ID: 1031044217

View in Genome Browser
Species Human (GRCh38)
Location 7:116869445-116869467
Sequence ATTTAGTAAATGAATGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 915
Summary {0: 1, 1: 0, 2: 7, 3: 95, 4: 812}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031044217 Original CRISPR ATTTAGTAAATGAATGAAGA TGG (reversed) Intronic
901178020 1:7318856-7318878 ATTCAGTGAATGAATGAACAAGG + Intronic
901257116 1:7839236-7839258 CTTCAGTAACTGAAAGAAGATGG - Intronic
902665668 1:17935906-17935928 AAATAATGAATGAATGAAGATGG - Intergenic
903029752 1:20455284-20455306 AGTGAGTGAATGAATGAATAAGG - Intergenic
903105046 1:21070514-21070536 ATTTAGAACAAGAATGAAGTAGG - Intronic
904019398 1:27450846-27450868 ATTGAGGAAAGAAATGAAGAAGG - Intronic
904104924 1:28071429-28071451 ATTTAGTAAATGATTTATGGAGG - Intronic
905501175 1:38438669-38438691 ATTGAGTCAATTAATCAAGAAGG - Intergenic
905590717 1:39160917-39160939 AGTCAGTAACTAAATGAAGAGGG - Intronic
905930369 1:41782824-41782846 ATATAATGAATGAATGAAGGAGG + Intronic
905967851 1:42114337-42114359 ATTTAGTAGATGAATGACTTTGG + Intergenic
906665329 1:47617388-47617410 ATTTAGTGAATTAATGCAAAAGG - Intergenic
906951425 1:50337072-50337094 ATGAAGTAAATGAATAAATATGG + Intergenic
907002621 1:50876979-50877001 ATTTAATAAATAAATAAACAGGG + Intronic
907155978 1:52334314-52334336 AATAAGTAAATGAATGGACATGG + Intronic
907703122 1:56808900-56808922 ATTAAGCTAATGAATGAAGAAGG - Intronic
907774727 1:57502638-57502660 ATTTGTTAAATGAATAAACAAGG + Intronic
907941498 1:59092576-59092598 ATCTAGTAAGTGAAGGAAGTGGG - Intergenic
908080484 1:60572534-60572556 AATAAGTAAATGAATGAGCATGG + Intergenic
908632636 1:66126613-66126635 AGTTAATAAATAAATGTAGAAGG + Intronic
908860046 1:68474380-68474402 ATTTAGTAATGGAATGTACATGG - Exonic
909090036 1:71214318-71214340 TATAAGTAAATGAATGAATAAGG - Intergenic
909173607 1:72325501-72325523 ATTTTGAAAATAAATGAAAATGG + Intergenic
909244671 1:73264991-73265013 ATTTTCTAAATAAATGAAAATGG + Intergenic
909245233 1:73272606-73272628 ATTTAGTAAGTAAATTTAGAAGG - Intergenic
909590469 1:77342865-77342887 AATGAGTAAATGAATGAATCAGG - Intronic
909649500 1:77958279-77958301 AATTAATAAATGAATGAATCGGG - Intronic
909716924 1:78719514-78719536 TTGAAATAAATGAATGAAGAAGG - Intergenic
909915723 1:81316456-81316478 ATTTAGAAAATGATTAAAGTTGG + Intronic
909953075 1:81743238-81743260 ATGTAGGGAATGAATGGAGAGGG + Intronic
909974704 1:82031481-82031503 CTGAAGTAAATGACTGAAGATGG - Intergenic
911524493 1:98967440-98967462 TACTAGTAAATAAATGAAGAAGG + Intronic
911581408 1:99637571-99637593 AGATAGTTAATGAATGTAGATGG - Intergenic
911659749 1:100487970-100487992 ATTATGTGAATGGATGAAGAAGG + Intronic
911993334 1:104730883-104730905 ATTTTTTAAATCAATGAATATGG + Intergenic
912028495 1:105208116-105208138 AGTTAGTAAATAAATAAATAAGG + Intergenic
912115048 1:106395657-106395679 ATTTAGTGAATGAATGTCCAAGG + Intergenic
912215460 1:107606076-107606098 AGCTAGTAAATCAAGGAAGAGGG - Intronic
912452515 1:109776120-109776142 AGTAAACAAATGAATGAAGAAGG + Intergenic
913122160 1:115752452-115752474 AGTAAATGAATGAATGAAGAGGG + Intronic
913591020 1:120325486-120325508 ATTTGTAAAATGAATGAATAAGG + Intergenic
913652350 1:120929617-120929639 ATTTGTAAAATGAATGAATAAGG - Intergenic
913694276 1:121308969-121308991 ATTTAGTATACTAATGAAGTAGG + Intronic
914143287 1:144971097-144971119 ATTTAGTATACTAATGAAGTAGG - Intronic
914168758 1:145199454-145199476 ATTTGTAAAATGAATGAATAAGG + Intergenic
914523879 1:148443413-148443435 ATTTGTAAAATGAATGAATAAGG + Intergenic
914599796 1:149192456-149192478 ATTTGTAAAATGAATGAATAAGG - Intergenic
914642526 1:149623727-149623749 ATTTGTAAAATGAATGAATAAGG - Intergenic
914936507 1:151985927-151985949 ATTTAATAAATGAATGAATGAGG + Intronic
915392886 1:155560674-155560696 ATTTGTTGAATGAATGAAAAAGG + Intronic
915984832 1:160453931-160453953 ATTTAGTAAATGTATCCAGTTGG - Intergenic
916167390 1:161976272-161976294 AATGAATAAATGAATGAACAAGG - Intergenic
916309638 1:163382252-163382274 ATTTATTAAGTGAGTGAATAGGG - Intergenic
916437232 1:164788357-164788379 ATTAAATAAATAAATGAAAAGGG - Intronic
916778404 1:167995023-167995045 AATTAGGAAATTGATGAAGAAGG + Intronic
917213037 1:172649384-172649406 ATTGAATTAATGAATGCAGAAGG - Intergenic
917271402 1:173278796-173278818 ATTTAGCCAATTAATCAAGAAGG + Intergenic
917734627 1:177909176-177909198 ATTCAGTAAATGGTTGATGAAGG + Intergenic
917940318 1:179913258-179913280 ATTTAGAAAATAAATTAAGCCGG - Intronic
918574372 1:186038815-186038837 ATGTAATAACTGAAAGAAGAAGG - Exonic
918930817 1:190854649-190854671 TTTTAGAAAATAAAGGAAGAGGG - Intergenic
918964619 1:191326848-191326870 AATTAACAAATGAATGAATAAGG - Intergenic
919701306 1:200633935-200633957 ATGTAGTCAATGAAAGTAGAAGG - Intronic
920179616 1:204124456-204124478 ATTGGGCAAATGAATGAAGTTGG - Intronic
920331938 1:205215092-205215114 ATCTAGGAATTGAATGAAGAGGG - Intergenic
920481604 1:206327354-206327376 ATTTAGTATACTAATGAAGTAGG + Intronic
920729557 1:208470275-208470297 ATTTACTAATTTAATGATGATGG - Intergenic
920894882 1:210037637-210037659 ATTTCTGAAATGAATGAAAATGG - Intronic
921032025 1:211342156-211342178 AATATGTAAATGAATGAACATGG + Intronic
921239735 1:213166568-213166590 AGTTAATAAATAAATGTAGATGG + Intronic
921723073 1:218495004-218495026 ATTTATTCAAAGAATGAACAAGG + Intergenic
922171332 1:223158198-223158220 AATTAATAAATGAATAAAGCAGG - Intergenic
922281705 1:224131613-224131635 ATCTTGAAAATGAATGAAGTTGG + Intronic
923430647 1:233916972-233916994 ATTTGATGACTGAATGAAGAAGG - Intronic
923654778 1:235906102-235906124 TTTAAGTAAATAAATAAAGAGGG + Intergenic
924018134 1:239750213-239750235 ATTTAGTAAATGTGTGCAGAAGG + Intronic
924039165 1:239966523-239966545 TTTTATTAAATGAATAAATATGG + Intergenic
924045738 1:240028076-240028098 ATTTTTTAAAGGAATCAAGAAGG + Intronic
924133814 1:240941481-240941503 ATTTGCTAAATCAATGAACAAGG + Intronic
924145095 1:241065795-241065817 ATTTATTAACTGAGTGATGATGG + Intronic
924391397 1:243563421-243563443 TTTTAATAAATGAATCAAAATGG + Intronic
924543212 1:245000836-245000858 TATTATTGAATGAATGAAGAGGG + Intronic
924551656 1:245083667-245083689 ATCAAGTATATGACTGAAGAAGG + Exonic
924907000 1:248465873-248465895 ATTTGTTAAATAAATGAAGAAGG - Intergenic
924917109 1:248582263-248582285 ATTTGTTAAATAAATGAAGAAGG + Intergenic
1063222092 10:3978660-3978682 TGTTAGTAAATGAATGAAGGTGG + Intergenic
1063601038 10:7481814-7481836 AGTTAATGAATGAAAGAAGAGGG + Intergenic
1063726377 10:8641936-8641958 ATTTAGGACATTAATGAGGAAGG + Intergenic
1063769289 10:9179029-9179051 GTCTAGTAAATGAATATAGATGG - Intergenic
1063778621 10:9294173-9294195 AATATGTAAATGAATGAGGATGG + Intergenic
1063885267 10:10571251-10571273 ATTTAGTAAATGTCTGTGGATGG - Intergenic
1064183652 10:13141507-13141529 ATTTAGGAACTGACTGAAAAGGG - Intergenic
1064824289 10:19378209-19378231 ATGTATTCAATTAATGAAGAAGG + Intronic
1064843393 10:19622867-19622889 ATTTAGTAAATGATAAAAGATGG + Intronic
1065158945 10:22899127-22899149 ATTCAGTAAATGTGTGTAGAAGG - Intergenic
1065464362 10:26003012-26003034 ACTTAATGAATGAATGAAGGAGG + Intronic
