ID: 1031034050

View in Genome Browser
Species Human (GRCh38)
Location 7:116767556-116767578
Sequence AAAGATACTCCCCCTGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031034050_1031034052 25 Left 1031034050 7:116767556-116767578 CCTACTTCAGGGGGAGTATCTTT 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1031034052 7:116767604-116767626 CTAAATTGCTCTATGTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031034050 Original CRISPR AAAGATACTCCCCCTGAAGT AGG (reversed) Intronic
901397623 1:8992888-8992910 AGAGATGCCCTCCCTGAAGTGGG + Intergenic
901652509 1:10751395-10751417 AAAGATCATCCCCCTGAAGATGG - Intronic
902891561 1:19448017-19448039 AAACACACTCCCCCAGGAGTGGG + Intronic
904766485 1:32852658-32852680 ATAGTTACTCCCCCTGGAGGGGG + Intronic
905007189 1:34719243-34719265 AAAGATATTTCCCCTGAAAGAGG - Intronic
908176867 1:61564691-61564713 CAAGATACTATCACTGAAGTAGG + Intergenic
911330745 1:96523124-96523146 AAATATACTCCACAGGAAGTGGG + Intergenic
912228602 1:107765718-107765740 AGAGATACCTTCCCTGAAGTGGG - Intronic
913997115 1:143660691-143660713 AAAGATACTCCCACACAAGGAGG + Intergenic
914505138 1:148282091-148282113 AAAGATACTCCCACACAAGGAGG - Intergenic
914507427 1:148302057-148302079 AAAGATACTCCCACACAAGGAGG + Intergenic
915237284 1:154493273-154493295 AAGGTTACTCCCCTTGAAGAGGG - Intronic
916494792 1:165336679-165336701 CAAGATATTCCCCCTGAGCTGGG - Intronic
918744958 1:188187165-188187187 AAGGATAGTCCCCAGGAAGTGGG + Intergenic
921901016 1:220450912-220450934 TGAGATACTCCCACTGAAATGGG - Intergenic
923449975 1:234107274-234107296 AAGTATACTCCACCTGCAGTGGG + Intronic
923797386 1:237171002-237171024 ATAGATTCTCCCCATGAGGTCGG + Intronic
1063734683 10:8739692-8739714 CAAGTTACTCCCATTGAAGTTGG + Intergenic
1065893137 10:30138043-30138065 AAAGCTACTTCCCATGCAGTGGG - Intergenic
1068109468 10:52662379-52662401 AAAGATTGGCCCCCTGCAGTTGG - Intergenic
1072865168 10:99051701-99051723 AAACACACTCTCCCTGAATTAGG - Intronic
1072967756 10:99989220-99989242 AAACATACTCTGCCTGTAGTGGG - Intronic
1073551688 10:104408100-104408122 AAAGATATTTACCCTAAAGTTGG + Intronic
1073720377 10:106162512-106162534 AAAGATCCTCCCCCCGCAGAGGG + Intergenic
1073950978 10:108808882-108808904 AAACTCACTCCCCCTGGAGTAGG - Intergenic
1076392918 10:130117194-130117216 AGAGATACTTCCCTTGAAGGTGG - Intergenic
1078279849 11:9890531-9890553 AAAGATCCTCCACATGTAGTTGG - Intronic
1078693267 11:13603101-13603123 AAAGATAATCTCACTGAAGGAGG - Intergenic
1079511299 11:21214082-21214104 AAAGATACTCACCCTGTATAAGG - Intronic
1094126699 12:27031212-27031234 AAGGATACTCCCATTGAAATTGG - Intronic
1096440994 12:51644505-51644527 AACGAGACTCCGTCTGAAGTAGG - Intronic
1101210652 12:102532207-102532229 AAAGTTACTCCCCCTTTAGGAGG - Intergenic
1101241480 12:102843737-102843759 AAAGCTTCTCCCCCTGGAGCTGG - Exonic
1114263343 14:21055606-21055628 AAACATGCTTTCCCTGAAGTAGG - Intronic
