ID: 1031033031

View in Genome Browser
Species Human (GRCh38)
Location 7:116755371-116755393
Sequence CACCCCTTGAAGGAGGGACA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 1, 2: 3, 3: 28, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031033025_1031033031 1 Left 1031033025 7:116755347-116755369 CCTTGTAGGTTTTCCCAAATAGT 0: 1
1: 0
2: 0
3: 23
4: 173
Right 1031033031 7:116755371-116755393 CACCCCTTGAAGGAGGGACAAGG 0: 1
1: 1
2: 3
3: 28
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031033031 Original CRISPR CACCCCTTGAAGGAGGGACA AGG Exonic
900402531 1:2478413-2478435 CACTCCTCGCAGGAGAGACACGG - Intronic
900529431 1:3145439-3145461 CAGCCCTGGAAGGAGGAACGGGG + Intronic
901164388 1:7207560-7207582 CACCCATTAGAGGTGGGACAGGG - Intronic
901296182 1:8162430-8162452 CACCAGTGGAGGGAGGGACAGGG - Intergenic
901771933 1:11534993-11535015 CACCCCTGCAAGGGAGGACAGGG - Exonic
904271320 1:29352148-29352170 CACACCATGAAGGAGTGAAAGGG + Intergenic
904463351 1:30693386-30693408 GACCCCATACAGGAGGGACAAGG - Intergenic
907259198 1:53204688-53204710 CACGTGTTGAAGGAGGGACCTGG + Intronic
907297908 1:53467208-53467230 AACCCCTTAGAGGAGGGGCAAGG - Exonic
907382590 1:54103520-54103542 CACGTGTTGAGGGAGGGACATGG - Intronic
907656044 1:56342699-56342721 CACCCAGCCAAGGAGGGACAGGG + Intergenic
907863897 1:58380186-58380208 CACATGTTGAAGGAGGGACATGG + Intronic
912726280 1:112061415-112061437 CCCCTCTTGAAGGACAGACAGGG + Intergenic
912764125 1:112393648-112393670 CACCCCTAGAAGTAGGGAACAGG - Intergenic
914417308 1:147495887-147495909 TGCCCATTGAAGGAGGGACCTGG + Intergenic
914956791 1:152169881-152169903 CACCCATACAAGGAGGCACAAGG - Intergenic
916480994 1:165214131-165214153 CACGTGTTGATGGAGGGACATGG + Intronic
917657160 1:177137950-177137972 CAGCACTTAAAGGAGGGAGAAGG + Intronic
919405517 1:197177166-197177188 CACATATTGAAGGAGGGACCTGG + Intronic
919483094 1:198113344-198113366 TCCCCCTGGAAGGAGGGAAAAGG + Intergenic
921317964 1:213909765-213909787 CATGCTTTGAAGCAGGGACAGGG + Intergenic
924511479 1:244731840-244731862 CAGCCCTGGAGGGAGGGGCAGGG + Intergenic
924563223 1:245174330-245174352 CACCCCTTTAAGGAGTATCATGG + Intronic
924788096 1:247219094-247219116 CAACCCTCGAACCAGGGACAAGG + Intergenic
924804975 1:247354772-247354794 CAACCCTCGAACCAGGGACAAGG + Intergenic
1063241661 10:4175848-4175870 CACCCATAGAAGGTAGGACAGGG + Intergenic
1063434921 10:6021887-6021909 CACCCCTTGCAGGAGTGACAGGG - Intronic
1067029333 10:42869907-42869929 GAGCCCTTGAAGGATGGGCAAGG - Intergenic
1067168475 10:43884384-43884406 CACCCCTTGCAGGTGGAACCAGG - Intergenic