1065568818 10:27046697-27046719 AATTAGTGAATGAATTGAGATGG - Intronic
1066138102 10:32472081-32472103 AATTAGTAAATGGATGAAACAGG + Intronic
1066401016 10:35076145-35076167 TTCTACTAAGTGAATGAAGAGGG + Intronic
1066401124 10:35077218-35077240 TTCTACTAAGTGAATGAAGAGGG + Intronic
1067930507 10:50556206-50556228 ATTTGTTAAATGAATGAATGAGG - Intronic
1068018810 10:51554504-51554526 ATTGAGTAAATAAATGATTAGGG - Intronic
1068027498 10:51665725-51665747 TTTTAAAAAATGAAGGAAGAAGG - Intronic
1069022684 10:63506209-63506231 ATATAATAAAGGAATAAAGAAGG + Intergenic
1069119985 10:64557401-64557423 AATTAGTGAATGGATGAATACGG + Intergenic
1069240789 10:66136748-66136770 ATTTGGTAAAATAATTAAGAAGG + Intronic
1069856612 10:71444538-71444560 ATTTGGCAAATGAAGGCAGAAGG + Intronic
1070472777 10:76800573-76800595 ATTTAATAAATTAAAGAAAATGG - Intergenic
1071020568 10:81050084-81050106 ATTTAGAAGATGAATGAAAAGGG - Intergenic
1071402554 10:85289284-85289306 GTTTAGAAAATGAATGAAAATGG + Intergenic
1071820692 10:89277542-89277564 AATTAATGAATGAATAAAGATGG + Intronic
1072079617 10:92015512-92015534 TTTTTGCAAATGAAGGAAGAGGG - Intronic
1072168947 10:92841897-92841919 ATTTAGTAAATAAATAATAATGG + Intronic
1072386936 10:94940325-94940347 ATTTAGTAATGGTAGGAAGAAGG + Intronic
1072425476 10:95326470-95326492 GTTGAATAAATGAAGGAAGAAGG + Intronic
1072481239 10:95810619-95810641 ATTTTGTACCTGAGTGAAGAAGG - Intronic
1072605046 10:96974077-96974099 ATTGAGTAAATCATTAAAGATGG + Intronic
1072640186 10:97205757-97205779 ACATAGTAAATTAATGCAGAAGG - Intronic
1073403256 10:103276111-103276133 GTAAAGTAAATGAATTAAGAAGG + Intergenic
1073926829 10:108526332-108526354 ACTAAGTAAATGAATGGGGAAGG + Intergenic
1074360036 10:112818269-112818291 ATTAAGTAAAGAAATAAAGAGGG + Exonic
1074513371 10:114139931-114139953 ATTTATTAAATAAATGAGTAAGG + Intronic
1075371241 10:121936878-121936900 AATAAGTAAATAAATGAGGAAGG + Intergenic
1075607825 10:123827762-123827784 ATTTCTTAAAAGAATGAAGTGGG + Intronic
1076148720 10:128145982-128146004 ATTGAGTAAATGAATGGAGAAGG + Intergenic
1077263458 11:1636167-1636189 ATTTAGTAAATAAATAAAGGAGG + Intergenic
1077739377 11:4828458-4828480 ATCAAATAAATGAATGATGATGG + Intronic
1077849764 11:6064056-6064078 ATTGAATAAATGAATAAATAGGG - Intergenic
1078183700 11:9033412-9033434 TTTGAGCAAATAAATGAAGATGG - Intronic
1078499264 11:11853648-11853670 TTTCATTAAATGAAAGAAGAGGG - Intronic
1078825851 11:14929821-14929843 ATTGAGTAAATGAATTAATATGG + Intronic
1078876187 11:15400424-15400446 ATTTTTTAAATGAATGAAAATGG - Intergenic
1078919021 11:15809558-15809580 ATTTTGCAAATCAGTGAAGATGG - Intergenic
1079132091 11:17752962-17752984 ATTCAGTAAATGTTTGATGATGG + Intronic
1079483637 11:20910600-20910622 ATTTACTAAACAATTGAAGAGGG - Intronic
1079494324 11:21024252-21024274 TTTAAGTAAATCAATGTAGAAGG - Intronic
1079620253 11:22545321-22545343 TTTTAGTAAAATATTGAAGAAGG - Intergenic
1080507436 11:32929804-32929826 ATTTATTAGATTAATGTAGAAGG - Intronic
1080578460 11:33621929-33621951 ACTTTGAAAATGAATGAAGTAGG + Intronic
1080962555 11:37177614-37177636 ATTTTGTTAATCAATGAAGAGGG - Intergenic
1081037150 11:38162855-38162877 ATTCAGGAAATGAATAGAGAAGG + Intergenic
1081218812 11:40435468-40435490 ATCTAATAAATCAATGCAGATGG - Intronic
1081266698 11:41032704-41032726 ATTTAGTAACTGAAAAAAGGGGG + Intronic
1081722199 11:45298549-45298571 TTTTAATAAATAAATGAGGAGGG + Intergenic
1082755595 11:57073008-57073030 ATTTAGTAAATGCCTGAAATAGG + Intergenic
1082839183 11:57674998-57675020 TGGTAGTAAATGTATGAAGAAGG - Intronic
1083161087 11:60854491-60854513 ATGGAGTAAGTGAATGAACAGGG - Intronic
1083798801 11:65034638-65034660 ATCTGGCAAATGAATGAATAGGG + Intronic
1084064869 11:66698203-66698225 AATAAGTGAATGAATGAACATGG - Intronic
1084873526 11:72113858-72113880 ATTTGTTGAATGAATGAAAAAGG - Intergenic
1085002830 11:73056600-73056622 ATTTAATGAATGAATGAATGAGG - Intronic
1085215344 11:74825992-74826014 AGTGAGTGAATGAATGAAGGGGG + Intronic
1085419728 11:76345573-76345595 ATTAAGTTAATGAGTGATGATGG - Intergenic
1085497673 11:76986553-76986575 ATATAGTAAGTGATTGAAAATGG - Intronic
1086294197 11:85346852-85346874 AAGTAGTCAATGAATGGAGAAGG + Intronic
1086557087 11:88123345-88123367 ACTGAATAAATGAATGAACAAGG + Intronic
1086605577 11:88692389-88692411 AGTGAGTAAATGAATGAACTAGG + Intronic
1086642475 11:89176889-89176911 AATTAGTGAGTGAATGAAAAAGG - Intergenic
1086770017 11:90750477-90750499 ATATAGTAATTGAAGAAAGAAGG - Intergenic
1087321493 11:96665145-96665167 ATTTAGTTTCTGAATGAAAATGG - Intergenic
1087367870 11:97244430-97244452 ATTTTTTAAATCAAGGAAGAAGG - Intergenic
1087368931 11:97256448-97256470 ATTTCTGAAATGAATGAAGAAGG + Intergenic
1087386058 11:97470538-97470560 ATTTAGAATACAAATGAAGATGG + Intergenic
1087500192 11:98941985-98942007 AATAAATAAATGAATGAAAAGGG - Intergenic
1087510245 11:99083251-99083273 ATTTAAAAAAGGAAAGAAGAGGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087848218 11:102997568-102997590 ATCTAGTTAATGAAAGCAGAAGG + Intergenic
1087880790 11:103413937-103413959 ATTTGCTAAATGAATGAAAAAGG - Intronic
1088373175 11:109113415-109113437 AATAAATGAATGAATGAAGAGGG - Intergenic
1088487029 11:110350463-110350485 ATTTGGAAAATGAATAAAGTTGG - Intergenic
1088536962 11:110872139-110872161 AATTAGTAAATGGAGGAACAAGG + Intergenic
1088654385 11:111985466-111985488 GTTTATTAAATGAATGAAGAAGG - Intronic
1088735814 11:112726903-112726925 ATCTATATAATGAATGAAGAAGG - Intergenic
1088954051 11:114600386-114600408 ATTTGGTAAATGAAGGAATGAGG - Intergenic
1089087374 11:115833812-115833834 TTTGAAAAAATGAATGAAGAGGG + Intergenic
1089844293 11:121446361-121446383 TTTTAGTTAATGAATAAACAAGG + Intergenic
1089943596 11:122444409-122444431 AATTAGCAAATTAATGAAAAGGG - Intergenic
1090030162 11:123199340-123199362 GGTTAGTAAATGATTGAAGCAGG + Intergenic
1090046241 11:123336705-123336727 AATTAGTAAGTGAATTAAGCAGG + Intergenic
1091096673 11:132829420-132829442 AATGAGTCAATTAATGAAGATGG + Intronic
1091574349 12:1719463-1719485 ATTTAGTAACTATATGAACATGG + Intronic
1091970935 12:4786375-4786397 AATTAGTACCTTAATGAAGATGG - Intronic
1091988519 12:4934636-4934658 AATTAATAAATGAATAAACATGG - Intergenic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092571335 12:9725837-9725859 ATTTGGTAAATGAATTCAAAGGG + Intronic
1092617425 12:10228097-10228119 ATTCAGTAAAAGAATGATGATGG + Intergenic
1092917242 12:13200076-13200098 ATTTTCTAAATGCATGAATATGG + Intronic
1093436082 12:19136945-19136967 ATTCAAAATATGAATGAAGATGG + Intronic
1093490558 12:19700199-19700221 CTTTAGTAAAGGAACCAAGATGG + Intronic
1093636849 12:21480854-21480876 ACTTAGAAACTTAATGAAGAGGG - Intronic
1093748000 12:22764904-22764926 ATTTAGGAAACAAATGAACAGGG + Intergenic
1093974921 12:25411195-25411217 ATTTAGCAAATTTATGAGGACGG - Intronic
1094418962 12:30250112-30250134 TTTTTGTAAATGAATGATTATGG + Intergenic
1095127000 12:38491314-38491336 ATTTATTAAAAGAATGAAGCTGG - Intergenic
1095710300 12:45281162-45281184 ATTTACTAAATGAATAAATAAGG - Intronic
