ID: 1031039851

View in Genome Browser
Species Human (GRCh38)
Location 7:116827804-116827826
Sequence GTGGCAGCACAGAAAAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031039851 Original CRISPR GTGGCAGCACAGAAAAATCA GGG (reversed) Intronic
901087331 1:6619314-6619336 GTGGCATCACATTAAACTCATGG + Intronic
901819035 1:11814214-11814236 TTGGCAACAAAGAAAAATAATGG - Intronic
902458955 1:16556783-16556805 ATGGAAGCACAGAAAATTAATGG + Intergenic
902493201 1:16851133-16851155 ATGGAAGCACAGAAAATTAATGG - Intronic
903098460 1:21003937-21003959 ATGGCAGCACAAAAAGATGAAGG + Intronic
904120839 1:28196811-28196833 GTGGTAGAGCAGAAAACTCAAGG + Intergenic
905159007 1:36014898-36014920 GTGAGAGCAGAGAAAAAACATGG - Intronic
907164713 1:52400071-52400093 GAGGCAGCACATCAGAATCATGG - Intronic
907353460 1:53852705-53852727 GAGGCAGGACAAATAAATCAGGG + Intronic
908027478 1:59968344-59968366 GAGGCAAGACAGAAAAAGCAAGG - Intergenic
908077692 1:60538998-60539020 GAGGCAGCAAAAAAAATTCAAGG - Intergenic
916027742 1:160849208-160849230 GTGGGAGCAGAGGAAAAACATGG + Intronic
916519438 1:165550638-165550660 TTGACAGCAAAGAAATATCATGG - Intronic
917251270 1:173063910-173063932 ATGGCAGAATAGAAAAATCCAGG + Intergenic
917414003 1:174789428-174789450 GTAGCAGTATTGAAAAATCAGGG - Intronic
917649937 1:177066370-177066392 GTCACAGCAGAGAATAATCAGGG + Intronic
918730733 1:187992565-187992587 GTGGCAGTAAAGAAAAAGCAAGG + Intergenic
918888897 1:190237672-190237694 TTCGCAGCACACAAATATCATGG + Intronic
918958033 1:191236263-191236285 GTGGCAGCACTCAACCATCAAGG + Intergenic
923324515 1:232869553-232869575 CTGGCCTGACAGAAAAATCAAGG + Intergenic
923822680 1:237463183-237463205 TACGCAGCACAGAAAAATGAGGG - Intronic
924013872 1:239697982-239698004 CTGGCAGCATAGAAAAGTAAGGG + Intronic
924145043 1:241065030-241065052 GTGGCCTCACAGAGAAACCATGG + Intronic
1062815276 10:494996-495018 GTGGATGAACAGAGAAATCATGG + Intronic
1063020452 10:2121715-2121737 ATGACAGAAAAGAAAAATCAGGG - Intergenic
1063327899 10:5123340-5123362 CTGGTAGCACAGAGCAATCAGGG + Intronic
1066018464 10:31272051-31272073 GTGGCAGAACAGAAAGACCATGG + Intergenic
1068460121 10:57319163-57319185 GTAGCAGCACAGAAAAGAGACGG - Intergenic
1070424462 10:76271961-76271983 GTGACTGCACACATAAATCAGGG - Intronic
1072118100 10:92382830-92382852 GTGGCTCCACAGAAAGATTAAGG - Intergenic
1072460922 10:95617798-95617820 GTGGTAGCAAAGAAATTTCACGG + Intronic
1073144570 10:101272190-101272212 GTGGCAGCAAAGAAAAGCAAAGG + Intergenic
1073656729 10:105424815-105424837 GTGGAAGCAAAAAACAATCAAGG + Intergenic
1073689860 10:105796448-105796470 GTGTTAGCACAGAAACACCAAGG + Intergenic
1073898812 10:108194985-108195007 GTGACATCACAGGGAAATCAAGG + Intergenic
1074868817 10:117561357-117561379 GTCGCAGCACAGATTAACCATGG + Intergenic
1076140814 10:128077496-128077518 TTGGCAGCACAGAAGGCTCAGGG + Intronic