1069250552 10:66261042-66261064 CAACCCTTGAGGAAGGGACTTGG - Intronic
1069623945 10:69855643-69855665 GACTCCGTGAAGCAGGGACAGGG - Intronic
1070424587 10:76272950-76272972 CACATGTTGAAGGAGGGACCCGG - Intronic
1072044734 10:91643551-91643573 CAGACCTTGAAGGATGGATATGG - Intergenic
1073514752 10:104066338-104066360 TAACCCTTGAACCAGGGACAAGG + Intronic
1075842794 10:125518537-125518559 CACCCCTTCCAGGAGGGAGGTGG + Intergenic
1076738947 10:132471688-132471710 CAACCCTGGCCGGAGGGACACGG + Intergenic
1081033970 11:38118155-38118177 CACGTGTTGAGGGAGGGACATGG + Intergenic
1081125632 11:39317487-39317509 CACACGTTGAGGGAGGGACCTGG - Intergenic
1081271564 11:41090669-41090691 CACATGTTGAAGGAGGGACCAGG + Intronic
1081334576 11:41848741-41848763 CACACTTTGAGGGAGGGACCTGG + Intergenic
1083752350 11:64767568-64767590 TACCCATTGGAGGAGGGCCATGG + Exonic
1086092939 11:83021775-83021797 CAGCCCTTGAGGTAGTGACATGG - Intronic
1087275630 11:96157938-96157960 CACCCCTTGAAGCTTGGAAAAGG - Intronic
1088266488 11:107992648-107992670 CACCCCTGGACTAAGGGACATGG - Intergenic
1091132965 11:133162056-133162078 AACCACTGAAAGGAGGGACAGGG + Intronic
1091389937 12:119916-119938 CCTCCCTTGAAGGAGGGTCTGGG + Intronic
1092077153 12:5683500-5683522 CAGACCTTGGAGGAGGGCCATGG + Intronic
1092208457 12:6631110-6631132 AACACCAGGAAGGAGGGACATGG + Intronic
1092973149 12:13718289-13718311 CTCACCTTGAAGGAGGGAAAAGG - Intronic
1095044445 12:37485282-37485304 CACATGTTGAAGGAGGGACTTGG - Intergenic
1095389763 12:41692021-41692043 CACATGTTGAAGGAGGGACCTGG + Intergenic
1101302245 12:103495039-103495061 CAGCTCTAGAAGTAGGGACAGGG + Intronic
1104923183 12:132301653-132301675 CAGCCCTTGGAGGAGGGACCTGG + Intronic
1105273403 13:18899715-18899737 CACCTCTTGCAGGGGGGACAAGG + Intergenic
1106076494 13:26465422-26465444 CACACCCTGAAGAATGGACAGGG + Intergenic
1106107920 13:26750411-26750433 CAGACCTTGATGGAGTGACATGG - Intergenic
1106242797 13:27924168-27924190 AACCCCTTCAAGGGGGGCCAGGG - Intronic
1109420075 13:62100272-62100294 CACCCCTCGCAGGAGGGAATGGG - Intergenic
1111586253 13:90288032-90288054 CAAGCCTTGAACCAGGGACAAGG + Intergenic
1112227171 13:97551173-97551195 CATGCTTTGAAGGAGGGACCTGG + Intergenic
1114666050 14:24377758-24377780 CACTCCAGGAAGGAGGGAAAGGG - Exonic
1117758370 14:58999547-58999569 CACCTGTTGAGGGAGGGACCTGG + Intergenic
1120827870 14:88971468-88971490 CACCCCTTGAAGCAATCACAGGG + Intergenic
1121440559 14:93946335-93946357 CTGCCCTTGAAGGATGGACAGGG - Intronic
1124204935 15:27709559-27709581 CACATGTTGAGGGAGGGACAGGG + Intergenic
1125062251 15:35438342-35438364 CATCGCTTGAACCAGGGACATGG - Intronic
