ID: 1031030397

View in Genome Browser
Species Human (GRCh38)
Location 7:116727931-116727953
Sequence CAGTAGGACTTCAACTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031030397_1031030403 -4 Left 1031030397 7:116727931-116727953 CCCTGTTAGTTGAAGTCCTACTG 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1031030403 7:116727950-116727972 ACTGTTAGGGCTCAAAGACAGGG No data
1031030397_1031030402 -5 Left 1031030397 7:116727931-116727953 CCCTGTTAGTTGAAGTCCTACTG 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1031030402 7:116727949-116727971 TACTGTTAGGGCTCAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031030397 Original CRISPR CAGTAGGACTTCAACTAACA GGG (reversed) Intronic
901760970 1:11471322-11471344 CAGTAGCACTTCATCACACATGG - Intergenic
902100787 1:13986891-13986913 CAGAAGGACATGAACTCACAAGG - Intergenic
903211392 1:21821269-21821291 TAGGAGGACTTGAACTCACATGG - Intronic
908678267 1:66630484-66630506 TACTAGGACTTCAACTTACTAGG - Intronic
915866382 1:159503905-159503927 CAGTACTACTTCAACTCCCAGGG + Intergenic
916017445 1:160762661-160762683 CAGTAGGCTTTTAGCTAACAAGG - Intergenic
916549966 1:165840597-165840619 CAGTGGGACTTAAACTATAAAGG - Intronic
922083346 1:222320184-222320206 CAGAAGGAATTCAACCAAGAAGG + Intergenic
923828647 1:237528550-237528572 AAGTATGAATTCAACTCACACGG - Intronic
923937278 1:238777213-238777235 CTGTAGGACTTCTTTTAACAAGG - Intergenic
1066264118 10:33758731-33758753 GAGCAGGACTTCAACTAGGAAGG + Intergenic
1068356172 10:55911716-55911738 CAGTGAGACTTCAGCTGACAGGG - Intergenic
1079752486 11:24216805-24216827 ACATAGGACTTCAGCTAACAAGG + Intergenic
1080444720 11:32327507-32327529 CATGAAGACTTCAACTAACATGG - Intergenic
1080985825 11:37463802-37463824 GAGTAGTACTGCAACAAACATGG - Intergenic
1082652852 11:55815924-55815946 CAATAGGACTTAATCCAACAAGG + Intergenic
1084875940 11:72133430-72133452 CAGTAGAACTGCTACTAACCTGG - Intronic
1085170147 11:74442885-74442907 CAGAAGGACTCCATCTACCATGG - Intergenic
1087562913 11:99814538-99814560 CAGTTGGACTTAAATTAGCAGGG + Intronic
1087832328 11:102832592-102832614 GAGCAGGTCTTCAAATAACATGG + Intergenic
1088770877 11:113035145-113035167 CTGTAAGACTTCTACTAACTAGG - Intronic
1089093203 11:115895903-115895925 CAGTAGGACTTGAACTAAGCGGG - Intergenic
1094152063 12:27295814-27295836 CAGTAAGACTTCAGCTAAACTGG + Intronic
1097900493 12:64868303-64868325 CAGCAAGGCTTCAATTAACATGG - Intronic
1099745277 12:86694650-86694672 CAGTAGGATTTGAATTATCAAGG + Intronic
1102003682 12:109574821-109574843 CAGTAGGACTTCTGACAACATGG - Exonic
1104556827 12:129807752-129807774 CAGTTGGACTTCAACCAAATGGG - Intronic
1105654703 13:22423655-22423677 CTGAAGGACTCCAAGTAACAGGG - Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1110011185 13:70336107-70336129 AAGTAGCAATTCAACTACCAAGG + Intergenic
1111923584 13:94439087-94439109 CAGTAGCATATCAACTAACCAGG + Intronic
1112320351 13:98401229-98401251 CAGATGGAATTAAACTAACAAGG - Intronic
1113782360 13:112983901-112983923 CAGGTGGACTTCCACTCACATGG + Intronic
1116091412 14:40311636-40311658 CAGTAATACTTCATTTAACAAGG - Intergenic
1126296336 15:47140466-47140488 AAGAAGGACTTCACCCAACATGG + Intergenic
1128890830 15:71330385-71330407 CGGTAGGTATTCAACAAACATGG + Intronic
1133832622 16:9338116-9338138 CAGTAATAATTCAGCTAACATGG - Intergenic
1135609169 16:23850261-23850283 AAGTAGTACTGCAACAAACATGG + Intronic
1140437467 16:74959315-74959337 CATTTGGACATCCACTAACAGGG + Intronic
1141312350 16:82926750-82926772 CAGGAGGACTTCAACCAAACTGG + Intronic
1147934044 17:44001442-44001464 CTGTAGGCCTTCAACTCAGAGGG + Intronic
1151237682 17:72733314-72733336 CACTAGTACTTCCAGTAACATGG - Intronic
1157465686 18:47942952-47942974 CAAGGGGCCTTCAACTAACAAGG + Intergenic