1076490336 10:130857091-130857113 GTGGAAGAACAGAAACATGAAGG - Intergenic
1077847528 11:6041649-6041671 GAGGCACCACAGAAAAACCTAGG + Intergenic
1079259065 11:18860311-18860333 ATGGCAGCACAGCAAAATAGAGG + Intergenic
1080142173 11:28934948-28934970 GAGGTAGCACAGAATAATTAGGG + Intergenic
1080153509 11:29079648-29079670 GTGGCAGAAAGGAAAAATGAGGG - Intergenic
1080170179 11:29291956-29291978 GTGGCAAAAAAGGAAAATCATGG + Intergenic
1082185274 11:49172435-49172457 GTGGCAGCATAAGAGAATCAGGG - Intronic
1083569752 11:63752669-63752691 GTGGTAAAACAGAAAAAGCAGGG + Intronic
1084913206 11:72408059-72408081 GAGGCAGCACCGAAATATAAAGG + Intronic
1085369118 11:75981801-75981823 ATGGCAGCACAGAGGAAGCAGGG - Intronic
1085765454 11:79278024-79278046 GAGGCAGCATAGCAAAAACAAGG + Intronic
1086652174 11:89305513-89305535 GTAGCATCAAGGAAAAATCAAGG + Intergenic
1086963913 11:93008223-93008245 GTGGGGACACAGAAAAATTATGG - Intergenic
1088560915 11:111115511-111115533 ATGGTAGCACAGAAAACTGAGGG + Intergenic
1089424857 11:118364173-118364195 GTGGCACAACAGAATAAACAGGG - Intronic
1090633735 11:128674453-128674475 GAGGCAGCACAAAAGAATCTGGG + Intergenic
1092759160 12:11793690-11793712 GAGGCAGGAAAGAAAGATCAAGG + Intronic
1093288156 12:17291587-17291609 GTGGAAACACAGAGTAATCATGG - Intergenic
1094109770 12:26849356-26849378 GTGGCAGCTCAAGAAATTCAGGG - Intergenic
1095048342 12:37534513-37534535 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1097340541 12:58432575-58432597 TTGTCAGCTCAGAAAAATGATGG + Intergenic
1098100250 12:67007709-67007731 CTGCCACCACAGGAAAATCATGG + Intergenic
1099837733 12:87928792-87928814 ATCGAATCACAGAAAAATCATGG + Intergenic
1100892170 12:99137745-99137767 ATGGAAGCACAGAAAAAGCATGG - Intronic
1101849958 12:108393958-108393980 GTGGGAGCACAGAGAGGTCAAGG - Intergenic
1102987868 12:117293229-117293251 GTGGCAGCACAGGGAACACACGG + Intronic
1105398806 13:20069275-20069297 GTGGCAGGAGAGAAAAATGGGGG - Intronic
1106716957 13:32400293-32400315 TTTACAGAACAGAAAAATCATGG - Intergenic
1107274284 13:38659380-38659402 ATGGCAGCACAGATGAAACATGG - Intergenic
1111356305 13:87107815-87107837 ATGGCAGGACAGAAAAATGGTGG + Intergenic
1111500151 13:89108176-89108198 GTGGGAGCCAAGAAAAATGATGG - Intergenic
1111663420 13:91238896-91238918 GTGCCTGCACAGGAAAATAAGGG + Intergenic
1111920528 13:94405554-94405576 GTGAAAGCACAGGAAAAACAAGG - Exonic
1115707868 14:36016552-36016574 GTGGCATAATAGAAAAAACAGGG + Intergenic
1115863207 14:37712641-37712663 GTGGCAGCAAGGAGAAATGATGG + Intronic
1116126701 14:40797484-40797506 GTGGCAGCACGGAGAAATGCAGG + Intergenic
1117929016 14:60819686-60819708 GTGGCAGCACTACAAAGTCATGG + Intronic
1118780683 14:69005761-69005783 CTGGCAGCACACCAGAATCAGGG - Intergenic
1118830378 14:69426033-69426055 GTGAGAGCACAGGAAAAACACGG - Intronic
1122650915 14:103226671-103226693 GTGGCCGCACAGGACATTCAGGG - Intergenic