1125277971 15:38013304-38013326 CACCACAGGAAGGAGGGAAAAGG + Intergenic
1125500204 15:40235067-40235089 CACCTGTAGAAGGAGGGACAGGG + Intergenic
1126290461 15:47070772-47070794 CACCTGTTGAAGGAGGGACTTGG + Intergenic
1126668993 15:51099273-51099295 GACCCCTTGTAGGAGGCAGAGGG + Intronic
1129185454 15:73903340-73903362 CAGCCCTTGAAGGAAGGGCGGGG + Intergenic
1129367353 15:75064513-75064535 CAACCCTCGAACCAGGGACAAGG + Intronic
1130825593 15:87542217-87542239 GACCCTCTGAAGGAGGGAAATGG - Intergenic
1131140518 15:89973290-89973312 CATGCCCTGAAGGACGGACAGGG - Intergenic
1131743522 15:95420626-95420648 CACCTGTTGTAGGAGGGACCAGG - Intergenic
1132183241 15:99778640-99778662 CACCCCTTGGAGCTGAGACAGGG - Intergenic
1132819636 16:1857382-1857404 CGCCCCTTCAAGGAAGGTCATGG + Intronic
1135076599 16:19399483-19399505 CTCCCCAGGAAGGAGGGATATGG + Intergenic
1136998598 16:35208385-35208407 CATCCCTAGAGGGAGGGGCAGGG + Intergenic
1142179387 16:88660049-88660071 CACTCCTTCAGGGAGGGAAAGGG - Intronic
1143680879 17:8475185-8475207 CCCCCCTTGGGGGATGGACATGG + Exonic
1143784634 17:9247347-9247369 CACCCCTTGAGGAAGGCAAAGGG + Intergenic
1144451353 17:15382350-15382372 CATCCTTGGAAAGAGGGACAGGG - Intergenic
1145405438 17:22586384-22586406 CACGCGTTGAGGGAGGGACCTGG + Intergenic
1147685422 17:42284078-42284100 CTCTCCTTGAAGAAGGGACTTGG + Intergenic
1150119492 17:62588340-62588362 AACTGTTTGAAGGAGGGACAAGG - Intronic
1150339620 17:64356027-64356049 CACCCCTTGTAAGAGGGAGTTGG - Intronic
1150928877 17:69563254-69563276 CACCTGTTGTAGGAGGGACCTGG + Intergenic
1151518571 17:74612935-74612957 CAGTCCTTGATGGAGGGAGAAGG - Intronic
1151898946 17:76999040-76999062 CACTCCTGTCAGGAGGGACATGG - Intergenic
1154465162 18:14637280-14637302 CACCTCTTGCAGGAGGGACAAGG + Intergenic
1156370127 18:36465559-36465581 CACCCCTGGAAGCAGTGTCAGGG - Intronic
1156485245 18:37461528-37461550 CACCCGTTGTGGGAGGGACCTGG - Intronic
1156649239 18:39204693-39204715 CACACCTTCAAGAAGGGAAAAGG + Intergenic
1157003287 18:43552277-43552299 CACACTTGGCAGGAGGGACAGGG - Intergenic
1157175529 18:45448641-45448663 CACTTCTGGATGGAGGGACAAGG - Intronic
1162789089 19:13053882-13053904 CACCCCTTGAGGGTGGGACTGGG - Intronic
1163349945 19:16770195-16770217 CACACATTGAGGGAGGGACCAGG + Intronic
1163488736 19:17605125-17605147 CACCCCTTGGAGGAGGCCGAGGG + Exonic
1165453916 19:35900101-35900123 TACCCCTAGAAGCAGGGACTAGG - Intronic
1165491364 19:36125215-36125237 CACCCAGTGAATGGGGGACAGGG + Intronic
1165870838 19:38971981-38972003 CACCCCATGAAGTAGGCACATGG + Intronic
1166646960 19:44539291-44539313 CACCTTCTGAAGGAGGGAAAGGG + Intergenic
