ID: 1031033712

View in Genome Browser
Species Human (GRCh38)
Location 7:116764586-116764608
Sequence CCTTCCAAGCACAGTCTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031033708_1031033712 24 Left 1031033708 7:116764539-116764561 CCTGTATCTATGATGAAGGGATT 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1031033712 7:116764586-116764608 CCTTCCAAGCACAGTCTTTATGG 0: 1
1: 0
2: 1
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031033712 Original CRISPR CCTTCCAAGCACAGTCTTTA TGG Intronic
902065946 1:13687631-13687653 TCTACTAAGCACAGTCTTCACGG + Intergenic
903920618 1:26797651-26797673 CTTCCAAGGCACAGTCTTTAAGG - Exonic
904045447 1:27605616-27605638 CCTTCCAAGCTCCTTCTCTATGG + Intergenic
908251520 1:62269590-62269612 ACTTCCAGGCAAAGTTTTTATGG - Intronic
909055711 1:70818268-70818290 CATTTCAAGCTCATTCTTTATGG + Intergenic
910351278 1:86300727-86300749 CCTTCCAAGCTCATTCTGCAAGG - Intergenic
912543638 1:110435364-110435386 TCTCCCAAGCATAGACTTTATGG + Intergenic
915670962 1:157488875-157488897 CCGTCCAAGCCCAGGCTTAAAGG + Intergenic
916522840 1:165580700-165580722 TCTTCCTAGCAGAGACTTTAGGG + Intergenic
917064587 1:171077704-171077726 CCTTCCTGGCACATTCTTCAAGG + Intergenic
919094354 1:193011989-193012011 CCTTCCAGCCTCAGTCTTTTGGG + Intergenic
924255833 1:242182050-242182072 ACTTTCAAGCTCTGTCTTTAGGG - Intronic
1063170913 10:3509229-3509251 ACTTCCAAGCATAGTGTTAAAGG + Intergenic
1066177086 10:32919190-32919212 CCTTCTAAGCCTAGTCTTTTGGG + Intronic
1067785505 10:49242719-49242741 CCTTCCAGCCCCAGCCTTTAGGG - Intergenic
1071526130 10:86360018-86360040 CCTTACAAGCACTGCCTTTTAGG - Intronic
1077197395 11:1288287-1288309 CCTTCCAAGCTCTGCCCTTAGGG - Intronic
1078450001 11:11433717-11433739 CTCTGCAAGCATAGTCTTTATGG + Intronic
1079855824 11:25602473-25602495 ACTTCTAAGCACAGTTCTTAAGG + Intergenic
1082968885 11:58998269-58998291 ACTTCCAAGTACAGCCTTTGTGG + Intronic
1087126057 11:94626577-94626599 CCCTCCTAGCACAGTCTTGGAGG - Intergenic
1087850810 11:103027406-103027428 GCTTCCTAGCACAGATTTTAAGG + Intergenic
1094812385 12:34151246-34151268 ACTTCCAAGCACACTCATTGTGG - Intergenic
1097233117 12:57523853-57523875 CTTTCCAAGCCCAGTCCCTAGGG - Intronic
1097782548 12:63724799-63724821 CCTTCCAGAAACAGTTTTTACGG - Intergenic
1098296270 12:69007202-69007224 CCTTCCGAGCACTTTCTTCATGG + Intergenic
1099901581 12:88717017-88717039 CCTTCACATCATAGTCTTTATGG + Intergenic
1101555149 12:105801945-105801967 CGTTCAAAGCAAAGTCTTGAGGG - Intergenic
1102857408 12:116306265-116306287 CGGCCCAAGCACAGTTTTTAAGG + Intergenic
1105884322 13:24628971-24628993 CCTTCCAAGTTCACACTTTATGG - Intergenic
1105985580 13:25562955-25562977 CCTTCCCAGCACACTGTTGAGGG + Intronic
1108965492 13:56294050-56294072 ACTTCCAAGCACAGTGATTATGG + Intergenic
1110684309 13:78353637-78353659 TCTTCCAAGCTCATTCTTTTTGG - Intergenic
1111363102 13:87202694-87202716 ACTTCCAAGCATATTCTTTGAGG - Intergenic