1123754449 15:23386029-23386051 GTGAAACCACAGAAACATCACGG - Intergenic
1124872014 15:33552813-33552835 ATGGAAGCCCAGGAAAATCAGGG - Intronic
1128626746 15:69215193-69215215 GTGGCAGCACAAAAAAATTGGGG - Intronic
1129959070 15:79667000-79667022 CTAGCAGCAATGAAAAATCAAGG + Intergenic
1130412416 15:83657996-83658018 GTGGCAGCACATACGAAGCAAGG - Intronic
1131089952 15:89616469-89616491 GCTGCTGCACAGACAAATCAAGG + Exonic
1132192915 15:99884283-99884305 GTGACAGCGCAGAAAGTTCAAGG + Intergenic
1134074031 16:11278054-11278076 GAGGCAGCATAGAAACACCAAGG - Intronic
1134275423 16:12771713-12771735 GTGGAACCACAGAAAAACAAAGG + Intronic
1134461919 16:14436964-14436986 GTGAAACCACAGAAACATCATGG + Intronic
1134649069 16:15893946-15893968 GTGTGAGCAGAGAAAAAACACGG + Intergenic
1136074689 16:27808847-27808869 GTGGCAGCAGAGGAGAAGCATGG + Intronic
1137061318 16:35793729-35793751 GTGAAAGCAAAGAGAAATCAAGG + Intergenic
1137415724 16:48276966-48276988 GGGGATGCTCAGAAAAATCATGG + Intronic
1137493048 16:48949083-48949105 GTGGCATCACACAAGAATCCTGG - Intergenic
1138051276 16:53781271-53781293 GTGGCATAACAGAAAGAACATGG - Intronic
1139457022 16:67088632-67088654 GAGGCAGAAAAGAAAAATAATGG + Intronic
1140580812 16:76228776-76228798 TTGGCAGAACAGGAAAAGCAAGG + Intergenic
1141753317 16:85974390-85974412 CTGGCATCAGAGAAAACTCAGGG - Intergenic
1141903209 16:87006271-87006293 GTGACTTCACAGAAAAACCACGG - Intergenic
1143787495 17:9266796-9266818 GTGGGAGAAAAGAAAAATAAGGG + Intronic
1144584452 17:16479661-16479683 CTGGCAGCCCAGGAAAACCAAGG - Intronic
1145298870 17:21615573-21615595 GTGGCAGAAAAAAAAAATGAAGG - Intergenic
1145404180 17:22571139-22571161 GTGGCAGAAAAGAAAGACCATGG + Intergenic
1145411608 17:22670693-22670715 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1146465695 17:33084458-33084480 GTGGCAGAGCAGAAAGAGCATGG + Intronic
1151474979 17:74340196-74340218 GGGGCAGCAAAGGAGAATCAGGG - Intronic
1153417897 18:4869850-4869872 GTGGCACAACATAAAAATTATGG + Intergenic
1155694514 18:28669540-28669562 GAGTCTGCAAAGAAAAATCAAGG + Intergenic
1156947448 18:42851990-42852012 CTGGAAGCAGACAAAAATCAGGG - Intronic
1157165568 18:45355601-45355623 CTGGCAGCTAAAAAAAATCAGGG - Intronic
1157381825 18:47225606-47225628 GAGTCAACACAGAAAACTCATGG + Intronic
1158029120 18:52941032-52941054 TTTTCAGCACAGAAAAATGATGG + Intronic
1164956898 19:32394031-32394053 GTGGCAGAACAGAGAAAGAAGGG - Intergenic
1166137696 19:40787227-40787249 GTGACAGCTCAGAAAGGTCAGGG + Intronic
1166590352 19:43992305-43992327 TTGGCAGGACAGAAACAGCAGGG - Intronic
1167215156 19:48159635-48159657 GTGGCAGGAGAGGAAAGTCAGGG + Intronic
928081089 2:28313024-28313046 GGAGCAGCACAGAATCATCAAGG + Intronic
929668088 2:43849368-43849390 GTGGCAGGAGAGAAGAATGAGGG + Intronic
931614976 2:64146208-64146230 GTGGCAGAAGAGAAAACTGAGGG + Intergenic
