ID: 1031033008

View in Genome Browser
Species Human (GRCh38)
Location 7:116755087-116755109
Sequence GACAAAGAGCAGATGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 299}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031033008 Original CRISPR GACAAAGAGCAGATGCAGCT TGG (reversed) Intronic
900097549 1:946162-946184 GGCAAAGAGCGGGTGCGGCTCGG - Exonic
900708335 1:4094467-4094489 GAGAAGGAGCAGGTGAAGCTGGG - Intergenic
900902644 1:5527365-5527387 GAGAAAGAGCAGATGCGGTCTGG + Intergenic
901107863 1:6771376-6771398 GACAGAGAGAAAATGCAGCCAGG + Intergenic
901457677 1:9372681-9372703 GACACAGAGCAGAGAGAGCTGGG - Intergenic
901749345 1:11396385-11396407 GAGAAAGAGGAGAGGGAGCTGGG + Intergenic
903976765 1:27155058-27155080 GACCAGGAGGAGCTGCAGCTGGG - Intronic
904565896 1:31428333-31428355 GATTAAGAGCACAGGCAGCTAGG - Intronic
905012483 1:34756828-34756850 GACAAAGAGCAGGTTCCCCTGGG + Intronic
905728908 1:40280719-40280741 GACAAAAAGCAAATTCAACTGGG - Intronic
907649030 1:56275699-56275721 GACAAATAGCTGATGCATGTGGG + Intergenic
910373441 1:86543164-86543186 GGCAATGAGCACATGCAGCCTGG - Intergenic
910993290 1:93078092-93078114 TAAAAAAAGCAGATGCAGCCGGG - Intergenic
912992589 1:114503890-114503912 GAAAAAAAGCAAATTCAGCTTGG + Intronic
914415075 1:147472173-147472195 GACAAAGAGAAAATGCAGTAAGG + Intergenic
915121169 1:153630240-153630262 GAGAGAGAGCAGTTGGAGCTGGG - Intronic
915775918 1:158486115-158486137 GATAAATAGCTAATGCAGCTGGG - Intergenic
916771491 1:167913140-167913162 GACAAAGCGCGGAAGCACCTTGG + Intronic
917004905 1:170403627-170403649 GACCAAAAGCAGAAGCAGATAGG + Intergenic
918289189 1:183090241-183090263 AAAAAAAAGCAGATGCATCTAGG + Intronic
918762348 1:188427758-188427780 GAGAAAGAGAAGATACAACTGGG - Intergenic
921621762 1:217333288-217333310 GAAAGAGAACAAATGCAGCTGGG + Intergenic
922393050 1:225167420-225167442 TCCAAAGAGCAGCTGCAGCTTGG - Intronic
922570243 1:226630395-226630417 GATAAAGAAAGGATGCAGCTGGG + Intergenic
922936500 1:229426853-229426875 GACAAAGAGGAGAGGCAGGCAGG + Intergenic
923115753 1:230936028-230936050 GAGAAAGGGCAGCTGCAGGTGGG + Intronic
923386506 1:233470585-233470607 GAGACAGAGCAGAAGCAGATGGG + Intergenic
1064671059 10:17714162-17714184 GACAAAGAGCAGCTGGGGCAAGG - Intronic
1064689033 10:17894821-17894843 GACAAAGAGCTAATGCATGTGGG - Intronic
1065917368 10:30364959-30364981 GACAAAGAGGAGATGAAGATGGG - Intronic
1066748342 10:38626020-38626042 TCCAAAGAGCAGAAGCAGTTTGG - Intergenic
1066968336 10:42291755-42291777 TCCAAAGAGCAGAAGCAGTTTGG + Intergenic
1068755580 10:60648853-60648875 GAGCAGGAGCAGAAGCAGCTTGG - Intronic
1070429899 10:76327384-76327406 GTCAAAGAGAAGATGAGGCTGGG - Intronic
1071326608 10:84524790-84524812 GACAAAAAGTAGATGATGCTTGG - Intergenic
1072063222 10:91838208-91838230 GATAAAGAGGAGATGAAGTTGGG + Intronic
1072501401 10:96021865-96021887 TGCAAAGATCAGATGTAGCTAGG + Intronic