1111792890 13:92881177-92881199 CCTTCCCAGCACAATCTCTGGGG + Intergenic
1116176170 14:41473190-41473212 CCTTGCCAGCCCAGTCTTTGGGG + Intergenic
1118314299 14:64716195-64716217 CCAGCCAATCACAGGCTTTAGGG + Intronic
1118595039 14:67428736-67428758 CCTTCCAACCTCAGGCTTGAGGG + Intergenic
1118969889 14:70626177-70626199 ACTTCCAAGCTCATTCTATAAGG + Intergenic
1119134579 14:72205097-72205119 TCTTCCCAGTACAATCTTTATGG + Intronic
1119484542 14:74979220-74979242 CCTTCCAAGGCCAGTAATTAGGG + Intergenic
1119965759 14:78913946-78913968 CAGTCCAGGCAGAGTCTTTAGGG - Intronic
1120689743 14:87579485-87579507 CCCTCCAAACAGAGTCTTTAAGG - Intergenic
1121988811 14:98534286-98534308 TCTTTCTAGCACAGTTTTTATGG + Intergenic
1122072973 14:99216714-99216736 CCTCCCAAGCTCTGTGTTTATGG - Intronic
1127764976 15:62176551-62176573 CATCCCAGACACAGTCTTTATGG - Intergenic
1129111064 15:73337498-73337520 CCTTCGATGCTCTGTCTTTAAGG - Intronic
1129799328 15:78401806-78401828 CCTCCAAGTCACAGTCTTTAGGG - Intergenic
1130672267 15:85923134-85923156 CCTTCCCAGCACAGGCCTTTGGG - Intergenic
1130717216 15:86346643-86346665 CCGGCCAAGCTCATTCTTTATGG + Intronic
1131002417 15:88949575-88949597 CCTTCCAAACACATCCTTCAGGG - Intergenic
1133925308 16:10187491-10187513 CCATCAAAGCACTGTCTTGAGGG - Intergenic
1134421485 16:14095110-14095132 CCTTCCATGCACTGCCTTTCAGG - Intronic
1137432774 16:48432032-48432054 CCTTCCAAGGATGGGCTTTAGGG - Intronic
1137493790 16:48953263-48953285 ACTTCCAGGCACAGTGTGTAAGG - Intergenic
1137954551 16:52815723-52815745 CCTTCCAAGAACATCCTTTTTGG + Intergenic
1138792912 16:59929568-59929590 CCTTCCAAAACCAGTCTTTAAGG - Intergenic
1142946102 17:3428956-3428978 TCTTCCAAACACATTCTATAAGG + Intergenic
1143056264 17:4164310-4164332 TCTTCCAAAGAAAGTCTTTAAGG + Intronic
1147459501 17:40559270-40559292 CCAACCAAGCTCAGTCTTGAGGG - Intronic
1147608966 17:41790305-41790327 CCATTCAAACACAGTCCTTAGGG + Intergenic
1155133397 18:22962070-22962092 CTTTCCAATTACAGTATTTAAGG - Intronic
1155342807 18:24830048-24830070 CACTCAAAACACAGTCTTTAAGG - Intergenic
1158058017 18:53304687-53304709 ACTTCCAAGCATAGTCCTGAAGG - Intronic
1158272531 18:55732498-55732520 CCTTCCCAGAAAAGTCCTTAAGG - Intergenic
1160247032 18:77167073-77167095 CCTTCTCAACACAGACTTTAAGG - Intergenic
929841598 2:45470754-45470776 ACTTTCCAGCAAAGTCTTTAGGG + Intronic
930089801 2:47523510-47523532 TGTTCAAAGCACAGGCTTTAAGG + Intronic
931416310 2:62084845-62084867 TTTTCCAAGCACAGACTTTAGGG + Intronic
931442280 2:62298729-62298751 CCATCCAAGCATATTCTTCAGGG - Intergenic
933271514 2:80238037-80238059 CCGTCCAAGGACAAGCTTTAAGG + Intronic
934751177 2:96795192-96795214 CCTTCCAGGCACTGTCTTTCTGG + Intronic
935390912 2:102551863-102551885 CCTTCCAAGCACATTCTTTTTGG - Intergenic
935911991 2:107907123-107907145 ACTTCCAAACTCATTCTTTAAGG + Intergenic
937504946 2:122526410-122526432 TCCTCCAAGCACAGTCTCTCAGG - Intergenic
937580954 2:123487460-123487482 CCTTCCAAGCTCCGTCCTTGTGG + Intergenic