1115437794 14:33395960-33395982 AAAGATACTCATCCAGAACTAGG - Intronic
1115776774 14:36724216-36724238 AAAAAAATTCCCCCTGAATTAGG + Intronic
1116446105 14:45013860-45013882 AAAGATACTCTTCCAAAAGTGGG - Intronic
1118597720 14:67449021-67449043 ACAGAAGCTCCTCCTGAAGTTGG - Intronic
1121568782 14:94930763-94930785 AAAGTAAGTCCCTCTGAAGTAGG + Intergenic
1124693252 15:31843219-31843241 AGAGAAATTCCCCCAGAAGTTGG - Intronic
1125405054 15:39343491-39343513 AAAGATATTCTACCTGAAATTGG - Intergenic
1131721536 15:95173908-95173930 ACAGATACCCTCCCTGAGGTGGG - Intergenic
1139382104 16:66538994-66539016 AAGAATAGTCCCTCTGAAGTAGG - Intronic
1139601534 16:67990399-67990421 AAAGATGTTCAGCCTGAAGTTGG + Intronic
1141027203 16:80559858-80559880 AAAGCTACTCTCCATGAAGCAGG + Intergenic
1144055431 17:11536606-11536628 TATGATATTCCCTCTGAAGTGGG - Intronic
1151220090 17:72605855-72605877 AAAGAAACCCCCACTGAAGAGGG + Intergenic
1154140909 18:11823317-11823339 AGACATTCTCCCCCTGAAGGGGG - Intronic
1154963102 18:21329498-21329520 AAAGATACTCCTTTTGAACTTGG + Intronic
1155449741 18:25951324-25951346 AAATAAGCACCCCCTGAAGTTGG + Intergenic
1156754124 18:40500055-40500077 GAAGATACTCCCTCTTAGGTGGG - Intergenic
1161944738 19:7428558-7428580 AAAGATAATGGCCCTGAAGGTGG + Intronic
1166535725 19:43573452-43573474 AAATATACTCCCCCTCCAGTGGG + Intronic
927032745 2:19139797-19139819 AAAGACACTATCCCTGAAGCAGG - Intergenic
927254191 2:21025651-21025673 AAAGATCCTCGGCCTCAAGTGGG + Intronic
932557153 2:72834534-72834556 GATGATACTCCACCTGTAGTGGG - Intergenic
934688237 2:96337024-96337046 AAAGATAGTTCTCATGAAGTTGG + Intronic
938092561 2:128442995-128443017 AAAGATCCTCCTCCTGACTTGGG - Intergenic
938629403 2:133149800-133149822 AACAATAGTCCCCCTTAAGTAGG - Intronic
940269696 2:151876064-151876086 ACAGAGACTCTCCCTTAAGTGGG - Intronic
942209986 2:173660486-173660508 ATAGATACTACCTCTGAGGTGGG + Intergenic
942696024 2:178647063-178647085 AAAGAGACTCCCCCTGTTGAAGG - Exonic
944830854 2:203533493-203533515 AAAGGTCCTCCCCCTCAATTCGG + Intronic
945932545 2:215869954-215869976 AAAGAGATTTCTCCTGAAGTTGG + Intergenic
946265968 2:218541696-218541718 TAAGATTCTTCCCCAGAAGTGGG + Intronic
946871190 2:224087332-224087354 AAAAATAATGCCCCAGAAGTAGG - Intergenic
1169831320 20:9828489-9828511 AAAGATTCTTCCTCTAAAGTAGG - Intronic
1170847790 20:19976500-19976522 AAAGAATTTCCCCTTGAAGTTGG - Intronic
1173069147 20:39744684-39744706 CAAGCTACACACCCTGAAGTGGG + Intergenic
1179040966 21:37801915-37801937 AAAGATACTGTCCCTAAAGTGGG + Intronic
950153304 3:10704955-10704977 AAAAATCCTCTCCCTTAAGTAGG + Intronic
951747001 3:25989633-25989655 AAAGATACTCCATCTCTAGTTGG + Intergenic
956505627 3:69936187-69936209 AAAGATAGTCATCCTGCAGTCGG + Intronic
956968498 3:74492349-74492371 AAAGATACGCTCCCTTAAGTAGG - Intronic
957610188 3:82455711-82455733 AGTGATGCTCCCTCTGAAGTTGG - Intergenic