931848596 2:66230484-66230506 GTGGCAGGAGAGAAAAAGTAGGG + Intergenic
931985096 2:67733768-67733790 GTGGCAGCTGAAACAAATCAGGG + Intergenic
933553786 2:83807526-83807548 GTGGGAGCAGAGGAAAAACATGG - Intergenic
933643244 2:84786742-84786764 GTGGCATAACTGAAAAATCATGG + Intronic
935193097 2:100793947-100793969 GAGGCAGCACAGAACAATTTTGG - Intergenic
937244671 2:120485032-120485054 GGGGCATCACAGAAAGAGCAAGG - Intergenic
937832102 2:126435254-126435276 ATGGCATCACATAAAACTCACGG + Intergenic
937864141 2:126735522-126735544 GGGGCAGCACAGCACAGTCATGG - Intergenic
939125890 2:138176995-138177017 GGGGCAGCACACAGAAAGCATGG + Intergenic
939675211 2:145063628-145063650 GCAGTAGCACAGAAAAATGATGG + Intergenic
939911997 2:147994482-147994504 GTGAAAGAACAGACAAATCAAGG + Intronic
943387270 2:187217429-187217451 GGGGCAGCACACAGAACTCAGGG - Intergenic
947387324 2:229604515-229604537 GTGCAAGAGCAGAAAAATCAGGG + Intronic
947987004 2:234456818-234456840 GTGGCAGCCCTGAAAAAAAAAGG + Intergenic
948134565 2:235627155-235627177 GGGCCAGCACAGGAAAAGCAGGG - Intronic
948652140 2:239454638-239454660 CTGGTAGCACAGAAAAATCTTGG - Intergenic
1169020320 20:2326263-2326285 TTCCCAGCACAGAAAATTCATGG + Intronic
1170441026 20:16378858-16378880 GTGGCAGCAGAGAGCAGTCAGGG - Exonic
1170510885 20:17075632-17075654 GGGGCAGCAGAGAAAAAGAATGG - Intergenic
1170511006 20:17076663-17076685 GGGGCAGCAGAGAAAAAGAATGG - Intergenic
1171542880 20:25977990-25978012 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1172159090 20:32852919-32852941 GTGCCAGACCAGAAAAATGACGG - Intergenic
1172532898 20:35645884-35645906 GTGGGATCACAGAAAAATCAAGG + Intronic
1179013938 21:37578386-37578408 GAGCCAGAACACAAAAATCACGG + Intergenic
1180935029 22:19619814-19619836 GGGGAAGCACAGAAAAATCTTGG - Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1182804541 22:33058708-33058730 GTGGCACCTCAGAGAAACCAGGG + Intergenic
950478973 3:13233058-13233080 GTGGCTGCACAGCAAAGTGAAGG + Intergenic
950595642 3:13978890-13978912 GTAGCAGCAGGGAAAAATAATGG - Intronic
950886258 3:16365631-16365653 GTGGCAGCAGAGAGACATCTGGG + Intronic
954086506 3:48248386-48248408 AAGGCATCACAGAAAATTCATGG - Intronic
955362214 3:58285284-58285306 GTGGCACCACCGCAGAATCAAGG - Intronic
956173119 3:66448644-66448666 GATGCATCACAGAAAAGTCAGGG - Intronic
956303823 3:67802751-67802773 CTGGCAGGACATAAAATTCATGG + Intergenic
957714199 3:83903929-83903951 GTACCAAAACAGAAAAATCAAGG - Intergenic
958887339 3:99740767-99740789 ATAGCAGAACAGAAAAATCTTGG - Intronic
960057229 3:113284312-113284334 CTGGAAGGACAGAAAAATAAAGG - Intronic
960088480 3:113615253-113615275 GTGGCATCCCAGAAAAGGCATGG - Intronic
960589884 3:119355120-119355142 GTGGTATCACAGAAAAAGCATGG + Intronic
960728478 3:120696868-120696890 GTGGCAGCTGAGAAAAATGAGGG + Intronic
960965807 3:123104033-123104055 GTGGTAGCAGAGAAGAAGCAAGG + Intronic