938072703 2:128317046-128317068 CCTTCCCAGCCCAGACTTTGGGG + Intronic
938234219 2:129689901-129689923 CCTTGCATGCAGAGTCTTTTGGG - Intergenic
944830415 2:203528337-203528359 CCTTCCAAACACAGTTTTGGTGG + Intronic
945316260 2:208374056-208374078 CCTTAAAATCAAAGTCTTTAAGG - Intronic
947330790 2:229027413-229027435 CATTCAGAGCACAGTCTTTGAGG + Intronic
1169547155 20:6661946-6661968 ACTTCCAAGCCCAGTCTTAAGGG - Intergenic
1170032637 20:11958804-11958826 CTTTCCAAACTCAGTCTTTTAGG - Intergenic
1170673024 20:18452589-18452611 ACTTCTAAGGACAATCTTTAGGG - Intronic
1172368424 20:34367550-34367572 CCTTCCAAACACAGTGCTTCTGG - Intronic
1172921699 20:38488967-38488989 CCTTCCAAACACACTCTAAATGG - Intronic
1174908936 20:54585664-54585686 CATTAAAAGCACAGGCTTTAGGG + Intronic
1175253410 20:57623208-57623230 TCATCCAAGCACAGTCTGGATGG - Intergenic
1177720295 21:24897123-24897145 CATTCCAAGCACAGATTTCAGGG - Intergenic
1178901919 21:36605425-36605447 CCTTCAGAACACAGTTTTTAGGG - Intergenic
1184048472 22:41987314-41987336 TCTTCCCAGCAGAGTCTTTAGGG - Intronic
1184987982 22:48148309-48148331 CCTGCCAAGCACAGGCTTCGGGG + Intergenic
950793905 3:15495178-15495200 CCCTCCAAGCAAAGGCTTCAGGG + Intronic
953199008 3:40760645-40760667 GCTTCCAAACTCATTCTTTAAGG + Intergenic
953491483 3:43356020-43356042 CCTTCCTAGCTCATTCTTTGAGG + Intronic
956082086 3:65568045-65568067 CTTTCAAAGCACAGTCCTAAGGG + Intronic
958546769 3:95564026-95564048 CTTTTCAAACACAATCTTTAAGG - Intergenic
958714739 3:97765592-97765614 ACTTCCAAGCACAGCTTTTAAGG - Intronic
959017262 3:101149060-101149082 CCTTCCACCAACAGTCTTTTAGG + Intergenic
960294361 3:115925082-115925104 CCTTCCAAGTCCACTCTTTGAGG + Intronic
966680963 3:182641932-182641954 CCTACAAAGAACATTCTTTAGGG - Intergenic
967959206 3:194906935-194906957 CCTTCAATGAACAGTCTTAAAGG - Intergenic
970642056 4:18077798-18077820 CCTTCCAATAACATTCATTAAGG + Intergenic
973222889 4:47749429-47749451 CCCTCCAACCAAAGCCTTTAAGG + Intronic
973696971 4:53499704-53499726 CCTGAAAAGCAGAGTCTTTAAGG - Intronic
983274962 4:165605689-165605711 ACTTCCAAGCTCACTCATTAGGG + Intergenic
983275688 4:165614657-165614679 CATTCCATGCAAAGTCTGTAGGG - Intergenic
985309670 4:188583569-188583591 CCTTCCACCCAGAGACTTTAGGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
988364688 5:30281187-30281209 CCTTCTATGCCCAGTTTTTAAGG + Intergenic
988554464 5:32224122-32224144 CATTCCAAGCAGAGTCCTCAGGG + Intergenic
988680867 5:33482487-33482509 CATTGCAAGCACAGTCCTTAAGG + Intergenic
990097153 5:52130973-52130995 CCTTCCATGCTCTGTCTGTACGG - Intergenic
992687724 5:79214665-79214687 ATGTCAAAGCACAGTCTTTAGGG - Intronic
994727488 5:103453807-103453829 CCTTCCTTGAACAGTCATTATGG - Intergenic
995239119 5:109865808-109865830 CCTTTCAAGGACAGGCTTGATGG - Intronic
997069654 5:130606308-130606330 CCTTCCAAGAACATTCTATGTGG - Intergenic
997848259 5:137307785-137307807 CCTTCCAGGCAAAGTCCTCAAGG - Intronic
998747437 5:145277056-145277078 CCCTCAAACCACAGTCTTCAGGG - Intergenic