1096753034 12:53775006-53775028 ATTTGTTGAATGAATGAATAAGG + Intergenic
1097317306 12:58185655-58185677 AATGGGTAAATGAGTGAAGATGG - Intergenic
1097764852 12:63514178-63514200 TTTTAGTAAGTCAAAGAAGAGGG + Intergenic
1098302851 12:69071593-69071615 ATTTGATAAATGAATAAACAAGG + Intergenic
1098825093 12:75286935-75286957 ATTTAGCAAATTAATCAAAAAGG + Intronic
1099280864 12:80643575-80643597 ATTTGGTAAAAGAATACAGAAGG + Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099476579 12:83114821-83114843 ATATATAAAATGAATGAAGATGG - Intronic
1099702986 12:86112767-86112789 AGTGAGTAAAGGAAGGAAGATGG + Intronic
1099746604 12:86712093-86712115 ATTTAATAAATAAATGAAATGGG - Intronic
1099985409 12:89657189-89657211 ACTTAGTAACTGACTGAAGCCGG - Intronic
1100065283 12:90636279-90636301 AATAAATAAATGAATGAATAAGG + Intergenic
1100603973 12:96135817-96135839 ATGTATTGAATGAATGAATAGGG - Intergenic
1100866025 12:98857658-98857680 AATGAATAAATGAATGAAGGTGG + Intronic
1101560106 12:105848954-105848976 ATTTTGTGAGTGAATGAAGGAGG - Intergenic
1101573362 12:105975540-105975562 ATTTGATAAATGAATGAAAATGG - Intergenic
1101804695 12:108053155-108053177 ATTTAGAAAATGAATCAAGATGG + Intergenic
1102143973 12:110640402-110640424 ATTTAGAGACTGAATGACGATGG - Exonic
1102426735 12:112849723-112849745 GTTGAGTGAATGAATGAACATGG + Intronic
1103080575 12:118020719-118020741 ATTCACTAAATTAATAAAGATGG - Intronic
1103758532 12:123231327-123231349 ATTTATTAAACAAATGAACAAGG - Intronic
1104172271 12:126293335-126293357 CTCTTGTAACTGAATGAAGATGG + Intergenic
1104651667 12:130539109-130539131 TTTTTGGAAATGAATGAATATGG - Intronic
1105030537 12:132880109-132880131 ATTTTGAAAAAGAATGAAGCTGG + Intronic
1105320654 13:19318001-19318023 TATTAGTAAATGAATTGAGATGG - Intergenic
1106224449 13:27774508-27774530 AGTGAGTGAATGAATGATGAAGG + Intergenic
1106930956 13:34664219-34664241 ATTTTTTACATGAATGAATATGG + Intergenic
1107026445 13:35806641-35806663 AGTTAGAAACTGAATGAAGAAGG - Intronic
1107054955 13:36092838-36092860 ATTTAGTAACTGATTGGATATGG - Intronic
1107171184 13:37343579-37343601 ATTTTTTAAATAAATGAAGTAGG + Intergenic
1107370988 13:39747443-39747465 ATGTATTACATGAATGAAGGAGG - Intronic
1107430905 13:40339410-40339432 AGTAAGTCAATGAATGAAGGTGG - Intergenic
1108201494 13:48048664-48048686 AATAAGTCAATGAATGAAGCAGG + Intergenic
1108434990 13:50393132-50393154 GTTTAATAAAAGGATGAAGAGGG - Intronic
1108551257 13:51547254-51547276 ATTTAATAGATGCATAAAGATGG - Intergenic
1108568607 13:51727171-51727193 ATTTAGTAAATGTCTGATGAAGG - Intronic
1108805425 13:54149107-54149129 AATTAACTAATGAATGAAGAGGG - Intergenic
1108997610 13:56754182-56754204 ACTTTGTAGATGCATGAAGAAGG - Intergenic
1109624861 13:64961893-64961915 ATTTAGGAAAGGAGGGAAGATGG + Intergenic
1109868075 13:68292717-68292739 AATAAGTAAATAAATGAACATGG + Intergenic
1109900963 13:68769338-68769360 ATTTAGGAAAAAAAAGAAGAGGG - Intergenic
1110034660 13:70667977-70667999 ATTTAGTAAAAAAAGGAATATGG - Intergenic
1111201724 13:84947181-84947203 ATTTATTAAATGAATAGAAAAGG - Intergenic
1111612852 13:90626205-90626227 AATAATTTAATGAATGAAGAAGG - Intergenic
1112681641 13:101773633-101773655 ATTTAGTTATGGAATGAAGAAGG + Intronic
1112757973 13:102660935-102660957 ATATAGAAAAAGAATGAAGTTGG + Intronic
1112784824 13:102940162-102940184 ATTGAGTAAATTAATGAACGAGG - Intergenic
1112805777 13:103162559-103162581 ATTTGGTCAATGAACGAAGCTGG + Intergenic
1112993166 13:105538926-105538948 ATTTAGGTAATGAATAAATATGG - Intergenic
1113912653 13:113851122-113851144 GATGAGTAAATGAATGGAGATGG + Intronic
1114029531 14:18565544-18565566 AATTAGAGAATGTATGAAGAAGG - Intergenic
1114467625 14:22935323-22935345 TCCTAGTAAATGAATGAACAGGG - Intergenic
1114892768 14:26946049-26946071 GTTTAGTAAATGAATGAATGTGG + Intergenic
1115170814 14:30504202-30504224 ATTTTGTAAAAGAATGTAGAAGG + Intergenic
1115301030 14:31885426-31885448 AGTTAATAAATGAATTAATAGGG - Intergenic
1115714765 14:36091114-36091136 ATGGAGTAAACAAATGAAGAGGG - Intergenic
1116122988 14:40744552-40744574 ATTTAATAAATCAGTGAAGTAGG - Intergenic
1116234380 14:42259271-42259293 ATGTACTGAATGAATAAAGAAGG - Intergenic
1116514136 14:45785749-45785771 GTTTACTAAGTGAAAGAAGAAGG - Intergenic
1116631709 14:47343620-47343642 ATTTAGATAATTAATGAAAATGG - Intronic
1116642466 14:47482655-47482677 AATAAATGAATGAATGAAGAAGG - Intronic
1116758018 14:48972770-48972792 ATTTAGAGATTGAATGAAAATGG + Intergenic
1116763427 14:49042136-49042158 ATTTAGTAAATGACAGAATCAGG - Intergenic
1116846026 14:49865820-49865842 ATATAGTGATTGAATTAAGATGG - Intergenic
1117108847 14:52427702-52427724 ATTTAGTAACTGAAAGAACGTGG - Intergenic
1117120209 14:52559524-52559546 TTTTAGTAAATGAGGGAAAAGGG + Intronic
1117431679 14:55671704-55671726 ATTTAGGCCATGAAGGAAGAAGG - Intronic
1119261739 14:73241769-73241791 AATGAGTAAATGAATAAAGGTGG + Intronic
1119655762 14:76415674-76415696 AATTAGTAAATAAATAGAGATGG + Intronic
1119947883 14:78714066-78714088 ATTTATTAAATGATTAAATAAGG + Intronic
1120157329 14:81107953-81107975 AATTAGGAATGGAATGAAGATGG - Intronic
1120192111 14:81448975-81448997 TTTTTTTAAATGAATGAAGAGGG + Intergenic
1120975481 14:90244431-90244453 ATTTATTTAATGAACAAAGAGGG - Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1121951747 14:98176958-98176980 TTTTAGAAAATGAATGAGGTGGG - Intergenic
1121987490 14:98521869-98521891 AGTTGGTAAATGATTGAAGTGGG + Intergenic
1122096334 14:99375651-99375673 CTTCAGTATATGAATAAAGATGG + Intergenic
1122288389 14:100666369-100666391 ATTTAGCAAATGACTGTAAACGG + Intergenic
1122756811 14:103987376-103987398 ATTTGGAAGATGAATGAACAAGG - Intronic
1124078964 15:26473859-26473881 ATTTTGCATATGAGTGAAGAGGG + Intergenic
1124080141 15:26486271-26486293 ATATAGTAAATGAAGGAAACTGG + Intergenic
1124235540 15:27986372-27986394 GCTCAGTAAATAAATGAAGAAGG - Intronic
1124269399 15:28266943-28266965 ATTTGTTAAATGAATGTGGATGG + Intronic
1124506583 15:30281771-30281793 AATCAGTAAATAAATGTAGAAGG + Intergenic
1124610630 15:31205751-31205773 AATTTGTAAATGAATGAGCATGG - Intergenic
1124736974 15:32256865-32256887 AATCAGTAAATAAATGTAGAAGG - Intergenic
1125087235 15:35744850-35744872 ATTTTTAGAATGAATGAAGATGG - Intergenic
1125220447 15:37326843-37326865 ATTTTTTTAATGAATTAAGATGG - Intergenic
1125367708 15:38936623-38936645 ATTGCATAAATGAATGAAGTAGG - Intergenic
1125458249 15:39883240-39883262 TTTTGGTAAAATAATGAAGAAGG + Intronic
1125687182 15:41570388-41570410 ATTTGGTAAAAGAATGCAGATGG - Intronic
1125965473 15:43872046-43872068 AATTTGTAAATGAAGGAACATGG - Exonic
1126146103 15:45474316-45474338 ATTTTTTAAATGAATTAATAAGG - Intergenic
1126180206 15:45777766-45777788 CTTTATTAAATGAGTAAAGAGGG + Intergenic
1126410200 15:48366030-48366052 ATTTTATGAATGAATGAATATGG + Intergenic
1126985640 15:54304155-54304177 ATTAAGTAAATAAATGGAAATGG + Intronic
1127178640 15:56389970-56389992 ATTTAATAACTTACTGAAGATGG - Intronic
1127951967 15:63816801-63816823 ATCTAACACATGAATGAAGAAGG + Intronic
1128070647 15:64794260-64794282 ATTTATTAATTTAATTAAGATGG - Intergenic
1129045717 15:72732461-72732483 ATTTAGTAAGTAAATGTATATGG - Intronic