1073083354 10:100873559-100873581 GACCAAGAGCCTATGCAGCAGGG + Intergenic
1073623034 10:105068401-105068423 GGGAAAAAGCAGATGCATCTAGG - Intronic
1073717150 10:106120637-106120659 GATAAATAGCTAATGCAGCTGGG + Intergenic
1074423277 10:113328163-113328185 GACAAAGAGGAGCAGCACCTGGG - Intergenic
1076051386 10:127336305-127336327 AACAAAGATCAGATGATGCTTGG - Intronic
1076092501 10:127699918-127699940 GACACAAAGCAGGTCCAGCTGGG - Intergenic
1076290753 10:129343619-129343641 CACACAGAGCAGGTGCAGGTAGG + Intergenic
1076608342 10:131703880-131703902 GTCAAAGAGCAGAGGCACCTGGG - Intergenic
1078730139 11:13965979-13966001 CACAAAGAACAGAAGCTGCTTGG - Intronic
1079193758 11:18305601-18305623 GAATAAGGGCAGATGCAGTTAGG - Intronic
1080593384 11:33744320-33744342 CACAAACAGCAGATGCAGAGAGG + Intronic
1083986478 11:66219114-66219136 GAGAAAGACCAGAAGCAGGTGGG + Intronic
1084484702 11:69441123-69441145 TACAGAGAGCAGATTGAGCTGGG - Intergenic
1085359274 11:75871578-75871600 GCAAAAGAGCAGATGCAGTCCGG - Intronic
1085554492 11:77407683-77407705 TCCAGAGACCAGATGCAGCTAGG - Intronic
1085643405 11:78207583-78207605 GCCAAAGAGCCACTGCAGCTTGG - Exonic
1086243080 11:84720039-84720061 CTACAAGAGCAGATGCAGCTCGG - Intronic
1088629857 11:111764473-111764495 GACAAAGACAAAATGCTGCTAGG + Intronic
1089027058 11:115282312-115282334 GCCATAGGGTAGATGCAGCTGGG - Intronic
1089505363 11:118958614-118958636 GACCAGGAGCACCTGCAGCTTGG - Intergenic
1090021613 11:123133673-123133695 GAGAAAGAGCAGGTGCAGGAAGG + Intronic
1090036126 11:123251252-123251274 GACAGAGAGGAGAGGCAGATAGG + Intergenic
1090185601 11:124737438-124737460 GACAAAGGACAGATGCAGTAAGG - Intergenic
1091842135 12:3628781-3628803 GACAAACAGCAACAGCAGCTTGG + Intronic
1095450032 12:42320743-42320765 GAACAAAAGCAAATGCAGCTGGG - Intronic
1095513201 12:42976085-42976107 GAGAAACAGCAGATGCAGAAAGG - Intergenic
1095898317 12:47302764-47302786 GAGAAACAGCAGATGCAGAAAGG + Intergenic
1096173732 12:49496666-49496688 AACAAAGATCAGAATCAGCTGGG - Intronic
1096411478 12:51379802-51379824 GACTCAGAGCTGACGCAGCTGGG - Exonic
1096575980 12:52553090-52553112 GACAAAGCTCAGATGCAGGAGGG + Exonic
1096730217 12:53604702-53604724 GACAAAAAGCAGATACTGCTAGG + Intronic
1097661511 12:62435904-62435926 CACAAGGTGCAGATGCTGCTCGG - Intergenic
1100086737 12:90920002-90920024 AAAATAGAGCAAATGCAGCTAGG - Intronic
1100280502 12:93113794-93113816 GAGAAACAGCAGATGCAGGAAGG - Intergenic
1101769117 12:107732305-107732327 CACAAACAGCAGAGGAAGCTTGG - Intergenic
1103205604 12:119126317-119126339 TACAAAGAGCAGCTAGAGCTGGG - Intronic
1104210104 12:126680686-126680708 TCCAAAAAGCAGATGAAGCTTGG - Intergenic
1106115578 13:26814949-26814971 CCCAAAGAGAAGATCCAGCTGGG + Intergenic
1108800563 13:54090679-54090701 GACAAAGAGCAGATTCTCCAAGG - Intergenic
1109592158 13:64499648-64499670 GAGAAACACCAGATGCAGATAGG - Intergenic
1111045693 13:82811074-82811096 GACAAATAGCTAATGCATCTAGG + Intergenic