1167384534 19:49156160-49156182 AATCCCATGGAGGAGGGACAGGG - Intergenic
1167511093 19:49895718-49895740 CACCCCCTCAAGGAGGAACGCGG + Intronic
926220813 2:10934529-10934551 CAACACTTGGAGGAGGAACAGGG - Intergenic
926936172 2:18088289-18088311 TAACCCTAGAAGTAGGGACAAGG - Intronic
927945212 2:27131503-27131525 CACTCCCTGCAGGAGGGAAAGGG + Exonic
929448856 2:42023084-42023106 CACCTGTTGAGGGAGGGACCTGG + Intergenic
930043690 2:47149930-47149952 CTCGCCTTGAATGAGGGGCAGGG - Intronic
931700949 2:64908709-64908731 CATTCCTTGAAGGTGGGACTAGG + Intergenic
932415856 2:71573506-71573528 GACCCCATGAACGAGGTACAGGG + Intronic
932635804 2:73386493-73386515 CGAGCCTTGAAGGAGGGAAAAGG + Intronic
932935822 2:76099681-76099703 CACCCATTGTGGGAGGGACCTGG - Intergenic
934945484 2:98538127-98538149 CACACCTTGAAGCAGGAAAAAGG + Intronic
935663935 2:105494146-105494168 CACACCCTGAGAGAGGGACAAGG - Intergenic
935678424 2:105616288-105616310 AGCCCCTTGAAGGAGGGAGCTGG + Intergenic
937584689 2:123531947-123531969 CACCTGTTGACGGAGGGACCTGG - Intergenic
937873619 2:126804018-126804040 CACACCCTGCAAGAGGGACAAGG - Intergenic
942630291 2:177945982-177946004 CACCCCGTCCAGGAGGGAGATGG + Intronic
943266032 2:185734196-185734218 CATGCCTTGGAGGAGGGTCAAGG - Intergenic
943609349 2:190014478-190014500 CACATGTTGAGGGAGGGACATGG - Intronic
943953912 2:194162123-194162145 CAACCCATGAAACAGGGACAAGG - Intergenic
944176145 2:196831085-196831107 CAACCCTTGAACCAGAGACAAGG - Intergenic
944516789 2:200520597-200520619 GACAACTTGAAGCAGGGACAGGG + Intronic
945623546 2:212171571-212171593 CACATATTGAAGGAGGGACCAGG + Intronic
946968489 2:225066343-225066365 CACATGTTGAAGGAGGGACCTGG + Intergenic
948316016 2:237029077-237029099 CAGCCTTTGAAGGAAGGCCATGG + Intergenic
1168820126 20:767304-767326 CAACCCTTGAAGGACACACAGGG + Intronic
1171135626 20:22692148-22692170 CGCTGCTTGCAGGAGGGACAGGG - Intergenic
1171363538 20:24607629-24607651 CGGCCCTTGAAGCAGGGAGAGGG - Intronic
1171449202 20:25224308-25224330 GACCCCATGAGGGTGGGACAAGG - Intronic
1171802041 20:29631355-29631377 CACGTGTTGAAGGAGGGACTTGG + Intergenic
1171841935 20:30224226-30224248 CACGTGTTGAAGGAGGGACTTGG - Intergenic
1173458017 20:43219308-43219330 CCCCCCTTTAGGGAGGAACAGGG + Intergenic
1173711732 20:45163329-45163351 CACCCCTTTATGGAGGGCCCTGG + Intergenic
1174035180 20:47664296-47664318 CCACCCCAGAAGGAGGGACAGGG - Intronic
1175198173 20:57260541-57260563 CACCCCATGAAGGCGAGAGAAGG + Intronic
1175275287 20:57764423-57764445 CACATCTTGCAGGAGGGACCTGG - Intergenic
1175524229 20:59622578-59622600 CACCCCTCGCAGCAGGCACACGG - Intronic
1176021227 20:62963388-62963410 CACCCCTTGGAGCAGCGGCAGGG + Intronic