961783637 3:129336453-129336475 GCGGCAGCACAGAGGAAGCAGGG - Intergenic
962500209 3:135983614-135983636 GTGGAAGAACACAAATATCAGGG - Intronic
967016402 3:185486103-185486125 GTGGCAACAGAGAAACATGAGGG + Exonic
967663481 3:192142997-192143019 GTGGCAGGAAAGAAAGAACAGGG - Exonic
971454675 4:26833233-26833255 ACGGCACAACAGAAAAATCAAGG + Intergenic
971534308 4:27729279-27729301 GTGGAAGGACAGAAAACACATGG + Intergenic
976085329 4:81402044-81402066 GGGCAAGCACAGATAAATCAGGG + Intergenic
976448261 4:85156678-85156700 TTGGCAGCACAGTAGAGTCATGG + Intergenic
976657066 4:87499779-87499801 ATGGCCGGACCGAAAAATCAGGG - Intronic
976883429 4:89958388-89958410 GTGGCAGCAAACATAAATGAGGG - Intergenic
978298965 4:107243396-107243418 GTGCCAGCAGAGATAAATCAGGG + Intronic
980121813 4:128735322-128735344 GGGGCAGCTCACAAAACTCAGGG + Intergenic
980198865 4:129627551-129627573 GAAGCAGCTCATAAAAATCAAGG + Intergenic
983239939 4:165221041-165221063 TAGGCAGCACAGAAAGATTAAGG - Intronic
987191274 5:15480849-15480871 GTGGGAACAAATAAAAATCAGGG + Intergenic
987257715 5:16173606-16173628 GTGGGATCCCAGAAAAAGCAGGG + Intronic
987572627 5:19685102-19685124 GTGGAACCAAAGAGAAATCAAGG + Intronic
988233372 5:28507689-28507711 GTGGAAGCAAAAAGAAATCAAGG + Intergenic
988614426 5:32760886-32760908 GTGGCAGAACAGAAAAAGATGGG - Intronic
989410982 5:41120273-41120295 GTGCCAGCACAGAAAAGACATGG - Intergenic
989435482 5:41408345-41408367 GTGGAAGCACAGGAAACTCAGGG - Intronic
990714702 5:58623902-58623924 ATGGAAGCACAGAGAAGTCAGGG - Intronic
992334958 5:75757290-75757312 GTCACAGCACAGAAAAAAAAGGG + Intergenic
992743677 5:79798294-79798316 GTGGGAGCACAGCAACACCAGGG - Intronic
992882016 5:81119688-81119710 GTGGCAGCACTGATCATTCATGG + Intronic
993330677 5:86596363-86596385 ATAGCAGCACAGAAAAACAATGG + Intergenic
996658552 5:125970897-125970919 GTGGAGTCACAGACAAATCAGGG + Intergenic
996785456 5:127232022-127232044 GTGGCAGCAGAAAACAATGAAGG + Intergenic
997265743 5:132494368-132494390 TTGCCAGCACAGAAAAATCCAGG - Intergenic
998146997 5:139734641-139734663 GGGGCAGCAGAGAGAAGTCAGGG + Intergenic
999866238 5:155703294-155703316 GTGGCAGGACATAGAAAGCATGG - Intergenic
999959612 5:156740524-156740546 GTGGCAACACAGAAGTATAATGG + Intronic
1001785949 5:174413324-174413346 TTGCCAGCATTGAAAAATCAGGG + Intergenic
1002626390 5:180532504-180532526 GTGAGAGCAAAGAAAAAACATGG - Intronic
1002639275 5:180623038-180623060 GTAGCTGCCCAGAAAAGTCAAGG + Intronic
1003389981 6:5705523-5705545 CTGGCTGCACAGCAAATTCAGGG - Intronic
1004950665 6:20667622-20667644 GTGGCAGAAGAGAAAAAATAAGG - Intronic
1005850081 6:29814511-29814533 GTGGGAACCCAGAAAAAGCACGG + Intergenic
1006483562 6:34319100-34319122 GTGAGAGCACAGAAAAAACATGG - Intronic
1007127895 6:39442664-39442686 GTGGCAGCACTGAAAAAGCCTGG + Intronic
1008856703 6:56096777-56096799 GTGGCAGCCAAGAAAATTAATGG - Intronic