1113692593 13:112322182-112322204 GACACAGAGAAGATGCTGGTGGG + Intergenic
1113765336 13:112877542-112877564 GAGAGAGAGCAGGTGCAGCTTGG + Intronic
1113963839 13:114140563-114140585 GACACACAGCACACGCAGCTTGG - Intergenic
1114137734 14:19871104-19871126 GAAAAAGACCAGCTGCTGCTTGG + Intergenic
1117194447 14:53325568-53325590 AACATAGAGCAGATGCTCCTGGG - Intergenic
1118412195 14:65492825-65492847 GACTTAGAGCAGATTCAGGTGGG - Intronic
1119633440 14:76254334-76254356 GAAAAACTGCAGCTGCAGCTGGG + Intronic
1122198580 14:100108220-100108242 TCCAAAGAGCACATGGAGCTGGG - Intronic
1122760713 14:104023402-104023424 GACATAATGGAGATGCAGCTGGG + Intronic
1125216233 15:37278599-37278621 GACAAATAGCTAATGCATCTGGG + Intergenic
1125781399 15:42272549-42272571 GACAAAAACCAGATGCAGGGAGG - Intronic
1126601681 15:50434396-50434418 AACAAAGAGAAAATGCAGCCGGG - Intronic
1127772550 15:62243259-62243281 GACAAGGAGGAGATGAAGGTAGG - Intergenic
1128248255 15:66147636-66147658 GAGAAAGAGCAGGTGCACCGAGG + Intronic
1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG + Intergenic
1129773603 15:78218490-78218512 GACACAGAGCAGAAGGAGCCTGG + Intronic
1130578049 15:85109974-85109996 CACAGAGAGTAGATGAAGCTGGG - Intronic
1132030986 15:98438398-98438420 GGCAAGGAGCAGAGGCAGCAGGG + Exonic
1133161728 16:3916287-3916309 CAGAGAGAGCAGATGCAGCCTGG + Intergenic
1133502609 16:6379975-6379997 GAGAGAGAGCAGATGCAGGAAGG + Intronic
1133896403 16:9933330-9933352 GGCAAAGAGCTGGTGCAGTTAGG - Intronic
1136734417 16:32451281-32451303 TCCAAAGAGCAGAAGCAGCTTGG + Intergenic
1136851340 16:33614868-33614890 GACAGAAAGTAGATGCTGCTGGG + Intergenic
1137601551 16:49759849-49759871 GCCAAAGGGCAGGTGCAGCAGGG - Intronic
1137828040 16:51516775-51516797 GAGAGAGAGCAGATGCAGGGTGG + Intergenic
1139955162 16:70689721-70689743 AACAAAGATCAAAAGCAGCTGGG + Intronic
1140852390 16:78947348-78947370 GAAAAATAACAAATGCAGCTAGG - Intronic
1140866069 16:79063271-79063293 TATAAAGAGCAGAGGCGGCTTGG - Intronic
1142106276 16:88304595-88304617 CACAGAGAGCAGAAGCAGCTGGG - Intergenic
1203018663 16_KI270728v1_random:378321-378343 TCCAAAGAGCAGAAGCAGCTTGG - Intergenic
1203036998 16_KI270728v1_random:651479-651501 TCCAAAGAGCAGAAGCAGCTTGG - Intergenic
1144754316 17:17669925-17669947 GACCAGGAGCAGATGGGGCTTGG - Intergenic
1145940111 17:28738867-28738889 GGCCCAGAGCAGGTGCAGCTGGG - Intronic
1146144204 17:30397435-30397457 GAAAAAGAGAAGATGTGGCTGGG + Intronic
1146924711 17:36736277-36736299 GACAAGGAGGAGATGCAGGAGGG - Intergenic
1146948965 17:36892645-36892667 GACAAAGTCCAAAGGCAGCTTGG + Intergenic
1147548006 17:41418239-41418261 GACAAAGAGAAGATGCTGGGGGG + Intergenic
1147852831 17:43455463-43455485 GGCAAAGAGCATATACAGCATGG - Intergenic
1147993585 17:44349740-44349762 TCCAAAGATCAGGTGCAGCTGGG + Exonic
1150978091 17:70111340-70111362 CAAAAAGAGGAGATGGAGCTGGG + Intronic
1151449992 17:74192833-74192855 GAAAAAGAGCAGCTGTGGCTGGG - Intergenic