1129061658 15:72865252-72865274 ATTTGGTAAAGGATTGAACACGG - Intergenic
1129305828 15:74661241-74661263 ATTAATTAAATCTATGAAGATGG + Intronic
1129320857 15:74773904-74773926 ATTTAGTGAATGGATGAATGAGG + Intergenic
1130042779 15:80418872-80418894 ATTTATTGAATGAATGAATGAGG - Intronic
1130300328 15:82675681-82675703 AATTTGTAAATGAATGAGCAGGG + Intronic
1130304046 15:82700846-82700868 AATAAGTAAATAAATGCAGATGG - Intronic
1130617959 15:85430682-85430704 AATTAGGATAAGAATGAAGAAGG - Intronic
1131115592 15:89793079-89793101 ATTTCTGAAGTGAATGAAGAGGG + Exonic
1131525206 15:93147100-93147122 ATTTAAAGAATGTATGAAGAAGG - Intergenic
1132032062 15:98446358-98446380 CCCTAGTAAATGAATGCAGATGG - Intronic
1133479046 16:6151611-6151633 ATCTATTAAATGCATGAAGATGG - Intronic
1133629639 16:7607824-7607846 ATTTGATTAATGAACGAAGACGG - Intronic
1133697332 16:8277231-8277253 AATAAGTAAATAAATAAAGATGG + Intergenic
1134336173 16:13301728-13301750 AATGAGTGAATGAATGAAGTTGG + Intergenic
1134421379 16:14093417-14093439 ATTAAGTAAATAAATAAAAATGG - Intronic
1134742269 16:16558587-16558609 AATTAATAAATGAATAAAGAAGG - Intergenic
1134788955 16:16971160-16971182 ATCTAGAAACTGAAGGAAGATGG - Intergenic
1134861838 16:17567182-17567204 ATTTGCTGAATGAATGAAGAAGG - Intergenic
1134919883 16:18106251-18106273 AATTAGTTAATGTTTGAAGATGG - Intergenic
1134925295 16:18153871-18153893 AATTAATAAATGAATAAAGAAGG + Intergenic
1135020369 16:18957872-18957894 ATTTAGTCACTGAAAGAGGATGG - Intergenic
1135074349 16:19380727-19380749 ATTTGGTGATTGAATGAAGGAGG - Intergenic
1135118326 16:19742845-19742867 ATTGGATAAATGAATGAATATGG + Intronic
1135251129 16:20901365-20901387 GTTAAGTAAATCAATAAAGAAGG + Intronic
1135406765 16:22204167-22204189 ATTAAATAAATAAATGAAAAAGG - Intergenic
1135780167 16:25293163-25293185 GTTTAGTAAATGAATGAATGTGG - Intergenic
1137407586 16:48202055-48202077 AATAAGTAAATGAATGAATGGGG - Intronic
1137819414 16:51429443-51429465 ATTTAGAAGATGAGAGAAGATGG + Intergenic
1137890247 16:52153149-52153171 ATTGAGTAAATGAAAGAGAAAGG + Intergenic
1138229380 16:55326186-55326208 ATTTAGTTAATGCATAATGAAGG + Intronic
1138934796 16:61706028-61706050 ATGTATTGAATGAATGAATAAGG + Intronic
1138980251 16:62259189-62259211 ATAAAGGAAATGAAAGAAGAAGG + Intergenic
1139086215 16:63589416-63589438 ATTATGTAAATGAATGACTATGG - Intergenic
1139755205 16:69137068-69137090 ATTTCATAAATGAATCAACAAGG - Intronic
1140493680 16:75363808-75363830 ATTTATTGAATGAATGAATGAGG - Intronic
1140573743 16:76139014-76139036 ATTAAATAAATAAATGAATAGGG - Intergenic
1140989135 16:80191360-80191382 AATAAATAAATGAATGAACAAGG + Intergenic
1141279394 16:82617367-82617389 AATGAATGAATGAATGAAGAAGG + Intergenic
1144191516 17:12850834-12850856 ATTTGGTGAATGAATGAATGAGG + Intronic
1144603050 17:16636362-16636384 TTTTAGCTAATGAATGAAGAAGG + Intronic
1144708828 17:17387322-17387344 ATTGAGTGAATGAATGAAATAGG - Intergenic
1146559909 17:33859013-33859035 ATTGACTACATGAATGAATATGG - Intronic
1146659377 17:34654183-34654205 AGTTAGAAAATGAATCCAGAGGG - Intergenic
1147438549 17:40432597-40432619 AATGAACAAATGAATGAAGAGGG + Intergenic
1147847963 17:43418526-43418548 ATTTACTGAATGAATGAATGAGG - Intergenic
1147963766 17:44182104-44182126 TTTTAGTAAATGACTGCGGAAGG + Intergenic
1148969409 17:51466318-51466340 AATGAGTGAATGAATGAAGGAGG + Intergenic
1149313486 17:55418680-55418702 AATTATTAAATAAAGGAAGATGG + Intronic
1149499690 17:57142832-57142854 ATTGAATAAATAAATGAAGCTGG - Intergenic
1149573417 17:57694045-57694067 AATATGTAAATGAATGAACATGG - Intergenic
1150029275 17:61714780-61714802 AATTAGCAAATCATTGAAGAAGG - Intronic
1153044389 18:842546-842568 ATTTAGCAAATGAATAAAAGGGG + Intergenic
1153318754 18:3751215-3751237 AGTAAATAAATAAATGAAGAGGG + Intronic
1153429133 18:4996480-4996502 ATTTAGTAAATAATGGAAGTCGG + Intergenic
1153636972 18:7120994-7121016 GTTTATTGAATGAATGAAGTAGG - Intergenic
1153996133 18:10443167-10443189 ATTTTGTAAATGTATGAAGTGGG + Intergenic
1154098163 18:11440379-11440401 ATATTGGAAATGAAAGAAGAGGG - Intergenic
1154931569 18:21002601-21002623 AATTAACAAATGAAGGAAGATGG + Intronic
1155031285 18:21986483-21986505 ATTTTGTAAAAGAATAAAGTGGG + Intergenic
1155651780 18:28151907-28151929 AATCAGTATATGAATGAACATGG + Intronic
1156951171 18:42900013-42900035 ATTTAATTAATTAATGAAAATGG + Intronic
1157543793 18:48533441-48533463 ATTTATAAACTGACTGAAGAGGG + Intergenic
1157655371 18:49382217-49382239 ATTGAGTGAATCAGTGAAGAAGG - Intronic
1157797830 18:50591762-50591784 ATTTAGTAAATGCAAGAACATGG + Intronic
1157848151 18:51023364-51023386 ATTTGTTGAATGAATGAACAAGG - Intronic
1157861738 18:51147429-51147451 TTCTAGCAAATGAATGAAGGAGG - Intergenic
1158083581 18:53624133-53624155 ATTTATTAATTGAATGATCAGGG - Intergenic
1158144226 18:54292812-54292834 ATTTAATAAATGGAATAAGAAGG - Intronic
1158267964 18:55681130-55681152 ACTTAGTAAATGGATGAATAAGG - Intergenic
1158278627 18:55796309-55796331 ATTTTATAAATGTATGATGATGG + Intergenic
1158430927 18:57386669-57386691 ATTTGATAAATCACTGAAGATGG - Intergenic
1158638917 18:59185637-59185659 AATGAGTAAACGAATGAAGTAGG + Intergenic
1159125394 18:64218217-64218239 AATTAGTAAATGAAGAATGAAGG + Intergenic
1159221152 18:65464644-65464666 ATTTACTAAAATAAAGAAGAAGG + Intergenic
1159336212 18:67070743-67070765 CATGAATAAATGAATGAAGAAGG - Intergenic
1159538834 18:69749373-69749395 ATTTTGTGAAAGATTGAAGATGG - Intronic
1159688564 18:71456465-71456487 ATTTAGGACATGAAAGAAAATGG - Intergenic
1159735110 18:72086484-72086506 ATTTTGTAAATGAAAGAACTGGG + Intergenic
1159736701 18:72108531-72108553 ATTTAGAAAATACATAAAGAAGG - Intergenic
1160054804 18:75468950-75468972 ATTTAGGAAATAAATAATGAAGG - Intergenic
1161869207 19:6857338-6857360 ATTTAATAAAAGGATGAAGATGG + Intronic
1161990907 19:7683631-7683653 ATATAATAAATGAGGGAAGAAGG - Exonic
1162060008 19:8089204-8089226 AATTGGTAAGTGAATGAATAAGG + Intronic
1163370795 19:16900140-16900162 ATTTTGTACAGGAAGGAAGAGGG - Intronic
1165209762 19:34224765-34224787 ATTTGGTAAATGAATGGGGATGG - Intronic
1167175943 19:47864463-47864485 AGTTTGTTAATGAATGAAGATGG + Intergenic
1167563854 19:50243794-50243816 CTTAGGGAAATGAATGAAGAAGG - Intronic
925109400 2:1321020-1321042 AATGAATAAATTAATGAAGAAGG + Intronic
926171977 2:10558304-10558326 AATAAGTGAATGAATGGAGAAGG - Intergenic
926270598 2:11363234-11363256 ATTTATTGAATGAATGAATGAGG - Intergenic
926744730 2:16141596-16141618 ATGGAGCAAATGCATGAAGATGG - Intergenic
926870921 2:17416096-17416118 TTTCATTCAATGAATGAAGAAGG + Intergenic
927235619 2:20871882-20871904 AGGTAGCAAAAGAATGAAGAAGG + Intergenic
927418526 2:22904835-22904857 AATTAGTGAAAGAATGAATAGGG - Intergenic
928125591 2:28613426-28613448 AGTTAGTTAAAGAAGGAAGAAGG - Intronic
928418874 2:31121966-31121988 CTTTTGTAAATGATAGAAGATGG - Intronic
928635999 2:33247503-33247525 AATAAGTAAATGAATGGACATGG - Intronic
929355050 2:41013754-41013776 ATTTATTTAATGAATAAATAGGG - Intergenic
929644960 2:43617296-43617318 TTATAGTAAAGGGATGAAGAAGG + Intergenic
