ID: 1031029264

View in Genome Browser
Species Human (GRCh38)
Location 7:116716831-116716853
Sequence TCAGCCCGTGGCTGGCTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031029257_1031029264 14 Left 1031029257 7:116716794-116716816 CCACAGTAGCTTCCATCACCTTG 0: 1
1: 0
2: 2
3: 13
4: 185
Right 1031029264 7:116716831-116716853 TCAGCCCGTGGCTGGCTGGCCGG No data
1031029259_1031029264 -4 Left 1031029259 7:116716812-116716834 CCTTGTGAATCACCAGTGCTCAG 0: 1
1: 0
2: 2
3: 19
4: 164
Right 1031029264 7:116716831-116716853 TCAGCCCGTGGCTGGCTGGCCGG No data
1031029258_1031029264 2 Left 1031029258 7:116716806-116716828 CCATCACCTTGTGAATCACCAGT 0: 1
1: 0
2: 1
3: 14
4: 146
Right 1031029264 7:116716831-116716853 TCAGCCCGTGGCTGGCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031029264 Original CRISPR TCAGCCCGTGGCTGGCTGGC CGG Intronic
No off target data available for this crispr