1151620543 17:75242331-75242353 GACAGAGAGCTGATGAAGGTGGG - Exonic
1151841121 17:76618256-76618278 GAGAAGAAGCAGATACAGCTAGG + Intergenic
1151872273 17:76844498-76844520 GACCAAGACCAGAGGCAGGTGGG + Intergenic
1152058469 17:78050816-78050838 GACAAAGATCAAATCCAGCCTGG + Exonic
1153054871 18:935946-935968 GACCAAGAGGAGGTGGAGCTTGG + Intergenic
1155276100 18:24189143-24189165 GCCAATGAGCAGTTGCAGTTAGG - Intronic
1156517717 18:37695189-37695211 GAAAAAGAGAAGAGGGAGCTGGG + Intergenic
1157805177 18:50652403-50652425 GATAAAGAGCTGATGCACCTGGG + Intronic
1158166994 18:54551486-54551508 GAGAAAGAGCTGAAGCAGCAGGG + Intergenic
1159605823 18:70473787-70473809 GTCAAAGAGAAGATGGAGATTGG - Intergenic
1159644637 18:70903031-70903053 GGGAAAGAGCAGAAGCAGCGAGG + Intergenic
1160869740 19:1271731-1271753 GGCAAGGAGCAGAGGCAGGTGGG + Intronic
1161912435 19:7204610-7204632 GACAAAGAGCAGCTGCAAGGTGG - Intronic
1165029484 19:32987314-32987336 GACAAAAAGTAGATGGTGCTGGG - Intronic
1166530261 19:43538386-43538408 AACATATAACAGATGCAGCTGGG - Intergenic
1166624274 19:44335647-44335669 GACAAAGAGCACATGTGGCCAGG + Intronic
1167824427 19:51959397-51959419 AACATAGAAAAGATGCAGCTGGG + Intergenic
925101721 2:1252595-1252617 GACATAGAGAAGATGCTGCCTGG + Intronic
926292556 2:11542336-11542358 CTCCAAGAGCAGATGCAGCCGGG - Intronic
927259043 2:21068363-21068385 CACAAAGGGGAGATACAGCTGGG - Intergenic
927614122 2:24572668-24572690 GTAAAATAGCAGGTGCAGCTCGG - Intronic
929675085 2:43918361-43918383 GGCAAAGAGCTGATGCAGTCTGG - Exonic
932439228 2:71721252-71721274 GCCCAAGGGCAGATGCTGCTGGG - Intergenic
932475316 2:72002409-72002431 GAGAAAGAGCAGAGCCAGCGTGG + Intergenic
932733221 2:74235107-74235129 GACACTGGGCACATGCAGCTTGG + Exonic
932841518 2:75087634-75087656 GACAATGTGGAGATACAGCTGGG - Intronic
933271052 2:80233317-80233339 GAAAAAGAGCAGATGCCCCCTGG + Intronic
934612512 2:95751743-95751765 GACTTAGAGCAGATGTACCTTGG + Intergenic
935091802 2:99901736-99901758 GAGAAAGAGCAGATGCAGGGAGG - Intronic
935535415 2:104287245-104287267 GACAGAGAGCAGATTCAGAGCGG + Intergenic
935976990 2:108587802-108587824 GACACAGTGCAGAAGCAGCAAGG - Intronic
937974042 2:127570369-127570391 GAAAAAGAGAGGAAGCAGCTTGG + Intronic
939187257 2:138875925-138875947 GACAAATACCAGATGCATGTGGG - Intergenic
942745520 2:179227780-179227802 GAAAATGAGCAGAGGCAGCAGGG + Intronic
943786035 2:191880179-191880201 TACAAAGAGCAGTGGCTGCTGGG + Intergenic
943876441 2:193072908-193072930 GACAATGAGGGGATGAAGCTGGG + Intergenic
944229131 2:197375911-197375933 TACAAAGAGCAGATAAAGCCTGG + Intergenic
945000566 2:205345873-205345895 TAAAAAAAGAAGATGCAGCTGGG + Intronic
945005388 2:205399648-205399670 TAAAAAAAGAAGATGCAGCTGGG - Intronic
945034332 2:205691311-205691333 GAGAAAGGGCAGAGGCAGCCTGG + Intronic
946212040 2:218154994-218155016 GAAAAAGAGCAAATGCCCCTGGG - Intergenic