1176342222 21:5709572-5709594 CAGCCCTGGAGGGAGGGACAGGG - Intergenic
1176474476 21:7141724-7141746 CAGCCCTGGAGGGAGGGACAGGG - Intergenic
1176502605 21:7614884-7614906 CAGCCCTGGAGGGAGGGACAGGG + Intergenic
1176536543 21:8107641-8107663 CAGCCCTGGAGGGAGGGACAGGG - Intergenic
1176809376 21:13521106-13521128 CACCTCTTGCAGGAGGGACAAGG - Intergenic
1178139166 21:29662613-29662635 CACCTTTTGAAGGAGAGACAGGG + Intronic
1179265877 21:39802967-39802989 CACACGTTGTGGGAGGGACATGG - Intergenic
1179983951 21:44910886-44910908 CACCCCCTGCAGCAGGGACAGGG - Intronic
1180845370 22:18978342-18978364 CTCCCCTTGACAGAGGGGCAGGG + Intergenic
1180928326 22:19571438-19571460 CACCCCTTGGAGGAGGGACAGGG + Intergenic
1181658002 22:24317669-24317691 CACCCCGTCCAGGAGGGAGATGG - Intronic
1181792297 22:25277772-25277794 CACCCCGTCCAGGAGGGAGATGG - Intergenic
1182519451 22:30877045-30877067 CTGCCCTTGCAGGAAGGACAGGG - Intronic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
1184273566 22:43398175-43398197 GGCCCCTGGAAGGAGGGCCAAGG + Intergenic
1203241488 22_KI270733v1_random:24052-24074 CAGCCCTGGAGGGAGGGACAGGG - Intergenic
949204389 3:1420634-1420656 CATCCATTGGAGGAGGGAGAAGG - Intergenic
950254547 3:11493577-11493599 CACCCATTGAGGGAGGCAGAAGG - Intronic
950635873 3:14314157-14314179 CCCCCCTTGAAGCAGGCAGAGGG + Intergenic
950683088 3:14598640-14598662 GAGCCCTTGAAGGAGGGGCTCGG - Intergenic
951969915 3:28432081-28432103 CACATGTTGTAGGAGGGACATGG - Intronic
952583029 3:34856806-34856828 CAACCCCTGAAGGAGGCCCAGGG - Intergenic
952746922 3:36790426-36790448 CAGCACTTAAAGGATGGACAAGG - Intergenic
953449770 3:42996513-42996535 CACCCTATGAAGGAGGTACTAGG + Intronic
953811643 3:46117644-46117666 CAACCCTTGAACCAGGGACAAGG - Intergenic
954108191 3:48420221-48420243 CACCTCTTGCAGGAGGGTCTGGG + Exonic
954399614 3:50312176-50312198 CACCCCGTCCAGGAGGGAGATGG - Intronic
954432658 3:50479531-50479553 CACCCCTTGGAGGTGGCACTGGG - Intronic
954665183 3:52247801-52247823 CACCCCTTGGAGGGTGGGCAAGG + Intronic
954682976 3:52355829-52355851 AACCCCTTGAAGGATGGTGAGGG - Intronic
955025906 3:55167195-55167217 CAGCTCTTGCAGGAAGGACAAGG + Intergenic
955576015 3:60363966-60363988 CACCCCTTGACCTAGGGACAAGG - Intronic
955650253 3:61186458-61186480 ATCCCCTTGAATGAGGCACAGGG + Intronic
956270497 3:67444264-67444286 CACCCCGTCCAGGAGGGAGATGG + Intronic
957442690 3:80270985-80271007 CACACGTTGTAGGAGGGACCCGG + Intergenic
962112939 3:132471126-132471148 CACCCCGTCCAGGAGGGAGATGG - Intronic
963719116 3:148839643-148839665 CACCAATTGAAGGAGTGACCAGG + Intronic