1158178895 18:54689482-54689504 CAGTAGGACTTCAGAGAGCAAGG - Intergenic
1158270791 18:55713787-55713809 CAATAGAACTACACCTAACATGG - Intergenic
1164995402 19:32717658-32717680 CAGCTGGACTTCAACTGGCAGGG - Intergenic
928353139 2:30581455-30581477 TAGTAGGGCTGCAATTAACATGG - Intronic
928803490 2:35123796-35123818 TAGTAGGAGTTCAAATAATATGG - Intergenic
938809276 2:134837301-134837323 GAGTAAGCCTTAAACTAACATGG - Intergenic
939055941 2:137364662-137364684 CCCTAGGAATTCAACTTACAAGG + Intronic
945514312 2:210743818-210743840 CAGAATGACTTCAACAAAAATGG - Intergenic
948400615 2:237682303-237682325 CCGGAGGACTGCAAGTAACAGGG - Intronic
1169930081 20:10823175-10823197 CAGTAGGACTTGAAAAAACTTGG + Intergenic
1172368965 20:34372364-34372386 AAGTAGAACTTAAAATAACATGG - Intronic
1180614316 22:17118037-17118059 CAGGAGGACAGCAGCTAACAAGG - Exonic
1180635734 22:17261650-17261672 CAGTAAGACTGAAACTTACAAGG - Intergenic
951507597 3:23465775-23465797 CTGTAGGAATTCAATTAAAATGG - Intronic
957145315 3:76415240-76415262 CAATGGGACTTCAACAAAAATGG + Intronic
957399438 3:79689600-79689622 CAGGAGGAAATCAACTAATAAGG + Intronic
962134200 3:132716596-132716618 CAGTGGGGCTGTAACTAACAAGG - Intronic
964583364 3:158265949-158265971 CAGTGGGAATTCAATCAACATGG - Intronic
964691555 3:159455331-159455353 CTGGAGGACTTCAGCTAACTGGG + Intronic
976058005 4:81091782-81091804 CAGCAGAACTTCAGCTAACATGG - Intronic
976217124 4:82725935-82725957 AAGCAGGATTTCAACTGACAAGG + Intronic
980416835 4:132500041-132500063 GAATAGCACTTCAACAAACATGG + Intergenic
982132283 4:152240667-152240689 CAATTCGACTTCAGCTAACATGG - Intergenic
984360962 4:178731282-178731304 CTGTAGGACTTTAAATATCAAGG - Intergenic
984443496 4:179804220-179804242 CAGGAGGACTTCTTCTTACAGGG + Intergenic
989336055 5:40318155-40318177 CAGTTTGCCATCAACTAACATGG - Intergenic
994340803 5:98625530-98625552 AAGTAGTACTTCAATTAAAAAGG + Intergenic
1003125825 6:3355218-3355240 CAGTAGCTCTTCAAATAAAATGG + Intronic
1005454034 6:26001533-26001555 CAGTAGAAATTTCACTAACATGG + Intergenic
1007190552 6:40013251-40013273 GAGTAGTACTGCAACAAACATGG + Intergenic
1008480265 6:51978476-51978498 CACTAGGCTTTCAACAAACATGG + Intronic
1010734636 6:79429839-79429861 CAGGAAGACTTCAATTAAAATGG + Intergenic
1012870496 6:104667596-104667618 ATGTAGGAATTCAGCTAACAAGG + Intergenic
1016588250 6:145714309-145714331 CAGTAAGCCCTCAATTAACATGG + Intronic
1017384544 6:153868309-153868331 AAGTAGGAATCCAACTTACAAGG + Intergenic
1020168153 7:5823892-5823914 CTGTAGGACTGCATCCAACAAGG - Intergenic
1024558423 7:50623331-50623353 CACTAGGGCTTCACCTACCAGGG + Intronic
1028042851 7:86078689-86078711 AAGTAGGAATACATCTAACAAGG + Intergenic
1031030397 7:116727931-116727953 CAGTAGGACTTCAACTAACAGGG - Intronic
1034827930 7:154283627-154283649 CTGTAGGAATTCCAGTAACAAGG + Intronic
1035184829 7:157118351-157118373 CAGAAAGACTTAAACTAAAAGGG - Intergenic
1036521294 8:9494035-9494057 GAGTAAGAGTTCAAGTAACAAGG - Intergenic
1040765264 8:50902194-50902216 ACCTAGGAATTCAACTAACAAGG + Intergenic
1052896181 9:33750402-33750424 CAGGAGGACTGCAACCAACCGGG - Intergenic
1053517107 9:38739909-38739931 CAGTAGGAATTTCTCTAACACGG + Intergenic
1055996359 9:82164172-82164194 AAGGATGACTTCTACTAACAAGG + Intergenic
1060410637 9:123397908-123397930 CAGTGGAACTTCAAATAACCAGG + Intronic
1187374126 X:18735847-18735869 ACGTAGGAATTCAACTTACAAGG - Intronic
1187619714 X:21038421-21038443 CAGTAGTGCTGCAACGAACATGG + Intergenic
1190752552 X:53374964-53374986 CATAAGGACTTCACCTTACAGGG - Exonic
1192748864 X:73966829-73966851 CAGTAAGAGATCAACTAAAATGG - Intergenic
1196793714 X:119486222-119486244 CAGTAGGTCATCAGCTAATACGG + Intergenic
1197874116 X:131085924-131085946 CCGTATGACTTCCACTAACTTGG + Exonic
1201596459 Y:15675502-15675524 AATTAGGAATTCAACTTACAAGG + Intergenic