946239816 2:218346583-218346605 GACAAAGTGCAGAGGTAGCCTGG - Exonic
946400922 2:219468139-219468161 GACCCAGAGCAGATGCCCCTTGG - Intronic
947486951 2:230559262-230559284 GAGAAACAGCAGATGCAGAAAGG + Intergenic
948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG + Intergenic
948318813 2:237052687-237052709 AACAGAGAGGAGATGCAGCCTGG + Intergenic
1169286825 20:4315350-4315372 AAAAAAGAGCAAATGCAACTGGG + Intergenic
1169418449 20:5438713-5438735 GAAAAATAGCTGATGCAGCTGGG - Intergenic
1169814157 20:9639484-9639506 GACAAAAACAAGATCCAGCTAGG - Intronic
1170470472 20:16663528-16663550 GAGAAACAGCAGATGCAGAAAGG - Intergenic
1171413307 20:24960683-24960705 GAGAAAGCGCAGGTGAAGCTGGG - Intergenic
1172057718 20:32165943-32165965 GACAAAGCACAGCTCCAGCTCGG + Exonic
1173344777 20:42188966-42188988 CTCAAAGAGCATATGAAGCTGGG + Intronic
1174372177 20:50098417-50098439 GAGCAAGGGCAGAAGCAGCTAGG + Intronic
1174804377 20:53593521-53593543 GGCCAAGAGCGGATGCAGCCCGG + Intronic
1175193960 20:57229695-57229717 GAGAAAGAGCAGAACCAGTTTGG + Intronic
1175270655 20:57731602-57731624 GACAAAGAGCAGAAGAAAGTAGG - Intergenic
1176010125 20:62888979-62889001 GATAAAGAGCAGAGGCGTCTGGG - Intronic
1176127522 20:63482582-63482604 GATGGAGAGCAGATGCAGGTGGG - Intergenic
1176733601 21:10522257-10522279 GGCCAAGAGCGGATGCAGCCCGG - Intronic
1176986676 21:15445415-15445437 GACAATGAGCAGGTGCAGGCAGG - Intergenic
1177231186 21:18321867-18321889 GACATAGGACAGATGCTGCTGGG - Intronic
1177924759 21:27200062-27200084 GACAAATAGCTGATGCATGTGGG + Intergenic
1178999277 21:37440430-37440452 GAAAAAGAGCAAATGAAGCTGGG - Intronic
1179434267 21:41349625-41349647 GACAAGCAACAGAAGCAGCTCGG + Intronic
1180538074 22:16414076-16414098 TCCAAAGAGCAGAAGCAGTTTGG - Intergenic
1180560297 22:16609952-16609974 GGCCAAGAGCGGATGCAGCCCGG + Intergenic
1181265356 22:21628015-21628037 GACAAAGAGCAGCTCCCTCTTGG - Intergenic
1183015475 22:34983093-34983115 GACAGAGAGCAGATGGTGCCTGG + Intergenic
1183535404 22:38398203-38398225 GGCCAAGAGCGGATGCAGCCCGG + Intronic
1184347226 22:43921407-43921429 GACAAAGAGAGGACCCAGCTGGG - Intergenic
1184519868 22:44986933-44986955 GGGAAAGGGCAGATGCAGGTGGG + Intronic
950795786 3:15509875-15509897 GAATAAGAGCAGATGGGGCTGGG + Intronic
954841342 3:53514533-53514555 GAGAAAGAGCAGATGCAGAAAGG - Intronic
956719604 3:72106217-72106239 GAGAAAGAGCAGGTGCAGCAAGG - Intergenic
957137431 3:76307288-76307310 GAGAAAGAGCTGGTTCAGCTAGG - Intronic
960127672 3:114018124-114018146 GACACAGAGCACATCCATCTGGG - Intronic
960936902 3:122910081-122910103 GGCACAGAGCAGATGGAGATGGG - Exonic
961215477 3:125156685-125156707 GATGAAGACCAGATGCAGTTTGG - Intronic
961518509 3:127453521-127453543 GACAAAGAGGTGTTGCAGCTAGG + Intergenic
962408055 3:135117090-135117112 CACAAAGAGCAGAGGCTGCCTGG + Intronic
965247376 3:166291323-166291345 AACAAAGTGCAGATGCAGGATGG - Intergenic
968188347 3:196649293-196649315 GAAAAAGAGCAATTGCACCTGGG - Intronic