964912490 3:161800060-161800082 CACACCTTGCGGGAGGGACCTGG - Intergenic
965105855 3:164351518-164351540 CATCCCCTGAAGGAGAGAAATGG + Intergenic
966217754 3:177520290-177520312 CACACCCTGCAAGAGGGACAAGG + Intergenic
967207037 3:187133253-187133275 CACCTGTTGAGGGAGGGACCTGG + Intronic
967208323 3:187144630-187144652 CACACGTTGAGGGAGGGACCTGG - Intronic
969181648 4:5446597-5446619 CACCCCTTAGAGAGGGGACAAGG - Intronic
969486773 4:7476730-7476752 CACCTCTCTAAGCAGGGACATGG + Intronic
969489391 4:7490551-7490573 CTTTCCTTGAAGGAGGGAGAGGG + Intronic
970100231 4:12513589-12513611 CACATCTTGAGGGAGGGACCTGG + Intergenic
971157801 4:24102153-24102175 CACCCACTGAAGGTGGGACAGGG - Intergenic
974195542 4:58569973-58569995 CACCCCTTGAAGGAAGCATGAGG - Intergenic
974625545 4:64422930-64422952 CCCCGCTTGAAGAAGGGTCAAGG + Intergenic
975516910 4:75257940-75257962 AGCTCCTAGAAGGAGGGACATGG + Intergenic
978809884 4:112838081-112838103 CACATGTTGAGGGAGGGACATGG + Intronic
979799856 4:124894945-124894967 CACACCCTTAAGGAGGGGCAAGG - Intergenic
980096774 4:128499771-128499793 CACATGTTGAAGGAGGGACCTGG - Intergenic
981491931 4:145348747-145348769 CACGCATTGAGGGAGGGACAAGG + Intergenic
981914348 4:150017063-150017085 CACCTGTTGAGGGAGGGACCCGG - Intergenic
982781232 4:159493186-159493208 CACCCCTGGAAGGCAGGGCATGG + Intergenic
982795126 4:159635226-159635248 CACACGTTGTAGGAGGGACCTGG - Intergenic
986352961 5:6897034-6897056 CACCTGTTGAGGGAGGGACCTGG + Intergenic
986420510 5:7576275-7576297 GACTCCTTGGGGGAGGGACAGGG + Intronic
986512075 5:8517809-8517831 CACCTGTTGAGGGAGGGACCTGG - Intergenic
986764109 5:10908195-10908217 CACACCTTGTGGGAGGGACCTGG + Intergenic
988425369 5:31057489-31057511 CACGTGTTGAGGGAGGGACATGG - Intergenic
990792286 5:59495744-59495766 CACACCTTGCAAGGGGGACAAGG - Intronic
991355908 5:65768465-65768487 CACGTATTGAGGGAGGGACATGG - Intronic
991696751 5:69280067-69280089 CACATGTTGAAGGAGGGACTTGG - Intergenic
991937551 5:71816899-71816921 CGCCCCTTGGAGGAGTGACCTGG + Intergenic
993143976 5:84070485-84070507 CACACCTTGCAAGGGGGACAAGG + Intronic
994272181 5:97791470-97791492 CACGTTTTGAAGGAGGGACCCGG + Intergenic
994544294 5:101143626-101143648 CACCTGTTGAGGGAGGGACTTGG + Intergenic
998101588 5:139439374-139439396 CCCCGCCTGAAGGAGGGATAGGG - Intronic
998121946 5:139585724-139585746 GACTCCTTGAATGAGAGACAAGG - Intronic
999621624 5:153480259-153480281 CACCCCTTGAAGGACATCCAAGG + Intergenic
999715465 5:154356646-154356668 CTCCCCCTGAAGGTGGGAGAAGG + Intronic
1001425063 5:171617552-171617574 CAGCCCCAGATGGAGGGACAAGG - Intergenic
1001466370 5:171970200-171970222 AATCCCTCGAAGGAGGGACTTGG + Intronic
