ID: 1031036027

View in Genome Browser
Species Human (GRCh38)
Location 7:116788838-116788860
Sequence GAAAATGCCCAAATGGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031036022_1031036027 16 Left 1031036022 7:116788799-116788821 CCAAAAACTTGCCTGCTTGTAGA 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1031036027 7:116788838-116788860 GAAAATGCCCAAATGGAGTTTGG No data
1031036021_1031036027 23 Left 1031036021 7:116788792-116788814 CCTGCGACCAAAAACTTGCCTGC 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1031036027 7:116788838-116788860 GAAAATGCCCAAATGGAGTTTGG No data
1031036025_1031036027 5 Left 1031036025 7:116788810-116788832 CCTGCTTGTAGATTGGGTTTTCT 0: 1
1: 0
2: 1
3: 10
4: 310
Right 1031036027 7:116788838-116788860 GAAAATGCCCAAATGGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031036027 Original CRISPR GAAAATGCCCAAATGGAGTT TGG Intronic
No off target data available for this crispr