1008860074 6:56138502-56138524 GTGGCAGCAAGGAGAAATCTAGG + Intronic
1009302921 6:62050076-62050098 GTGGCAGCACATATACACCATGG + Intronic
1013253715 6:108361254-108361276 CTGGCATCCCAGAAAAATCCTGG + Intronic
1013711276 6:112902534-112902556 CTGGCAACCCAGAAACATCAGGG + Intergenic
1016271317 6:142293657-142293679 GTGGCAGGAGAGAAAAAGTATGG + Intergenic
1016642061 6:146360637-146360659 GAGGCAGAAGAGAAAAACCAGGG - Intronic
1017550794 6:155505059-155505081 GTGGCAGAAGACAGAAATCATGG + Intergenic
1018318379 6:162580745-162580767 GTGGAAGCACACAAACAGCAAGG + Intronic
1019062937 6:169269788-169269810 GGGACAGCACAGATAAAACAGGG - Intergenic
1019995997 7:4724946-4724968 GTGGCCACACAGAAAAATAGTGG + Intronic
1022628186 7:32059771-32059793 GTGGCACCAAGGAAAAAACAGGG + Intronic
1022802042 7:33786102-33786124 GTGGCACCACAGAGGAATGAGGG + Intergenic
1023712437 7:43009280-43009302 GTGGGAGGACAGAAGCATCATGG + Intergenic
1024367677 7:48540119-48540141 ATGACTGCAGAGAAAAATCAAGG - Intronic
1025811223 7:64876894-64876916 ATGAAAGCAAAGAAAAATCAAGG - Intronic
1029643849 7:101839003-101839025 GTGGCAACACAGCAAAAACGAGG - Intronic
1031039851 7:116827804-116827826 GTGGCAGCACAGAAAAATCAGGG - Intronic
1032704307 7:134408866-134408888 CTGGAAGCAAAAAAAAATCAGGG + Intergenic
1032740801 7:134736919-134736941 AAGGTAGCACAGAAAAATAAAGG - Intergenic
1033547502 7:142414796-142414818 GTAGGAGCACAGAGACATCAGGG + Intergenic
1033901894 7:146153056-146153078 GTTGCATCATAGTAAAATCAAGG + Intronic
1034076982 7:148241527-148241549 GTGGGAGCACAGAAAAGTAGGGG + Intronic
1034500115 7:151444931-151444953 GTGACAGCACAGAAGAAGCAAGG + Intergenic
1034576781 7:152006613-152006635 GGGGCTGCAGAGAAAAATAATGG - Intronic
1036412591 8:8516438-8516460 GTCCCAGCACAGAATATTCAAGG - Intergenic
1036610938 8:10349450-10349472 GTGGCCTCACAGAAGAGTCAGGG - Intronic
1036764795 8:11542655-11542677 GTGGCCTCACAGTAATATCAGGG - Intronic
1037576062 8:20204097-20204119 GTGGGAGCACAGCAGAAACAGGG - Intronic
1040733711 8:50481037-50481059 GTGGCAGCACCCACAAAACAAGG + Intronic
1043222859 8:77688464-77688486 GTCATAGCACAGAAAAATTATGG - Intergenic
1044075236 8:87813131-87813153 TTGGCAGCAAGGAAAAATCATGG + Intergenic
1044906621 8:97010946-97010968 TTCTCTGCACAGAAAAATCATGG - Intronic
1045651444 8:104345173-104345195 GTGGCAGCAAAGAAACAACAAGG + Intronic
1046313516 8:112469955-112469977 GTGGCAACAGAAAAAAATTATGG + Intronic
1047132942 8:122042129-122042151 AAGGCACCAGAGAAAAATCAAGG - Intergenic
1047830763 8:128627450-128627472 GTGGCACCAGAGAATAAGCATGG + Intergenic
1048638776 8:136329257-136329279 ATTGCAGCACAGAAAATTCAGGG - Intergenic
1049209661 8:141379814-141379836 CTGGCAGCACATCAGAATCATGG - Intergenic
1050416660 9:5425575-5425597 GTAGCATCACAGAAAAAGAAGGG + Intronic
1051760012 9:20452368-20452390 GTGGCAGGAGAGAAAAATGCAGG - Intronic
