ID: 1031043100

View in Genome Browser
Species Human (GRCh38)
Location 7:116859464-116859486
Sequence CCACATGTATTGTATCACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031043100 Original CRISPR CCACATGTATTGTATCACTA AGG Intronic
907325831 1:53638172-53638194 CCACATATATTGCATCTCTCAGG - Intronic
911552482 1:99300735-99300757 CAGCATTTATTTTATCACTAAGG + Intronic
912311441 1:108625216-108625238 CCTGAAGTTTTGTATCACTAAGG + Intronic
915484604 1:156211523-156211545 CAACAAGTGTTGTCTCACTATGG + Exonic
923080426 1:230648157-230648179 GCACATGCATTTTATCAGTAGGG + Intronic
1064531568 10:16315622-16315644 ACACATGTATTCTCTCTCTAAGG + Intergenic
1071161278 10:82748315-82748337 CAACATGTATGTTATGACTAGGG + Intronic
1073127263 10:101159158-101159180 TCACATGCCTTGCATCACTAGGG + Intergenic
1079198458 11:18353262-18353284 AAACATGTATTTTATCACTGCGG + Intronic
1079217349 11:18525686-18525708 CCATATGTCTTCTATAACTAAGG + Intronic
1081009776 11:37796037-37796059 ACACATGAATGCTATCACTAAGG - Intergenic
1082033871 11:47627996-47628018 CCACATTTATAGTATATCTAAGG + Intronic
1082633177 11:55564147-55564169 CCACATGTCATGTTTCTCTAGGG - Intergenic
1089369616 11:117946088-117946110 TTACATTTATTGTAACACTATGG - Intergenic
1093609998 12:21143707-21143729 CCACATTTATTTTAGCAATATGG - Intronic
1095310043 12:40687964-40687986 TCACATCTATTGTTTCACAATGG - Intergenic
1097426862 12:59456592-59456614 CCACATGTTTTGTATTATAAAGG + Intergenic
1099569644 12:84300236-84300258 CCACAGGCACTGTATCACCATGG + Intergenic
1103099504 12:118160421-118160443 GCACTTGTATTATATCATTATGG - Intronic
1108404872 13:50090732-50090754 GCACATGTATTCTATAATTAGGG - Intronic
1112954374 13:105040718-105040740 CAGCATGTATTGTATCAAAAAGG + Intergenic
1114414326 14:22530132-22530154 CTACATCTATTGTACCACTATGG + Intergenic
1117731570 14:58727623-58727645 CCACATGTATTAAATCTCTGAGG + Intergenic
1128102897 15:65019022-65019044 CCAAATGAATTATTTCACTATGG - Intronic
1133155209 16:3869558-3869580 CCACATGTAGTTAGTCACTACGG - Intronic
1138737867 16:59272829-59272851 ACACATGTATTTTCTCAGTAAGG - Intergenic
1143210490 17:5183523-5183545 CCACATTTATTGCATAAATATGG + Exonic
1144344118 17:14334587-14334609 GCTCATCTATTGTATCACTTTGG - Intronic
1146094031 17:29910664-29910686 CCAGATGAATTTTATCATTAAGG + Intronic
1149528598 17:57377377-57377399 CCTCATGTGTTGCATCACTGTGG + Intronic
1158190035 18:54816921-54816943 ACAAATGTTTTGTATCATTATGG + Intronic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
1167759835 19:51439132-51439154 CCAAATGTATCATATCACTAGGG - Intergenic
935650644 2:105378990-105379012 CCACATCTCTTGTATCACTGTGG + Intronic
936869378 2:117116187-117116209 CCACACTATTTGTATCACTAAGG + Intergenic
938612836 2:132966772-132966794 ACACATGTATTTTATCTGTAGGG + Intronic
940148285 2:150571568-150571590 CAACTTGTATTGAATTACTAAGG + Intergenic
942644940 2:178100035-178100057 CCACTTGTATTATATACCTAGGG + Intronic
944652284 2:201843101-201843123 CCACATGACTTGTATTCCTAAGG + Intronic
945930398 2:215849153-215849175 CCACATGTCCTGTAACACTGAGG - Intergenic
1170256456 20:14349510-14349532 CCATATATATTGTATCTATATGG + Intronic
1176954342 21:15083650-15083672 CCACATTTAATCTTTCACTAAGG + Intergenic
1177404860 21:20652690-20652712 CTACATGTATTGCATGAATAAGG - Intergenic
1177668946 21:24200327-24200349 TCACATTTATTGTATTGCTAGGG - Intergenic
1177932130 21:27298229-27298251 CCACATCTCTGGTATCAGTAGGG - Intergenic
1178685302 21:34705893-34705915 CCACTGGCATTGTATCACTTTGG + Intronic
949644182 3:6074187-6074209 GCACATTTATTGAATCACTTTGG + Intergenic
949719501 3:6972444-6972466 TCACATGATTTGTATCATTATGG - Intronic
951385921 3:22042449-22042471 CCATATGTTTTGTAACACAAAGG - Intronic
951532902 3:23714341-23714363 CCACATGCACTGCAGCACTAAGG + Intergenic
952844766 3:37678764-37678786 CCACATATGCTGAATCACTAAGG - Intronic
956893390 3:73635295-73635317 CAACATGTATTGTGACACAATGG + Intergenic
957454005 3:80417631-80417653 CCACGTGTATTATTTCATTATGG + Intergenic
961848217 3:129787118-129787140 CCATATGTTTTATATCACAAAGG + Intronic
963417101 3:145010708-145010730 CCACCTGTATTTTCTCTCTAAGG - Intergenic