1001553886 5:172623339-172623361 AACCCCTTGCTGGAGGGAGAAGG + Intergenic
1002089924 5:176798456-176798478 CTCCCCTTGAAGGAAGGGAAAGG + Intergenic
1003395930 6:5751960-5751982 CACCCCATGAAGAGGGGCCAGGG - Intronic
1006003288 6:30983446-30983468 CACCCTTTGAAGCAGGGATCGGG - Intergenic
1007408054 6:41646132-41646154 CAGCCCAGGAAGGAGGGATAGGG - Exonic
1007901853 6:45420727-45420749 CACCCCAAGAAGGGGGCACAGGG - Intronic
1007932721 6:45706988-45707010 CGCCCCTGGAGGTAGGGACAGGG + Intergenic
1008222881 6:48876198-48876220 CTCCCCAAGAAGGAGGGATATGG - Intergenic
1015344117 6:132135547-132135569 CACCTCATGAAGAAGTGACATGG - Intergenic
1016019477 6:139220605-139220627 CAACCCTAGAAGGAGGGGAAGGG - Intergenic
1016672064 6:146720844-146720866 CACACGTTGAAGGAGGGGCCTGG - Intronic
1017510571 6:155111151-155111173 CACCCCTGGAAGGTGGAAAAAGG + Intronic
1017589114 6:155959458-155959480 CACGTGTTGAAGGAGGGACTTGG - Intergenic
1017707737 6:157139495-157139517 CACCCCCTGCAGGCGGGCCAGGG - Intronic
1017819466 6:158038877-158038899 CAGCCCAGGAAGGAGGGGCATGG + Intronic
1017966107 6:159267867-159267889 CACACCTTGATGGAAGAACAGGG + Exonic
1019733537 7:2639781-2639803 CACAGCTTGGAGGAGGGAAAGGG - Intronic
1020082074 7:5291568-5291590 TTCCCCTTTAAGGAGGGCCAGGG - Intronic
1020105314 7:5420036-5420058 CAGCCCGGGAAGGAGGGACCAGG + Intronic
1020743470 7:12051756-12051778 CACGTGTTGAAGGAGGGACCTGG - Intergenic
1020774493 7:12435954-12435976 CACATGTTGAAGGAGGGACCTGG - Intergenic
1021170527 7:17393752-17393774 CACACGTTGTAGGAGGGACCTGG - Intergenic
1021522992 7:21555297-21555319 CAACCCTTGAATCAGGGACAAGG - Intronic
1021643895 7:22768675-22768697 ATCCCCTTGAGGGAGGGACCTGG + Intergenic
1021787015 7:24162651-24162673 CACTCGTTGAGGGAGGGACGTGG + Intergenic
1022041775 7:26588251-26588273 CCACCCTCAAAGGAGGGACAGGG - Intergenic
1022735944 7:33076199-33076221 CACATGTTGAAGGAGGGACCTGG + Intergenic
1023903861 7:44507234-44507256 CACCCGTTGTGGGAGGGACCTGG - Intergenic
1023937660 7:44750764-44750786 GACCCCTTGAGAGATGGACAAGG - Intronic
1024532675 7:50406477-50406499 CTCCCATTGAAGGAGGGCCAGGG - Intergenic
1025290370 7:57714824-57714846 CACGTGTTGAAGGAGGGACTTGG - Intergenic
1026577110 7:71581550-71581572 CACGCGTTGAAGGAGGGACCTGG - Intronic
1027371211 7:77509533-77509555 CACCCCGTCCAGGAGGGAGATGG + Intergenic
1028724502 7:94071666-94071688 CAGCCCTTGAAGGAGAGAAATGG + Intergenic
1029458894 7:100684416-100684438 CTCCCCTGCATGGAGGGACAGGG - Intronic
1029508960 7:100981353-100981375 CACTCGCTGCAGGAGGGACAAGG - Intronic
1029935132 7:104416545-104416567 CCTCCCTTGTAGGAAGGACATGG - Intronic