968505783 4:970856-970878 GGCAAAGGGCAGATACTGCTCGG - Intronic
968552034 4:1228747-1228769 GACACTGAGCAGGTGCAGCTGGG + Intronic
968892088 4:3374825-3374847 GGCAAAGAGCAGGGGCGGCTAGG - Intronic
969252626 4:5979422-5979444 GACAAAATGAAGATGCAGCATGG + Intronic
969451990 4:7279262-7279284 GAAAAACATCAGATGGAGCTAGG + Intronic
969790420 4:9490751-9490773 GACAAACAGCAGAGTGAGCTGGG + Intergenic
973209943 4:47604592-47604614 GAAAAAGAGAAGATTCACCTGGG - Intronic
973268285 4:48233081-48233103 GACTAAGTGCAGCTGCAGCTGGG + Intronic
973894256 4:55396230-55396252 CAGAAAGAGCAGAAGCAGCCGGG - Exonic
974180699 4:58380919-58380941 GACAAACAGCAAATGCATGTGGG - Intergenic
974974130 4:68869043-68869065 GAGAAAGAGCTGAAGCAGCAGGG - Intergenic
976374092 4:84324641-84324663 GACAAACAGCAGCAGCATCTGGG + Intergenic
977460840 4:97322903-97322925 GAAAAACAGCAGATGCAACAAGG - Intronic
977944475 4:102896103-102896125 TCCAAAGAGCAGAAGCAGCCTGG - Intronic
978119036 4:105056251-105056273 ACCAAACGGCAGATGCAGCTTGG - Intergenic
978647882 4:110962241-110962263 GACAAGGAGCTGATGGAGCAGGG - Intergenic
979694513 4:123597440-123597462 GACAAAAAGTAGATGGAGTTGGG - Intergenic
980042534 4:127955646-127955668 GAGAAATAGCAGATGCAGGAAGG + Intronic
980855098 4:138430576-138430598 GACAAAGAGCAGTGACAACTGGG + Intergenic
980999478 4:139814759-139814781 CACAAAGCTCAGATGCAGGTAGG - Intronic
981303584 4:143220327-143220349 AACATGAAGCAGATGCAGCTTGG - Exonic
981404939 4:144357043-144357065 GACACAATGCAGATGCAACTGGG + Intergenic
982176343 4:152708956-152708978 GATAAAGAGCAGAGGTAGGTGGG + Intronic
983857386 4:172662741-172662763 GAAAAAGAGAAGATTCAGCAGGG - Intronic
984003060 4:174274147-174274169 CTGAAAGAGCAGCTGCAGCTGGG - Intronic
984017909 4:174447593-174447615 GAGAAACAGCAGATGCAGAAAGG - Intergenic
985570028 5:639764-639786 GACAAAGAGAAGGTGCCCCTGGG - Intronic
985706945 5:1406823-1406845 GACAAAAAGCAGATGGTGCTGGG - Intronic
985716713 5:1467101-1467123 GACACACAGCAGATGCTTCTCGG + Intronic
988387813 5:30589500-30589522 AACAAAGAACAGATGAATCTTGG - Intergenic
988952080 5:36273349-36273371 CACAAAGAGTACTTGCAGCTTGG + Intronic
990280748 5:54248339-54248361 GAGAAAGAGAAGATGGAGATAGG - Intronic
992893697 5:81228479-81228501 GACTAGAGGCAGATGCAGCTGGG - Exonic
992919804 5:81503157-81503179 AAAAAACAACAGATGCAGCTGGG + Intronic
994507612 5:100662487-100662509 GACGAAGTTCAGATGCAGGTTGG - Intergenic
994633420 5:102314096-102314118 TACAAAAGGCAGAAGCAGCTTGG + Intergenic
994695781 5:103072016-103072038 GACAAATAGCTGATGCATATGGG - Intergenic
996726252 5:126675419-126675441 GAGGTAGAGCAGATGCTGCTGGG + Intergenic
997145207 5:131425731-131425753 GACAGACAGCAGAGACAGCTAGG + Intronic
999094685 5:148967357-148967379 GACCAGGAGCAGATGGAGCAAGG + Intronic
1000518740 5:162273688-162273710 GAGAAACAGCAGATGCAGGAAGG + Intergenic
1001284177 5:170410355-170410377 GACACAGTGCAGGTGCACCTGGG + Intronic