964816894 3:160727388-160727410 CCACAGGTTTTATTTCACTAAGG - Intergenic
965088917 3:164137744-164137766 CCACATGTATTATACCACAAAGG + Intergenic
967023456 3:185543303-185543325 ACACATGTATTTTCTCTCTAAGG - Intronic
967056641 3:185834980-185835002 TCCCATGTATTGTATCACTGTGG + Intergenic
967346578 3:188463462-188463484 CCAAATATATTGTAGCACTATGG - Intronic
967552118 3:190808775-190808797 CAAAATGTATATTATCACTAAGG - Intergenic
971854853 4:32030108-32030130 CCCTATGGATGGTATCACTAGGG - Intergenic
975941606 4:79654356-79654378 GCACATGTATATTATTACTAAGG + Intergenic
976617606 4:87094200-87094222 CAAAATGAATTGTATCACAAAGG - Intronic
977250212 4:94681014-94681036 GCAGAAGTATTGTATCACTGTGG + Intergenic
982966569 4:161915903-161915925 CCACATGTATTTTTTAAATAAGG - Intronic
983684838 4:170396262-170396284 CCACATGTATTTTATGCCTTGGG - Intergenic
988136736 5:27181939-27181961 CAACAAAAATTGTATCACTATGG + Intergenic
992754013 5:79887333-79887355 CCACCTGTATTCCATCAGTATGG + Intergenic
993868258 5:93220042-93220064 ACATATGTATTGTCTCATTAGGG + Intergenic
995915922 5:117244637-117244659 CCACATGTATTTTCCCCCTAAGG - Intergenic
996209630 5:120791440-120791462 GCTCAGGTATTGTATCAGTAAGG + Intergenic
996387188 5:122921761-122921783 CCACATATGTTATATTACTAAGG + Intronic
997647313 5:135490001-135490023 CCACATGCATTTTTTCACTTTGG + Intergenic
998790425 5:145760620-145760642 CCACTTGAATTCTATCACTACGG + Intronic
1001770498 5:174292518-174292540 CCACTTGTATTGTTTCCCTGGGG + Intergenic
1004427566 6:15516736-15516758 CCACATCTATTCCAGCACTAGGG + Intronic
1008214095 6:48763938-48763960 CCACAAGTCTGGTAACACTATGG + Intergenic
1009178785 6:60491453-60491475 CCACATCTATTCAAACACTATGG - Intergenic
1014175359 6:118325863-118325885 CCACATCCAGTGTACCACTAAGG + Intergenic
1016100951 6:140099392-140099414 CCATATGTATAGTAACAATATGG + Intergenic
1016931940 6:149420156-149420178 ACACATGTATTTTCTCGCTAAGG - Intergenic
1017418490 6:154247152-154247174 CAACATCTATTGCATAACTACGG - Intronic
1020852177 7:13368273-13368295 CCACATGTACTGGATCTCTTTGG + Intergenic
1021811851 7:24409918-24409940 CCACATGTTTGGCATCACTTGGG - Intergenic
1023013782 7:35945351-35945373 CCACATATATTTTATAATTAGGG - Intergenic
1025931628 7:65999514-65999536 CCCCATGTATTGTTTTGCTATGG - Intergenic
1030162630 7:106524641-106524663 TCACATGTAATGTATTACAAAGG + Intergenic
1031043100 7:116859464-116859486 CCACATGTATTGTATCACTAAGG + Intronic
1033493942 7:141874980-141875002 CTTCATCTATTGTATCACTACGG + Intergenic
1037316015 8:17600171-17600193 CCACATGCATTTTTTCACCAAGG + Intronic
1038278854 8:26144447-26144469 ACACATGTATTTTCTCAATAAGG + Intergenic
1038709041 8:29923630-29923652 CCACACATATTGTATTAATATGG - Intergenic
1041568632 8:59310205-59310227 CCACATGTTCTCTATCAATATGG + Intergenic
1050272196 9:3958227-3958249 CCACATGTATAATAACAATAAGG + Intronic
1050786007 9:9402562-9402584 CCTCATGTGTTTTATAACTATGG - Intronic
1051225942 9:14899232-14899254 CCACATGTGGTGTCTCACTGTGG - Intronic
1051711876 9:19939684-19939706 CCACAGCTATACTATCACTAGGG + Intergenic
1058167092 9:101632360-101632382 CCACATGAATGAGATCACTATGG - Intronic
1059462150 9:114438794-114438816 GCATATGTATTTTATCACTTTGG - Intronic
1062116792 9:134813962-134813984 CCACATGCACTGTCTCCCTAGGG + Exonic
1186073298 X:5847188-5847210 ACACATGTATTATAGCACTGGGG + Intronic
1186699366 X:12072948-12072970 CAACATGTACTGTATCACTTAGG + Intergenic
1188529409 X:31122680-31122702 CCACATGTATTGTATGCATTTGG + Intronic
1193845256 X:86462131-86462153 GCACATGTTTTTTATCATTAAGG - Intronic
1194102823 X:89728039-89728061 CCTCATGTATTATGACACTATGG + Intergenic
1194309599 X:92288150-92288172 CTGCATTTAATGTATCACTATGG + Intronic
1194872855 X:99154324-99154346 CCTTATGTAGTGTCTCACTAAGG - Intergenic
1197435728 X:126425729-126425751 CCACAAGGATTGTAACACCAAGG - Intergenic
1199139373 X:144291459-144291481 ATACATATATTGTATAACTAAGG + Intergenic
1199221032 X:145315911-145315933 ACACATGTATTTTCTGACTATGG - Intergenic
1200455503 Y:3386031-3386053 CCTCATGTATTATGACACTATGG + Intergenic
1200617890 Y:5402412-5402434 CTGCATTTAATGTATCACTATGG + Intronic