1030613629 7:111715389-111715411 AACTACTAGAAGGAGGGACAGGG + Intergenic
1030944207 7:115695855-115695877 GACCCCTTGAAGGAGTGGCCTGG + Intergenic
1031033031 7:116755371-116755393 CACCCCTTGAAGGAGGGACAAGG + Exonic
1034440257 7:151082543-151082565 CACCCCTTCAATCAGGGTCATGG + Exonic
1034710059 7:153183511-153183533 CACAGGTTGAAGGAGGGACCTGG - Intergenic
1034839069 7:154378969-154378991 CACACGTTGAGGGAGGGACTTGG - Intronic
1038043925 8:23750297-23750319 CACCTGTTGAGGGAGGGACCTGG + Intergenic
1038709437 8:29928011-29928033 GACCCCTCTAAGGAGAGACAGGG + Intergenic
1039620697 8:38995018-38995040 CATGCCTTGAAGGAGAGTCAGGG + Intronic
1040122630 8:43699920-43699942 CTCCCCAGGAAGGAGGGATATGG + Intergenic
1043391726 8:79798535-79798557 CACCCCTTGAGGAAGGAAGATGG - Intergenic
1050953415 9:11626181-11626203 CATGTGTTGAAGGAGGGACATGG + Intergenic
1054166057 9:61730539-61730561 CACGTGTTGAAGGAGGGACTTGG + Intergenic
1054707790 9:68480349-68480371 CACCCCTTGAAGGAACCTCATGG + Intronic
1055414203 9:76064242-76064264 CACCCCGTCCAGGAGGGAGATGG - Intronic
1057391996 9:94647981-94648003 GACCCCTGGAAGGAGGGCCCAGG + Intergenic
1057915687 9:99053469-99053491 CTCCCCTGGAAGGAGGGGGAGGG + Intronic
1058386406 9:104441587-104441609 CACCCCTGGATGGAGTGAGATGG + Intergenic
1059706245 9:116826175-116826197 CACCCAGTCAAGGAGGGACAGGG + Intronic
1060745484 9:126128096-126128118 CACACGTTGAGGGAGGGACCTGG + Intergenic
1061912836 9:133734022-133734044 CGGACCCTGAAGGAGGGACAGGG - Exonic
1062012557 9:134274884-134274906 GACCCCTTGAAGGAGCAAGAGGG + Intergenic
1062438617 9:136558547-136558569 CCCCACATGAAGGAGGGACCTGG + Intergenic
1203457810 Un_GL000220v1:7127-7149 CAGCCCTGGAGGGAGGGACAGGG - Intergenic
1185444660 X:251158-251180 CACCCCTTCAAGGATGCACATGG - Intergenic
1185644774 X:1608939-1608961 CAGCCCCTGGAGTAGGGACAGGG - Intergenic
1186006349 X:5076675-5076697 CACCTGTTGTAGGAGGGACTGGG + Intergenic
1186590458 X:10925059-10925081 CACGTCTTGAGGGAGGGACCTGG - Intergenic
1188427631 X:30067536-30067558 CACCCACCCAAGGAGGGACAAGG + Intergenic
1191172133 X:57458980-57459002 CTCCCCTGGAAAGAGGGAAAGGG + Intronic
1194068210 X:89288037-89288059 CACACCCTGCAAGAGGGACAAGG - Intergenic
1195343399 X:103926238-103926260 CACCTCTTGGTGGAGAGACATGG - Intronic
1195365129 X:104117335-104117357 CACCTCTTGGTGGAGGGAGATGG + Intronic
1196475496 X:116079974-116079996 CACCCACTCAAGGAAGGACAAGG + Intergenic
1196724685 X:118885570-118885592 CAACCCTTGAACCAGGGACAAGG + Intergenic
1200722352 Y:6622207-6622229 CACACCCTGCAAGAGGGACAAGG - Intergenic
1200762399 Y:7052036-7052058 GACACCTTGAAGCAGGGAGAGGG + Intronic