930051885 2:47222796-47222818 ATTTGTTAAATGAATGAACATGG + Intergenic
930413341 2:51055582-51055604 ATTTAATAAATGAAGAAAGAAGG - Intergenic
930443760 2:51444456-51444478 AATTTGTAAATGAATTAAGATGG - Intergenic
930443763 2:51444507-51444529 AATTTGTAAATGAATTAAGATGG - Intergenic
930649042 2:53946289-53946311 ATTTTGTAAATGAAAGGAGGAGG - Intronic
930726226 2:54684311-54684333 AATGAATAAATAAATGAAGAAGG + Intergenic
930787396 2:55283849-55283871 ATTTGGTAAAGGGGTGAAGATGG + Intergenic
931025040 2:58103023-58103045 ATTTTTGAAATGAATGAAAATGG + Intronic
931261856 2:60626975-60626997 ATTTACCTGATGAATGAAGAGGG + Intergenic
932132257 2:69198444-69198466 GATTAATATATGAATGAAGATGG - Intronic
932202327 2:69841697-69841719 ATTTAGTGAATGGATAAAGAAGG + Intronic
932502292 2:72193927-72193949 ATTATGTAAATCAATGAACATGG - Intronic
932549205 2:72750229-72750251 ATTAAGTACATGAAAGAGGATGG + Intronic
932601042 2:73125827-73125849 TTCCAGAAAATGAATGAAGAAGG + Intronic
932795079 2:74687547-74687569 ATTTATTGAGTGAATGAATATGG + Intergenic
933023897 2:77229105-77229127 ATTTTGGAAATTAATTAAGAAGG - Intronic
933211649 2:79577239-79577261 ATTTATTCACAGAATGAAGAAGG - Intronic
933431416 2:82184824-82184846 AAATAGAAAATGAATGATGAAGG + Intergenic
933471993 2:82737719-82737741 GTTCAGTAAATGAATAAATAAGG + Intergenic
935310301 2:101776620-101776642 ATTTAGTCAATGAATTACTAGGG + Intronic
935539084 2:104328151-104328173 AATAAGTAAATAAATAAAGACGG + Intergenic
935791158 2:106591457-106591479 ATTTATTAAATGGAAGGAGATGG - Intergenic
935794292 2:106626294-106626316 TTCTAGTTAATGAATGTAGAAGG - Intergenic
936488432 2:112947440-112947462 ATTTAATAAGTGAAAGAAGAAGG - Intergenic
936642315 2:114328501-114328523 ATCTAATAACTGATTGAAGAGGG - Intergenic
938221959 2:129576749-129576771 TTTTAGTTTATAAATGAAGAAGG - Intergenic
938834920 2:135091904-135091926 ATTTGCTTAGTGAATGAAGAAGG - Intronic
939020570 2:136953652-136953674 ATTCCGTTAATGCATGAAGATGG - Intronic
939620515 2:144413293-144413315 ATTTGTTGAATGAATGAAGGAGG + Intronic
939622199 2:144434274-144434296 ATTTAATAAATGTTTGATGATGG - Intronic
939739964 2:145894038-145894060 ATATAGTAAAGGTAAGAAGAGGG + Intergenic
939775986 2:146388698-146388720 ATTTAAAAAATAAATGAAGCCGG - Intergenic
939940945 2:148350375-148350397 TTTTTATAAATGAATAAAGAAGG - Intronic
940026357 2:149212446-149212468 ATTTAATAAATGAGTGAAAAAGG + Intronic
940489518 2:154340242-154340264 AATAAGTAAATAAATGAAGAAGG - Intronic
940607394 2:155943479-155943501 ATTTAAAAAGTGAATGAAAAAGG - Intergenic
940684808 2:156833984-156834006 ATTTTCTAAATTAATGAACATGG + Intergenic
940794957 2:158068104-158068126 ATTTAGTTACTTAATGAAAATGG + Intronic
941001639 2:160208667-160208689 AATGAGTAAATGAAAAAAGAAGG - Intronic
941019975 2:160397613-160397635 AAAGAGTGAATGAATGAAGAGGG - Intronic
941203506 2:162543688-162543710 ATTTAGTGAATGAATGACTTTGG + Intronic
941230893 2:162911518-162911540 ACTTAGTATATGCATGAAGCTGG + Intergenic
941238033 2:162999906-162999928 ATTTATTAAATTAAATAAGAAGG + Intergenic
941578206 2:167262658-167262680 ATGTTATAAAGGAATGAAGATGG + Intergenic
941976581 2:171411975-171411997 ATTTACTAAAGAAATGCAGATGG + Intronic
942039693 2:172047409-172047431 ATTTAGTAACAGAATAAAAAAGG + Intronic
942235749 2:173903461-173903483 CTTTACTAAATGAATAAAGATGG + Intergenic
942382625 2:175407771-175407793 ATTTAGTAGATAAAAGAATATGG - Intergenic
942520998 2:176803941-176803963 AGCTAATAAATGAATGAGGATGG + Intergenic
942599619 2:177627437-177627459 ATTCAGGAAATGTCTGAAGAAGG - Exonic
942725942 2:179008259-179008281 ATTTGATAAATGAATGAGCATGG - Intronic
942756191 2:179344087-179344109 TTTAAGTAAAAGAATGAAGCAGG - Intergenic
942964109 2:181869174-181869196 AATATGTAAATGAATGAACATGG - Intergenic
943231710 2:185261906-185261928 ATTTAGGATATGAATAAAGGAGG - Intergenic
943588614 2:189769710-189769732 ATTTAATAAGTAAATAAAGAAGG + Intergenic
943783712 2:191852722-191852744 ATTGACTTAATGATTGAAGATGG + Intergenic
944418262 2:199500296-199500318 ATTTTGAAAATGAATGAAGTTGG + Intergenic
944735652 2:202560871-202560893 ATTTCTTAAATAAATGAACATGG - Exonic
945105345 2:206307162-206307184 AATTAGTCACTGAATGAAGAGGG - Exonic
945506867 2:210652499-210652521 AATTAGTGAATGAATGGAGGTGG + Intronic
945591153 2:211733141-211733163 ATTAAATAAATGAATAAAGCAGG - Intronic
945693529 2:213072960-213072982 CATTATTAAATGAATGAAAAAGG - Intronic
945699795 2:213154913-213154935 ATTTATTAAATGAATGAATATGG + Intergenic
946313118 2:218893736-218893758 ATTTGTTAAATGAATGATGAAGG - Exonic
946436833 2:219662667-219662689 ATTAAGTGCAAGAATGAAGAAGG + Intergenic
947077293 2:226359141-226359163 ATATAGTAAAGGAATAAACATGG - Intergenic
947430663 2:230024826-230024848 AATGAGTGAATGAATGAAAAAGG - Intergenic
1168974935 20:1957724-1957746 ATTTAGTAGAGGAATTAGGATGG + Intergenic
1169026281 20:2374335-2374357 ATGGAAGAAATGAATGAAGAGGG + Intergenic
1169034943 20:2442402-2442424 ATTTTTTAAATGAATGATGTTGG + Intergenic
1169835385 20:9872371-9872393 ATTTATTAACTGTATGAGGAAGG - Intergenic
1170114470 20:12842146-12842168 ATTTAAGACATGAAAGAAGATGG - Intergenic
1170417079 20:16156216-16156238 AATGATTTAATGAATGAAGATGG - Intergenic
1170447555 20:16444470-16444492 AATTTGTAAATGAATGAACATGG - Intronic
1171378236 20:24710199-24710221 CTTTAGTAAATGAATTAAAATGG + Intergenic
1172670514 20:36631833-36631855 ATTTGCTGAATGAATGAACATGG + Intronic
1172820973 20:37733930-37733952 AATGAATAAATGAATGAAGCTGG + Intronic
1173243167 20:41316248-41316270 ACATAGAAAATGAATGAAAAGGG - Intronic
1173281734 20:41634445-41634467 ATTTCAGAAATGAATGAGGAAGG - Intergenic
1173762197 20:45572585-45572607 AGTTAGTAAATAAATAAATAAGG - Intronic
1174485436 20:50858101-50858123 AATGAATGAATGAATGAAGATGG - Intronic
1174956360 20:55103113-55103135 GTTTAATAAGTGAAAGAAGAAGG + Intergenic
1175537385 20:59724242-59724264 ATTTACTTAATGCATGAAGGAGG + Intronic
1175613927 20:60376424-60376446 AATGAGTGAATGAATGAAGATGG - Intergenic
1176042530 20:63072937-63072959 TTTTAGTGACTGAAGGAAGAGGG - Intergenic
1176893559 21:14348407-14348429 ATTGAGAAAAGGAAAGAAGACGG + Intergenic
1176999891 21:15599189-15599211 TTTTGGAAAATGCATGAAGATGG - Intergenic
1177487846 21:21782277-21782299 AGTCAGTAAATAAATTAAGAAGG - Intergenic
1177630180 21:23716470-23716492 ATTAAGGAAATGACTGAAGTAGG + Intergenic
1178147127 21:29752899-29752921 ATTTCTTAAATGATTGGAGAAGG + Intronic
1178190550 21:30274727-30274749 AATTTGTACATGAATAAAGAAGG + Intergenic
1179402970 21:41101528-41101550 ATTTTGTAGATGAATGTATAAGG + Intergenic
1180257211 21:46639412-46639434 TTTTAGTAACTGATAGAAGATGG - Intronic
1180453646 22:15492594-15492616 AATTAGAGAATGTATGAAGAAGG - Intergenic
1181945773 22:26516390-26516412 AATGAATAAATGAATGATGAAGG - Intergenic
1182130993 22:27850622-27850644 ATTTGGTAAATGAATGAAACAGG + Intergenic
1182931393 22:34177500-34177522 ATTAAGTAAATGAAGGAGGGAGG - Intergenic
1183667135 22:39252578-39252600 AGCTAGCAAATGAATGAAGGGGG + Intergenic
1184059140 22:42071328-42071350 ACTTGATGAATGAATGAAGAAGG - Intergenic
1184637228 22:45842710-45842732 ATTTGTTGAATGAATGAACAAGG - Intronic