1001616646 5:173048229-173048251 GACAGAGAGCTGAAGAAGCTGGG + Intergenic
1002514187 5:179744764-179744786 GAAAGAGAGCAAAAGCAGCTGGG - Intronic
1004164559 6:13244557-13244579 GAGAAAGAGAATGTGCAGCTAGG - Intronic
1005094507 6:22099499-22099521 GACAAATAGCTGGTCCAGCTTGG - Intergenic
1005165678 6:22917439-22917461 GACATAGAGCAGAAGGTGCTTGG - Intergenic
1006173837 6:32110065-32110087 GAGAAAGAGCAGGTGAGGCTTGG + Intronic
1009501903 6:64424526-64424548 GAAATAAAGCAGATGCAGTTTGG - Intronic
1009858221 6:69291794-69291816 GATAAAGAGCACATGCAGGAAGG + Intronic
1011524250 6:88246192-88246214 GCCAAAGAGCTGGTGGAGCTAGG - Intergenic
1011786933 6:90857557-90857579 GACAAAGAGCAGAAGGATGTAGG + Intergenic
1015571416 6:134624999-134625021 GACAAACAGCAGCTGAACCTAGG + Intergenic
1015790371 6:136959146-136959168 AACAGAGAGGAGAAGCAGCTGGG + Intergenic
1016737413 6:147494362-147494384 GACAGAGAGCAGAATCAGCGAGG - Intergenic
1016898900 6:149080963-149080985 GAGATAGAGCAAATGCAGCAAGG + Intergenic
1017080704 6:150665783-150665805 GACAAATGCCAGAAGCAGCTGGG - Intronic
1018212262 6:161493625-161493647 CACGAAGAGCAGATGCAGAAAGG + Intronic
1018766857 6:166940831-166940853 CACCAAGAGCAGATGCAGCCAGG + Intronic
1019602609 7:1892860-1892882 GACACAGAGCAAATGCAGTTTGG - Intronic
1022561070 7:31350196-31350218 GACAAAGAGCAAAGGCTGCAAGG - Intergenic
1023068390 7:36402577-36402599 GAAAAAGAGCAGGTCCAGATTGG - Intronic
1024645014 7:51363602-51363624 GAGAAGAAGCAGAGGCAGCTAGG - Intergenic
1025032106 7:55566159-55566181 GACAAAGAGAAGCTGGAGGTGGG + Intronic
1025840277 7:65140810-65140832 GACAAAAAGCAGTGGGAGCTGGG - Intergenic
1025882784 7:65555155-65555177 GACAAAAAGCAGTGGGAGCTGGG + Intergenic
1025890660 7:65647449-65647471 GACAAAAAGCAGTGGGAGCTGGG - Exonic
1028179877 7:87706730-87706752 GACAAACAGAAGTTGGAGCTTGG + Intronic
1028466898 7:91162569-91162591 GACAAAGAGCAAAGGCCGCAAGG + Intronic
1028849039 7:95515708-95515730 CAGAAAGAGCAACTGCAGCTGGG - Intronic
1029908780 7:104121421-104121443 GAGAAACAGCAGATGCTGCATGG - Intergenic
1031033008 7:116755087-116755109 GACAAAGAGCAGATGCAGCTTGG - Intronic
1031883885 7:127225518-127225540 GAGAATGATCTGATGCAGCTAGG + Intronic
1032351858 7:131171825-131171847 GACAAAGAACAGATAGAACTTGG + Intronic
1033524127 7:142193599-142193621 CACACAGAGCATATGCAGCAGGG - Intronic
1034519435 7:151608026-151608048 GAGAGAGAGAAGATGCAGCGCGG + Intronic
1034843567 7:154422273-154422295 GACAAAGAGCAGATGGAAAAGGG + Intronic
1039603609 8:38863202-38863224 CAAAAAGAGCAGGTGCGGCTGGG + Intergenic
1040276013 8:46014007-46014029 GACAGGGAGAAGACGCAGCTTGG - Intergenic
1040296559 8:46151993-46152015 GGCAAAGAGGAGAAGCAGCAAGG - Intergenic
1040547322 8:48408880-48408902 GAAGATGAGCAGATGCTGCTGGG + Intergenic
1042093516 8:65185898-65185920 GAGGAAGAGGAGATGTAGCTTGG - Intergenic
1042429512 8:68688858-68688880 GACAAATAGCTAATGCAGTTGGG + Intronic
