGG - Intergenic
952088856 3:29859902-29859924 ACACACATACACACTCTGGTAGG + Intronic
954177975 3:48859288-48859310 ACAGACAGGCAGAAACTGGTTGG + Intronic
956642595 3:71428999-71429021 GCCGACATGCAGACAGTAGTCGG + Intronic
967140180 3:186551124-186551146 TCTTACATGCAGACACTGGTAGG - Exonic
976385503 4:84453209-84453231 ACAGGCCAGCAGACTCTGGTGGG + Intergenic
982260168 4:153487876-153487898 AGAGACAGACAGACTCTGGTGGG + Intronic
985303226 4:188511941-188511963 ACTGACCAGCAGAGTCTGGTGGG + Intergenic
987397964 5:17443457-17443479 GCCGACAGGCAGACCCTGGCAGG + Intergenic
987842636 5:23240309-23240331 ACAGACATCCACACTCTGTTTGG + Intergenic
995548179 5:113253400-113253422 AGGGACTTGCAGACCCTGGTGGG + Intronic
996784603 5:127224784-127224806 AGCCACATGCAGTCTCTGGAAGG - Intergenic
997780137 5:136649129-136649151 ACCAAAATCCAGACTCAGGTGGG - Intergenic
1006485742 6:34340021-34340043 ACCGACATAAAGAGTCTGCTGGG + Intronic
1007309821 6:40936447-40936469 ACCGAGATGCAGACTCTCCCAGG + Intergenic
1014262994 6:119241175-119241197 AAGGACATGCAAACTCTGTTTGG + Intronic
1018254334 6:161903498-161903520 ACCTCCATGCAGCCTCTGATGGG + Intronic
1019556461 7:1633914-1633936 CCTGACATGCAGCCCCTGGTGGG + Intergenic
1020949497 7:14657704-14657726 CCAGAAATGCAGAGTCTGGTGGG - Intronic
1027146696 7:75700496-75700518 ACCCTCATGGAGACTCTGCTTGG - Intronic
1028994574 7:97085911-97085933 ACCTAGATGCAGCCTCTGATGGG + Intergenic
1029617166 7:101666214-101666236 CCCGGGATGCAGACTCTGGATGG - Intergenic
1031026521 7:116685765-116685787 ACCGACATGCAGACTCTGGTTGG - Intronic
1032772848 7:135077045-135077067 ACCGAGCTGCAGAGTCGGGTGGG - Intronic
1033346018 7:140526229-140526251 ACCCACCTGCAGACTCGGTTAGG + Intronic
1037793060 8:21964783-21964805 ACCTACATGCAGGTTATGGTAGG - Intronic
1041957573 8:63573045-63573067 AAGGACTTACAGACTCTGGTGGG - Intergenic
1050707256 9:8415726-8415748 ACAGACATGCAGACAATGGAGGG + Intronic
1052691554 9:31821656-31821678 AGCGTCATGCAGCCTGTGGTTGG - Intergenic
1056813142 9:89779981-89780003 TCCCACAGGGAGACTCTGGTGGG + Intergenic
1057158796 9:92870115-92870137 ACCAACATACAGACTCTGAAAGG + Intronic
1203484434 Un_GL000224v1:39390-39412 ACAAACATGCAGACCCTCGTAGG + Intergenic
1189315356 X:40052164-40052186 AACGAAATTCAGACTCTGCTGGG - Exonic
1189333702 X:40157562-40157584 AACAACATGCAAACTTTGGTTGG + Intronic
1193580700 X:83259678-83259700 ACCACCATGGAAACTCTGGTTGG + Intergenic
1197483516 X:127017185-127017207 ACCAAAATGAAGACTTTGGTTGG - Intergenic
1197938342 X:131763239-131763261 ACACACATGCAGGCTCTTGTGGG + Intergenic