949144284 3:677513-677535 ATTCAGGAAGTGAATGAATATGG - Intergenic
949630114 3:5916928-5916950 AATTACTAAATGAATAAATATGG - Intergenic
949825122 3:8157047-8157069 AATAAGTAAATGAATAAAGTGGG + Intergenic
949996913 3:9625210-9625232 ATTACGTTAATGAAAGAAGAAGG - Intergenic
950832336 3:15887176-15887198 TTATAGTAAATGCAAGAAGAGGG + Intergenic
951074496 3:18373150-18373172 CTTTAGAAAGTGAATGAAGAAGG + Intronic
951106459 3:18749498-18749520 AATGAATAAATGAATGAAGTGGG - Intergenic
951143577 3:19198204-19198226 AATTAATAAATGAATAAAGAGGG + Intronic
951816524 3:26761190-26761212 ATTTAGCACAAGAATGAAAATGG + Intergenic
951878341 3:27454138-27454160 TTTTATTAAATAAATGGAGATGG - Intronic
952315840 3:32231624-32231646 ATTTATTGAAGGAATGGAGAGGG + Intergenic
952330375 3:32359260-32359282 AATTTGTAAATGAATGAGCATGG + Intronic
952560174 3:34583342-34583364 ATTTAATAAACGCATGAATAAGG - Intergenic
952905663 3:38137907-38137929 AATGAGTAAATGAATGAACCAGG + Intergenic
953369891 3:42378439-42378461 CTTTAGTAAGTGACTCAAGAAGG - Intergenic
953550961 3:43902441-43902463 ATTAAGTAGATCAAGGAAGAGGG - Intergenic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954550686 3:51479111-51479133 ATTTAATAAATGTGTCAAGATGG - Intronic
955091643 3:55757674-55757696 ATTCAGTAAATTAATGGAGTAGG + Intronic
955142269 3:56281086-56281108 ATTTAGAAAATGACTGGGGAAGG - Intronic
955454640 3:59106364-59106386 ATTAAATAAAAGCATGAAGAAGG + Intergenic
955811499 3:62795597-62795619 ATTGAGTGAATGAATGAATGAGG - Intronic
956338946 3:68198025-68198047 ATTTAATGAATGAATGAATTGGG + Intronic
957261754 3:77910730-77910752 ACTAAGTAAATAAATGTAGAAGG + Intergenic
957314796 3:78563463-78563485 ATTACATAAATGAATGAAGTAGG - Intergenic
957459596 3:80499104-80499126 GTTTAAAAAATGAATGAAGATGG - Intergenic
958529234 3:95304181-95304203 ATTTATTACATGACTCAAGAAGG - Intergenic
958819909 3:98961552-98961574 ACTTAGTAAATAAATGGGGAGGG + Intergenic
959203269 3:103275076-103275098 AACTAATAAATGAATCAAGAAGG - Intergenic
959259877 3:104063857-104063879 ATGTGGTAAATGTATGAAAATGG + Intergenic
959514812 3:107253145-107253167 ATTTTGTAAGTGAATAAAGCAGG - Intergenic
959780342 3:110224460-110224482 ATTTAATAAATAAATAAACATGG + Intergenic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960258285 3:115534077-115534099 ATGTGTTGAATGAATGAAGAAGG - Intergenic
960302196 3:116016692-116016714 AATTTGTAAATGAATGAGCATGG + Intronic
961763380 3:129188622-129188644 ATAAAGTAAAGGAATAAAGAAGG + Intergenic
961953865 3:130779870-130779892 TTTCAGCAAATAAATGAAGAAGG + Intergenic
962076796 3:132090679-132090701 ATTTAATAAATATATGCAGAAGG + Intronic
962211160 3:133479385-133479407 ATTTAGTATGTGAATTGAGATGG - Intergenic
962537959 3:136348176-136348198 ATTTATTAGAAGCATGAAGAAGG + Intronic
962701555 3:138005120-138005142 TTCTAGTAAATCAATGAGGAAGG + Intronic
963328689 3:143890359-143890381 AGTTACTAAATGAATGAGTATGG + Intergenic
963340608 3:144027957-144027979 ATTTGTTGAATGAATGAAGGAGG - Intronic
963610087 3:147456236-147456258 TCTTAGCATATGAATGAAGATGG + Intronic
963864331 3:150344135-150344157 ATTTGCTGAATGAATGAAGAAGG + Intergenic
963864940 3:150350433-150350455 AGTTACTGAAAGAATGAAGATGG + Intergenic
964008851 3:151865364-151865386 ATTTAGCAAATCAATAAAAAGGG + Intergenic
964074759 3:152680366-152680388 ATTTAGGAAATAAAATAAGAAGG - Intergenic
964293283 3:155205527-155205549 ATTTAGTGATTGACTGAATACGG - Intergenic
964653286 3:159036297-159036319 ACTCAGTATATAAATGAAGATGG - Intronic
964845677 3:161041982-161042004 AATAAGTAAATGAATGAGAACGG - Intronic
965045997 3:163577288-163577310 ATTTAATAACTGGATGACGAGGG - Intergenic
965298580 3:166979950-166979972 ATGGAATAAATGAATGAATAAGG + Intergenic
965651771 3:170941322-170941344 ATTAAGTAAATGGATGATGCAGG + Intergenic
966031948 3:175360453-175360475 ATTTAGGAAAAGAAGCAAGAGGG - Intronic
966315263 3:178637609-178637631 ATTCAGTAAATGAATGTAAATGG + Intronic
966471331 3:180292549-180292571 TTTTAGTAAAAGTATGAAGAAGG - Intergenic
966499520 3:180623655-180623677 ATTTTTGAAATGAATGAAAATGG - Intronic
967033053 3:185626405-185626427 AACAAGTAAATGGATGAAGAGGG - Intronic
967076050 3:186003156-186003178 ACTATGTAAGTGAATGAAGAGGG + Intergenic
967699308 3:192572931-192572953 ATTTAGTAAATGTTAGAAAAAGG + Intronic
967875138 3:194263658-194263680 AATATGTAAATGAATGAACATGG - Intergenic
969540419 4:7785093-7785115 AGTTAGCAGATGAATGAAGGAGG - Intronic
969560599 4:7944940-7944962 AATTAGTAAATGAATAAACTCGG + Intergenic
970420349 4:15900118-15900140 AGGAAGAAAATGAATGAAGAAGG - Intergenic
970800875 4:19972231-19972253 ATTAAGGAAGTGAATGAAGCAGG - Intergenic
970821747 4:20224469-20224491 GTTTAGTAAATGTGTAAAGAAGG - Intergenic
971117630 4:23666390-23666412 TTTTATTTAATGAATGAAGGAGG + Intergenic
971572000 4:28224846-28224868 ATTTAGAAAATGAAGGAGAATGG - Intergenic
971788748 4:31139787-31139809 ATTTAGAAAAATAATCAAGAAGG - Intronic
972704016 4:41523365-41523387 AATATGTAAATGAATGAGGATGG + Intronic
972848605 4:43020366-43020388 ATTTTGTCAATGAATGAATCAGG + Exonic
972850854 4:43048639-43048661 ATTTAATATATGAATCAAGGAGG + Intergenic
972906263 4:43751731-43751753 CTTTAGTAAATGGATGAAAATGG - Intergenic
973115462 4:46452033-46452055 TTTTAGTAATTGAATTGAGAGGG + Intronic
973262601 4:48179912-48179934 ATTTACTAAATACATGCAGATGG - Intronic
973282122 4:48370154-48370176 ATTAAGTAAATGATAGAACAGGG - Intronic
973619314 4:52711865-52711887 ACTCTGTAAATGAATAAAGAGGG + Intergenic
974133042 4:57779934-57779956 ATTTATTAAATGAATGAACGAGG - Intergenic
974237489 4:59200552-59200574 ATTTGGTAGATGAGTGAAGTAGG + Intergenic
974315598 4:60275864-60275886 ATTCATTGAATCAATGAAGATGG + Intergenic
974506370 4:62778936-62778958 AATAAATAAATGAATGAAAAAGG + Intergenic
974525043 4:63040325-63040347 ATTTAGTAAATTAATAAATGGGG - Intergenic
974884663 4:67803803-67803825 TTTTGGTCAATGAAGGAAGAAGG - Intergenic
974918671 4:68209012-68209034 ATTTAGTAAAGGAATGCAAGAGG + Intergenic
974928774 4:68336418-68336440 ATTGAAGAAATGACTGAAGATGG + Intronic
975156768 4:71080973-71080995 TTTTAGTAAAGGAAGGAAGCAGG - Intergenic
975346941 4:73302403-73302425 ATTTATTGAATGAATGAATTTGG + Intergenic
975422863 4:74189939-74189961 ACCTGGTAAATGAATGATGAGGG - Intronic
975437367 4:74368401-74368423 ATTAAGTAAAGCAATAAAGAGGG + Intronic
975786891 4:77900007-77900029 ATTTTGTAGATGAATAAATAAGG - Intronic
976486520 4:85611872-85611894 ATTAAATATCTGAATGAAGAAGG - Intronic
976535705 4:86213460-86213482 ATTTAGTAAGATAAAGAAGAAGG + Intronic
977165569 4:93691958-93691980 ATTTGTTGAATGAATGAATATGG - Intronic
977282191 4:95054756-95054778 ATTTAGTAAAGTTATAAAGATGG + Intronic
977404920 4:96585137-96585159 ATTCAGTGAATAAACGAAGATGG + Intergenic
977639541 4:99341050-99341072 ATGTAATAAATCAATGAAAAAGG - Intronic
977779803 4:100967439-100967461 ATTTACAAAATGAAAAAAGATGG - Intergenic
977800700 4:101227334-101227356 ATTTAGTATATAAAACAAGAGGG - Intronic
977966865 4:103162032-103162054 AATTAATACATGAATGAATAAGG + Intronic
978263255 4:106789280-106789302 ATTTGGGAAATGAGTGAAGCAGG + Intergenic
978468925 4:109040179-109040201 ACTTATTTAATGACTGAAGAAGG + Intronic