1042917998 8:73894131-73894153 AAAAAAGAGAAGAAGCAGCTGGG + Intergenic
1045799421 8:106084905-106084927 GAGAAAGAGCAGAAGCAGAGTGG - Intergenic
1045804486 8:106141569-106141591 GACAAAGAGCGTATGCAGACAGG + Intergenic
1046392881 8:113600171-113600193 GTCAAAGAGCAGCTGCTGTTAGG - Intergenic
1048679337 8:136822369-136822391 GTCAAAGATCAGATGGGGCTGGG - Intergenic
1048809702 8:138274708-138274730 GAGAAAGAGAATGTGCAGCTGGG - Intronic
1050710924 9:8462302-8462324 GAAGAAGAGCAGATGGACCTGGG - Intronic
1050715983 9:8526122-8526144 GACAAAAAGCAGATGCTCCAGGG + Intronic
1052219449 9:26001760-26001782 GACAAAGAGCTAATGCATCCAGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053002038 9:34582350-34582372 CTCAGAGAGCAGAAGCAGCTTGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053545376 9:39017955-39017977 CAGAAAGAGGAGATGCAGCTGGG - Intergenic
1055599565 9:77901539-77901561 GAGAAAGAGTAGCTCCAGCTCGG - Intronic
1056223547 9:84472925-84472947 GAGAAAGATCAGATTGAGCTTGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056630695 9:88290773-88290795 GACAAAGGGCAGGAGCACCTAGG - Intergenic
1056847392 9:90052639-90052661 GGCACAGAGCAGATGAAACTGGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058132748 9:101271378-101271400 GGCAAAGAGCAGTTCCAGCCAGG - Intronic
1058219563 9:102280546-102280568 GACAAATAGCAGATGCAGGAAGG + Intergenic
1058697358 9:107570863-107570885 AACAAAAAGCAGAAACAGCTGGG + Intergenic
1058951766 9:109910655-109910677 GACTAGGAGCAGACGCAGCAGGG + Intronic
1058951775 9:109910715-109910737 GACTAAAAGCAGATGCAGCAGGG + Intronic
1058951786 9:109910776-109910798 GACTAGGAGCAGACGCAGCAGGG + Intronic
1061062480 9:128257596-128257618 GACAAGGAGGAGATGAAGGTAGG - Exonic
1061201731 9:129141981-129142003 GATAAATAGCAGCAGCAGCTAGG - Intronic
1188177420 X:27008745-27008767 GACAGTGAGCAGAAGCAGCAGGG + Intergenic
1191115161 X:56844700-56844722 GGCCAAGAGGAGATGGAGCTGGG - Intergenic
1193302055 X:79901180-79901202 GTCAAAGAGCAGATGATTCTAGG - Intergenic
1193636015 X:83949437-83949459 GACCTTGAGCAGATGCAGCAGGG - Intergenic
1193906262 X:87248644-87248666 GACAAAAAGCATATGCAAATTGG - Intergenic
1194245717 X:91509519-91509541 GTCAAAGATCAGATGCATGTAGG - Intergenic
1194637278 X:96361360-96361382 GACAAATAGCAGATGCATGCAGG + Intergenic
1196033026 X:111111948-111111970 GACAGAAAGCACATGCAGCATGG - Intronic
1197266683 X:124381307-124381329 GGCACAGAGCAGATGCAGCATGG + Intronic
1197289301 X:124636145-124636167 GGCAAAGAGCATATCCACCTTGG + Intronic
1200182257 X:154157823-154157845 GACAAACAGCAGAATCAGCTCGG - Intronic
1200187911 X:154194937-154194959 GACAAACAGCAGAATCAGCTCGG - Intergenic
1200193561 X:154232077-154232099 GACAAACAGCAGAATCAGCTCGG - Intronic
1200199316 X:154269881-154269903 GACAAACAGCAGAATCAGCTCGG - Intronic
1200465132 Y:3507191-3507213 AACAAAGAGAAGAGGAAGCTGGG + Intergenic
1200564687 Y:4750769-4750791 GTCAAAGATCAGATGCATGTAGG - Intergenic