1001648685 5:173300262-173300284 CCTTCCACACACAGGCCTTATGG + Intergenic
1002960408 6:1909149-1909171 CCTTTCAAACAAAGACTTTACGG + Intronic
1003013503 6:2449027-2449049 CGTTCGAAGCACAGGCGTTAGGG + Intergenic
1007997718 6:46326250-46326272 CCTTCCAAGCTCAGGATTTCAGG + Intronic
1008176383 6:48272462-48272484 TCTTCCAAGCACAACCTTTTTGG - Intergenic
1010603152 6:77855494-77855516 TCTTCCAAGCATACTCATTAAGG - Intronic
1013253376 6:108358031-108358053 TCTTCCAAGTAAAGGCTTTATGG + Intronic
1014623238 6:123695432-123695454 GCTTCCAAACACAATCATTAGGG + Intergenic
1029724964 7:102396655-102396677 CCCTCCAAGAGCAGTCTTTGGGG + Intronic
1029933561 7:104399026-104399048 CTTTCTAAGGACAGGCTTTATGG + Intronic
1031033712 7:116764586-116764608 CCTTCCAAGCACAGTCTTTATGG + Intronic
1031722830 7:125198474-125198496 ATTTACAGGCACAGTCTTTAGGG + Intergenic
1032598680 7:133269878-133269900 TATTCAAGGCACAGTCTTTAAGG - Intronic
1032994998 7:137434935-137434957 CTTTCAAAACACAGTCTATAGGG + Intronic
1033728713 7:144150903-144150925 ACTTCCAAACTCATTCTTTAAGG + Intergenic
1034079345 7:148261958-148261980 CCTTAAAAGCAAAATCTTTAAGG + Intronic
1034328248 7:150257824-150257846 CTCTCCCAGCACATTCTTTATGG - Intronic
1034764968 7:153711640-153711662 CTCTCCCAGCACATTCTTTATGG + Intergenic
1034950529 7:155293822-155293844 CCTTGCAAGAACAGTCCTTTGGG - Intergenic
1035161359 7:156952462-156952484 CTTTTCAAGCAGAGTCTTTGTGG + Exonic
1038424800 8:27458238-27458260 TCCTCCAAGCACAGACTTTGTGG + Intronic
1039188642 8:34946630-34946652 CCTTCCAAGCTCAGCCATTAAGG + Intergenic
1042582610 8:70297627-70297649 CCAGCCAAGGACAGCCTTTATGG + Intronic
1042679762 8:71369944-71369966 AATTCCTAGCACAGTTTTTAAGG - Intergenic
1045427397 8:102080725-102080747 CCTTGCAATCACAGTTTTTATGG - Intronic
1045991116 8:108309629-108309651 CCTTCCAAGCTCATTCTATGAGG + Intronic
1049986105 9:953363-953385 CCATCCAAGGACAGAGTTTAAGG + Intronic
1052214311 9:25946985-25947007 CCTTCTATGCCCAGTTTTTAAGG + Intergenic
1053098669 9:35351147-35351169 CCTCCCAACCCCAGTCTTAAAGG - Intronic
1058010159 9:99968293-99968315 CCCTACAAGTACAGTCTCTAAGG + Intronic
1058811403 9:108643143-108643165 TCTTCCATGCTCAGTCTTCAGGG + Intergenic
1059916440 9:119107751-119107773 CCTTCCAAACTCATTCTATAAGG + Intergenic
1061234421 9:129334332-129334354 CCTTCCAGGCAGAGCCTTCAGGG - Intergenic
1061678691 9:132232047-132232069 CCTTCCAAGCAATGGCTTGAAGG - Intronic
1186717368 X:12266494-12266516 ACTTCCAAGCCCAGACTTCAAGG - Intronic
1187582389 X:20621882-20621904 CCTGCCAAGCATAGTTCTTAAGG - Intergenic
1189604548 X:42662208-42662230 CTTTCCAGGCACAGGCTTTGTGG + Intergenic
1189789128 X:44586643-44586665 ATTTCCAAGCAAAGTATTTAAGG + Intergenic
1193199531 X:78672118-78672140 CCTTCTAAAAACAGTCATTATGG + Intergenic
1194168862 X:90557106-90557128 CCTTCCAAACACAGGCTCTGAGG + Intergenic
1197181121 X:123538650-123538672 CCTGCCAAAGACAGTCTGTAAGG - Intergenic
1200515106 Y:4134891-4134913 CCTTCCAAACACAGGCTCTGAGG + Intergenic