958141068 3:89562924-89562946 GAAGTTACTGCCTCTGAAGTTGG + Intergenic
962008741 3:131373040-131373062 AAAGATACTACACCAGAAGTGGG + Intergenic
962010788 3:131388383-131388405 CAAGATACTACACCAGAAGTGGG + Intronic
963684949 3:148421605-148421627 CAAGAAACTCCCCCTTAAATTGG - Intergenic
965726918 3:171727563-171727585 AAAGATACTCTCCCAGCATTAGG + Intronic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
968801841 4:2748056-2748078 AAACATACTCACTCAGAAGTTGG + Intronic
970606605 4:17687403-17687425 ATAAATAATCTCCCTGAAGTGGG - Intronic
970657152 4:18243870-18243892 AAAGATACTTCACCTGAACTGGG + Intergenic
972219490 4:36937277-36937299 AAAGATACTCCTCGAGAAGAGGG + Intergenic
972283303 4:37623789-37623811 AAAGAAACTGCACCTAAAGTAGG - Intronic
975401187 4:73941645-73941667 AAAGATAAGGCCCCTGATGTGGG + Intergenic
978064861 4:104384327-104384349 AAAGATATTCCACATCAAGTTGG - Intergenic
979846139 4:125514733-125514755 AAATCTACTCCCGCTGAAGATGG - Intergenic
981115165 4:140981185-140981207 AAGGATACTCAACCTGTAGTTGG - Intronic
982604606 4:157498440-157498462 GAAGATATTCCCCCTCAAGTAGG - Intergenic
984513667 4:180711098-180711120 ATAGATAGTTCCCCTGAAGGTGG + Intergenic
993748861 5:91640610-91640632 AAAGACACACACCCTGAAGTGGG + Intergenic
1002106468 5:176881645-176881667 ACAGAAAGACCCCCTGAAGTGGG + Intronic
1003574564 6:7280574-7280596 AAAGACACTCCCCCTCACGCAGG - Intronic
1004158816 6:13195260-13195282 ATAGGTACTCCACCTGAAGATGG - Intronic
1006051064 6:31344808-31344830 ATAGATCCTCACCCTGGAGTGGG + Intronic
1014419180 6:121219627-121219649 TAAGGTACTCCCACTGTAGTGGG + Intronic
1014894934 6:126890358-126890380 AAAGACACTCCTCCTGATTTGGG - Intergenic
1016139356 6:140588356-140588378 ATAGATACACCCCCTCAAGGAGG + Intergenic
1017690093 6:156955775-156955797 GAAGATACTCGCCCTGGACTTGG + Intronic
1021108966 7:16672499-16672521 AAAGATACTGCAACAGAAGTGGG - Intronic
1028434989 7:90792959-90792981 AAAGAAACTCTCTCTGAAATGGG - Intronic
1031034050 7:116767556-116767578 AAAGATACTCCCCCTGAAGTAGG - Intronic
1037770994 8:21799746-21799768 CAAGCTAATCCCCCTGAAGTGGG + Intronic
1039774871 8:40725362-40725384 AAAGATATCCCCCCTGAGGAAGG - Intronic
1043496350 8:80805080-80805102 AAATATCTTACCCCTGAAGTAGG + Intronic
1044730139 8:95222997-95223019 AAAGATGCTAACCCTGAAGTAGG + Intergenic
1044746711 8:95377977-95377999 AAAACTACATCCCCTGAAGTGGG + Intergenic
1047308593 8:123673691-123673713 GTAGATACTCCCCCTCAAGGAGG + Intergenic
1050794194 9:9516446-9516468 AATGATATTCCTCATGAAGTTGG - Intronic
1054852790 9:69865669-69865691 ATAGATACTCCCACAGAAGGAGG - Intronic
1056217606 9:84419739-84419761 AAATATAAGCCCCCTGAGGTTGG + Intergenic
1057134947 9:92680832-92680854 AGACATACTTCCCCTGGAGTGGG - Intergenic
1058718101 9:107739993-107740015 AGACACACTCCTCCTGAAGTTGG - Intergenic
1059087609 9:111320942-111320964 GAAGAAACAACCCCTGAAGTAGG - Intergenic
1059282055 9:113143372-113143394 AAAAATAATCCACATGAAGTAGG + Intergenic