1052500703 9:29285918-29285940 GTGGCAGAGCAGATAAAACAGGG - Intergenic
1053228845 9:36387517-36387539 TTGACAGCAAAGAAACATCAGGG + Intronic
1058368028 9:104233539-104233561 CTGGCATCACAGTAAAACCAAGG + Intergenic
1058955496 9:109943121-109943143 TTGGTAGCCCATAAAAATCATGG - Exonic
1062102217 9:134734211-134734233 GTGGCCCCACAGGAACATCATGG + Intronic
1062604632 9:137341008-137341030 GTGGCATCACGTAAAACTCAAGG + Intronic
1185644273 X:1606047-1606069 GTGGCAGAACAGAAAACGAATGG + Intergenic
1186607732 X:11109609-11109631 GTGGGAGAACAGAGAACTCAGGG + Intergenic
1186636917 X:11416139-11416161 GCGGCAGCACAGAAATATCATGG + Intronic
1186637096 X:11418201-11418223 GTGGGTGCACAGAAGACTCAAGG + Intronic
1187364692 X:18656774-18656796 GAGGCAGGGCAGAAAAGTCACGG + Intronic
1187815758 X:23229988-23230010 TTGGCAGCACAGATTCATCAGGG - Intergenic
1189739287 X:44101828-44101850 ATGGCACTACAGAGAAATCAAGG + Intergenic
1189918699 X:45882380-45882402 TTGGGAGCAAAGAAAAATAAAGG + Intergenic
1190409920 X:50126285-50126307 GGGCCAGCATAGAAAAATGAGGG - Intergenic
1193910971 X:87306159-87306181 GTGGCAGTAGAGAGAAATAAAGG - Intergenic
1197554492 X:127937335-127937357 GTGGCAGCACTTAACCATCAAGG - Intergenic
1198294039 X:135267628-135267650 GTCCCAGCAAAGAAAAATCCAGG + Intronic
1198576720 X:138018361-138018383 GTTGTAGCACAGAAAAAAGAAGG + Intergenic
1198715403 X:139553067-139553089 GTGGCAGAACATCACAATCAAGG + Intronic
1198768845 X:140106877-140106899 GTGGCATCCCAGAAAAATACTGG - Intergenic
1199881584 X:151977555-151977577 GTGGCAGAACAGAATAATGAAGG + Intergenic
1200699910 Y:6393246-6393268 ATGAAAGCAAAGAAAAATCAAGG + Intergenic
1200910708 Y:8529162-8529184 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1200913096 Y:8548268-8548290 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1200917022 Y:8580274-8580296 ATGAAAGCAAAGAAAAATCATGG - Intergenic
1200917622 Y:8585260-8585282 GTGAAAGCAAAGAAAAATAAAGG - Intergenic
1200924754 Y:8644478-8644500 ATGGTAGAAAAGAAAAATCAAGG - Intergenic
1200930454 Y:8692172-8692194 TTGAAAGCAAAGAAAAATCAAGG + Intergenic
1200934625 Y:8727455-8727477 ATGAAAGCAAAGAAAAATCAAGG + Intergenic
1200935326 Y:8733333-8733355 ATGAAAGCAAAGAAAAATCAAGG + Intergenic
1200938805 Y:8761498-8761520 ATGAAAGCAAAGAAAAATCAAGG + Intergenic
1200961863 Y:9003282-9003304 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1200963281 Y:9014184-9014206 TTGAAAGCAAAGAAAAATCAAGG + Intergenic
1200980752 Y:9261345-9261367 TTGAAAGCAAAGAAAAATCAAGG - Intergenic
1200982028 Y:9271224-9271246 ATGAAAGCAAAGAAAAATCAAGG + Intergenic
1201034201 Y:9771452-9771474 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1202129689 Y:21598407-21598429 TTGAAAGCAAAGAAAAATCAAGG + Intergenic
1202149216 Y:21829587-21829609 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1202149815 Y:21834602-21834624 TTGAAAGCAAAGAAAAATCAAGG - Intergenic