978608416 4:110508487-110508509 TTTTTATAAAAGAATGAAGAGGG - Intronic
978688142 4:111473851-111473873 AGTTAGTTAATGAAAGAAAATGG + Intergenic
978957938 4:114637892-114637914 ATTTTGCAAATGAATAAAGTGGG - Intronic
979383919 4:120041589-120041611 ATTTCATAATTTAATGAAGAAGG + Intergenic
979409065 4:120352204-120352226 ATATACTAAATGTATGAACAGGG - Intergenic
979427609 4:120586717-120586739 ATTAAAAAAATGAATGAATAAGG + Intergenic
979613623 4:122717148-122717170 ATTTGTTAAATGAATGAAAGAGG - Intergenic
979829536 4:125282261-125282283 GATAAGTAAATGTATGAAGAAGG + Intergenic
980091571 4:128448270-128448292 AATGAATAAATGAATGAAAAGGG + Intergenic
980098332 4:128516556-128516578 ATTTACTGAATGGTTGAAGAAGG - Intergenic
980236537 4:130114367-130114389 AGTTAATAAATTAATAAAGATGG - Intergenic
980678481 4:136123601-136123623 ATTTAGTAGAGGAATGACTAGGG - Intergenic
980742371 4:136969259-136969281 AGTGAGAAAATGAATAAAGAGGG - Intergenic
980743359 4:136981135-136981157 TTTAAGTAAATGAATAAAGATGG + Intergenic
981317476 4:143354090-143354112 ATTGAGTAAATGGAAGAAGCTGG - Intronic
981818521 4:148859221-148859243 ATGTTGAAAATGAATGATGATGG + Intergenic
982038044 4:151365800-151365822 AATTAGAAAATGAATCAATATGG - Intergenic
982174909 4:152696693-152696715 ATTTAGGAAATCAAAGAAGTTGG + Intronic
982407943 4:155041534-155041556 ATTTATTAAATGAATGAATGTGG - Intergenic
983119742 4:163867242-163867264 GTTTAAAAAATGGATGAAGAAGG - Intronic
983229813 4:165117758-165117780 ATTTATTTATTGAATAAAGATGG + Intronic
983822136 4:172207992-172208014 TTTAAGTCAATGAAAGAAGACGG + Intronic
984078300 4:175211330-175211352 ATTGAATAAATGAATAAAAATGG + Intergenic
984416469 4:179466143-179466165 ATTTATTAAAGGATTCAAGATGG + Intergenic
984712480 4:182897474-182897496 ATTTATCAAATGAATAAAGGAGG - Intronic
984842048 4:184077767-184077789 CTTTAGTATATGCCTGAAGAGGG + Intergenic
985047773 4:185957686-185957708 ATTTAGAAAAAGAAAGCAGATGG + Intergenic
985143234 4:186864408-186864430 AATGAATAAATGAATGAACATGG + Intergenic
985327868 4:188793332-188793354 ATTTTTTAAATGTATGGAGAAGG - Intergenic
985385777 4:189446747-189446769 ATTTGTTGAATGAATGAAGTGGG - Intergenic
986637541 5:9837688-9837710 ATTTGTTAAAGAAATGAAGAAGG - Intergenic
986794977 5:11201272-11201294 ATTTGTCAAATGAATGGAGAGGG + Intronic
987098547 5:14571980-14572002 AATTTGTAAATGAATGAACATGG - Intergenic
987186713 5:15428546-15428568 ATTTAGAAAAAGAATAAAGTAGG - Intergenic
987435735 5:17891946-17891968 AGTGAGCAAATGACTGAAGACGG - Intergenic
987536753 5:19199645-19199667 ATTTAAAAAAGGAATGGAGAGGG + Intergenic
988088304 5:26500997-26501019 ATTTAGTAAGTGGATGGAGTAGG - Intergenic
988166502 5:27596770-27596792 ATTTTGTCAATGAATGACCAAGG - Intergenic
988198220 5:28035180-28035202 TTTTGGTAAATGAGTGAATATGG - Intergenic
988484038 5:31653689-31653711 ATTTACTGAATGAATGAATTGGG - Intronic
989210493 5:38854673-38854695 ATTTGATAAATGAATAAAAATGG - Intronic
989234663 5:39132509-39132531 ATTTAGTAAAAGCAGGAAGTTGG - Intronic
989236153 5:39150680-39150702 ATTTAGTGTATGAAGGAAAATGG - Intronic
989702654 5:44288759-44288781 AAACAGTAAATGAATGAAAAAGG - Intergenic
989771147 5:45147269-45147291 AATGAGTGAATGAATGAATAAGG + Intergenic
989984621 5:50683383-50683405 ATTTGTAAAATGAATGAATAAGG - Intronic
990161859 5:52949903-52949925 ATTCAGGAAAGGAAGGAAGAAGG - Intronic
990392001 5:55332701-55332723 AATTAGTATATTCATGAAGATGG + Intronic
990454009 5:55966813-55966835 ACTTAGTAAATAAAGGAATAAGG + Intronic
990473569 5:56140598-56140620 ATTGAGTAAATAAATGAACGAGG + Intronic
992161733 5:74011005-74011027 AATGAATAAATGAAGGAAGAAGG + Intergenic
992587892 5:78260231-78260253 ATTTAGGAAGAGAATGTAGATGG - Intronic
992660619 5:78957243-78957265 ATCTCATAAATGAATGAAAATGG + Intronic
992710974 5:79455699-79455721 TTTTAGCAATTAAATGAAGAAGG - Intronic
992985841 5:82228590-82228612 ATTTTTTAAGTGAATGATGATGG + Intronic
993262193 5:85672787-85672809 TTTCTGTACATGAATGAAGAAGG - Intergenic
993374379 5:87132642-87132664 ACTTAGGAAATGATTGAATATGG + Intergenic
993382890 5:87228205-87228227 TTTTAGAAAATGGATGAATAAGG + Intergenic
993639604 5:90386392-90386414 CTTGAATAAATGAATAAAGAAGG + Intergenic
993680378 5:90870668-90870690 AGTTTGTCAATGAAAGAAGAAGG + Intronic
993725769 5:91364931-91364953 ATGAAATAAATGAATGAATATGG - Intergenic
993852930 5:93033826-93033848 ATTTGGTAAATGAGAGAAAAAGG - Intergenic
994332745 5:98526506-98526528 ATTTAATAAGTGAATAAAGGGGG + Intergenic
994952133 5:106477050-106477072 ATTAAATAAATCAATGGAGAAGG + Intergenic
996167574 5:120244138-120244160 ATTTAGTAAATGCATACTGATGG - Intergenic
996450705 5:123620481-123620503 AATGTGTAAATGAATGAACATGG + Intergenic
996593986 5:125180296-125180318 AATAAATAAATGAATGAATACGG - Intergenic
996659025 5:125977435-125977457 ATTGTGGAAATGAATGCAGAAGG + Intergenic
996757998 5:126955134-126955156 ATTTGTTGAATGAATGAATATGG - Intronic
997905990 5:137817751-137817773 ATTTATTGATTGAATGAAGCAGG - Intergenic
998351862 5:141507363-141507385 ATTTAGTAAATAAAAGTACAGGG - Intronic
998651995 5:144131190-144131212 CTTTGGAAAATGAAGGAAGAAGG + Intergenic
998748709 5:145292543-145292565 ATTTGGTAAGTGAAAGATGATGG + Intergenic
998814196 5:145995586-145995608 AGTTAGAAAATGAATGAAGTTGG - Intronic
998948729 5:147369686-147369708 ATTTAATAAATGACTGTTGATGG - Intronic
998951624 5:147398275-147398297 ATTGAGTAAATGAAGGAGGTAGG - Intronic
998966085 5:147541774-147541796 ATATAGAAAATGAATAAACAAGG + Intergenic
999001515 5:147928867-147928889 AAATAGAAAATGAATGAAAAGGG + Intergenic
999475041 5:151890720-151890742 CTATAGTATATGAATGAAGCAGG - Intronic
999699626 5:154216738-154216760 ATTTAATAAATAAATAATGATGG - Intronic
1000728845 5:164805660-164805682 AACTAATAAATGAATGAGGATGG + Intergenic
1000774674 5:165404328-165404350 ATTGAGTACCTAAATGAAGATGG + Intergenic
1001585749 5:172833105-172833127 AATGAGTGAATGAATGAAAAGGG + Intergenic
1001627397 5:173147545-173147567 AGGTAGTGAATGAATGAATAGGG - Intronic
1001918590 5:175582516-175582538 ATTGAGGAAATGAAGGATGATGG - Intergenic
1002393269 5:178933117-178933139 ATTTGGTAAATGAATGATTTTGG + Exonic
1002909657 6:1480114-1480136 ATTAAATGAATGAGTGAAGATGG - Intergenic
1003343206 6:5241740-5241762 ATTTGTTAATTGAATGAATATGG + Intronic
1003376534 6:5583413-5583435 ATTTATAAAATGAATAAAGACGG + Intronic
1003577577 6:7312559-7312581 TTTTGGCAAATGAATGAAGACGG + Intronic
1003731178 6:8826370-8826392 CTTCAGTAAATGGAGGAAGATGG - Intergenic
1003861781 6:10328833-10328855 TTTCAGTAAATGAAGCAAGAGGG - Intergenic
1004062065 6:12207324-12207346 ATTTAAAAAATGAATAAAGATGG - Intergenic
1004492781 6:16131861-16131883 ATTTTGTTTCTGAATGAAGATGG + Intronic
1004940328 6:20549964-20549986 ATTTAATTAATTAATTAAGATGG - Intronic
1005233245 6:23729211-23729233 ATATAGAAAATGTATCAAGATGG + Intergenic
1005702934 6:28421420-28421442 CTTTATTAAATGAAGAAAGAAGG + Intergenic
1005706252 6:28456609-28456631 ATTATGCAAAAGAATGAAGAAGG + Intergenic
1006044730 6:31285037-31285059 ATTCAGATAATAAATGAAGAAGG - Intronic
1007291931 6:40794119-40794141 GTTTATTAAATGAATGAACCAGG - Intergenic
1007604921 6:43110767-43110789 TTTAAGTAAATGACAGAAGAGGG - Intronic
1008020717 6:46574736-46574758 ATTTTGTAAATAAAGGAAAAGGG + Intronic
1008161527 6:48082206-48082228 AGTCAGGAAATGAATGAAGAAGG + Intergenic
1008229403 6:48965846-48965868 ATTTAGTGAAAGAATGGGGAGGG + Intergenic
1008275981 6:49544835-49544857 ATTTAGTAAAGGAAAGAAAGTGG - Intergenic
1008383886 6:50865172-50865194 ATTTTGTATGTGAAAGAAGAGGG + Intergenic
1008396670 6:51016797-51016819 TTGAAGTAAATGAATTAAGATGG + Intergenic
1008877744 6:56348098-56348120 AATAAATGAATGAATGAAGAGGG - Intronic
1009483352 6:64189441-64189463 AATATGTAAATGAATGAACATGG - Intronic
1010106040 6:72169435-72169457 ATTTAATAAAAGAGTAAAGAAGG + Intronic
1010118689 6:72346808-72346830 AACATGTAAATGAATGAAGATGG - Intronic
1010160759 6:72851679-72851701 TTTATGTAAATGAATGTAGAGGG - Intronic
1010582757 6:77619745-77619767 ATTTGGTACATGAAGGGAGATGG - Intergenic
1010922328 6:81698287-81698309 ATTTACAAAATTAATGAAAAGGG - Intronic
1010942292 6:81933043-81933065 ATTTAGGAAATGAGGTAAGAAGG - Intergenic
1011031547 6:82929658-82929680 TTTTAGCAATTGGATGAAGAAGG - Intronic
1011424973 6:87217691-87217713 TTTAAGTAACTGAATGTAGAGGG - Intronic
1011717933 6:90126462-90126484 ATTTAGTTACGGGATGAAGAGGG + Intronic
1011890187 6:92149375-92149397 TTTTAGTAAATTATTGAGGAAGG + Intergenic
1011938947 6:92818342-92818364 ATTTAAGAAATGAGGGAAGACGG - Intergenic
1012076098 6:94688585-94688607 ATTTATTAAATCAAAGAATAAGG - Intergenic
1012116278 6:95302618-95302640 ATCTAGTGAAAGAATGAATATGG + Intergenic
1012647619 6:101707052-101707074 ATTAGGTAAGAGAATGAAGATGG + Intronic
1012877896 6:104751081-104751103 ATTGAGTGAATGAATGAACTAGG - Intronic
1012888988 6:104877754-104877776 ATGTAGTCAATGAATGAAACAGG + Intergenic
1013205145 6:107938149-107938171 TTTTTGTAAATGGATGATGATGG - Intronic
1013218146 6:108049730-108049752 ATTTTGTAAATGAATAAAACAGG - Intronic
1013726241 6:113099672-113099694 TTTTAGAAAATAAAAGAAGAGGG + Intergenic
1014016090 6:116531800-116531822 ATTTATTATATGAGTGTAGAAGG - Intronic
1014145087 6:117988193-117988215 ATTTATTAAGTGAATGAACTTGG + Intronic
1014154415 6:118094190-118094212 CTTGAGTAAATGAGAGAAGATGG + Intronic
1014362356 6:120495298-120495320 ATTTAGTTAATTAATGATCATGG + Intergenic
1014605587 6:123470108-123470130 ATTTAATAAATAAAAGAATAAGG - Intronic
1014747483 6:125217016-125217038 ATTTAATAAACAAATGAAAATGG - Intronic
1015114083 6:129627590-129627612 CTTTAATAAATTAATGAGGAGGG + Intronic
1015296349 6:131597774-131597796 ACTTATTAAATGAATGAATAAGG + Intronic
1015444576 6:133288197-133288219 ATTAAGTAAATGAATGGGCATGG + Intronic
1016884245 6:148944123-148944145 ATTTATTAGAGGAATGAAGGGGG + Intronic
1017329204 6:153175978-153176000 ATTTAGTGAATGATTAAATAGGG + Intergenic
1017467931 6:154712211-154712233 ATTAAGTAAATGGAGGATGAGGG - Intergenic
1017751761 6:157495316-157495338 ATTTGTTAAATGAATGAAACAGG - Intronic
1017809113 6:157971595-157971617 TTTTAGCTACTGAATGAAGAAGG + Intergenic
1018424436 6:163667607-163667629 ATATATTAAATGAATGAATAGGG - Intergenic
1019503132 7:1375542-1375564 GTTTATTAAATGAATGAAAGAGG + Intergenic
1020986027 7:15135496-15135518 GCTTAGAAAATGAATGAAAAGGG + Intergenic
1021333214 7:19365206-19365228 ATTTAGTAAATGAAGGACCGAGG - Intergenic
1021352907 7:19617175-19617197 ATTAAGAAAATTATTGAAGAGGG - Intergenic
1021526415 7:21593578-21593600 ATTTAGTAAATACCTGTAGAAGG + Intronic
1022021707 7:26405978-26406000 ATTTATTGAATTATTGAAGAAGG + Intergenic
1022412176 7:30147912-30147934 ATTTATTGAATGAATGAATGTGG - Intronic
1023453332 7:40311836-40311858 TTTTAACAAATGAATGAAAATGG - Intronic
1023461435 7:40401805-40401827 ATTTAGTATTTGAACAAAGAAGG + Intronic
1023580421 7:41676267-41676289 ATTTTGTATATAATTGAAGAAGG - Intergenic
1023652275 7:42384293-42384315 TATTAGGAAATTAATGAAGAGGG + Intergenic
1024114624 7:46180942-46180964 ATTTTGTAAATTAATGAAGTTGG + Intergenic
1024924119 7:54594673-54594695 ATTCCGTGAATGAATGAAGTTGG + Intergenic
1025070801 7:55897047-55897069 ATCTAATAAATAAATGAATAGGG + Intronic
1025705824 7:63862058-63862080 ATTTGAGAAATGTATGAAGAAGG - Intergenic
1026003930 7:66585499-66585521 ATTTGGTGAATGAGTGCAGAGGG - Intergenic
1026344582 7:69463152-69463174 ATTTAGTAAGTCAAGAAAGAGGG + Intergenic
1026437592 7:70413334-70413356 ATTCAGTAAATGATTGCTGAAGG + Intronic
1026500755 7:70941569-70941591 ATTTAGAAAAAAAAAGAAGAAGG + Intergenic
1026718765 7:72813030-72813052 AATATGTAAATGAATGAATATGG - Intronic
1027636362 7:80680293-80680315 ATATAGAAAGTGAATGAGGAAGG + Intergenic
1027693982 7:81385711-81385733 ATTTAGTAAATGTATCAAAATGG + Intergenic
1027966050 7:85009938-85009960 ATCAAGTAAATGAATAAAAAAGG + Intronic
1028155258 7:87422271-87422293 ATTTATGAGAGGAATGAAGAAGG - Intronic
1028161282 7:87488106-87488128 ATTTATTAAACAAATGAAAATGG + Intergenic
1028290343 7:89057495-89057517 AGTTTTTAAATAAATGAAGAGGG - Intronic
1029377217 7:100186385-100186407 ATTTCCTAAATAAAGGAAGATGG + Intronic
1029870569 7:103687569-103687591 GGTTTGTTAATGAATGAAGATGG - Intronic
1030565307 7:111146718-111146740 ATTAAGTTAATGGATGAAAAAGG + Intronic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031132310 7:117846765-117846787 ATTTAACTAAGGAATGAAGATGG - Intronic
1031279423 7:119778461-119778483 ATTTGGTAAATGAATGGGGGAGG + Intergenic
1031396111 7:121276403-121276425 ATTTAGTAAAAGAATAAACAAGG - Intronic
1031561003 7:123238089-123238111 ATTCAGTATATGAATGATTAAGG - Intergenic
1031577624 7:123435090-123435112 AGTGAGTAAATGAATGAATGAGG + Intergenic
1031653207 7:124317509-124317531 ATTTAGTAAATGAATGCATAAGG + Intergenic
1031806565 7:126315039-126315061 ATTCAGTAAATGAATAAAACAGG - Intergenic
1032651779 7:133886390-133886412 ATTTAATCAGTGAATGAATAAGG - Intronic
1032750002 7:134829907-134829929 ATTTAGTAATTTACTGTAGAGGG + Intronic
1032945279 7:136844868-136844890 ATTTAGTAAATAAAAATAGAAGG + Intergenic
1033061361 7:138111519-138111541 TTTCAGTAAATGTTTGAAGAAGG - Intronic
1033148762 7:138894560-138894582 ATCTAGTGCATGAGTGAAGAAGG - Intronic
1033390841 7:140925520-140925542 ATTTGTTAAATGAATGAATCTGG - Intergenic
1033429186 7:141273403-141273425 ATTTAATTGATGAATAAAGATGG - Intronic
1033900871 7:146137489-146137511 ATTTAGGACTTGAAAGAAGAAGG + Intronic
1033907794 7:146226988-146227010 TTATACTAAATGAATGAAAAAGG + Intronic
1034747155 7:153532965-153532987 TCTGACTAAATGAATGAAGATGG + Intergenic
1035208468 7:157310229-157310251 ATTTGGGAAATGAATGAGGCTGG + Intergenic
1035429757 7:158810376-158810398 ATCTAGTAAGTGAAAGAAGTGGG + Intronic
1036911119 8:12757775-12757797 TTTTAGGAAATGAACGAAGAAGG - Intergenic
1037338885 8:17820712-17820734 ATTGAGTAAGGGAATGAAGACGG - Intergenic
1037406713 8:18550122-18550144 TTTCAGTAAATGATTGATGAAGG + Intronic
1037512817 8:19600872-19600894 ATTTGTTAAATGAAGGAGGAAGG + Intronic
1037867465 8:22457314-22457336 AATAAATAAATAAATGAAGATGG - Intronic
1038008057 8:23450979-23451001 ATTTGGAAGATGAAGGAAGAGGG - Intronic
1038151720 8:24947361-24947383 ACAGAATAAATGAATGAAGAAGG - Intergenic
1038607546 8:29023744-29023766 TTTTAATAAGTGAATCAAGAAGG - Intronic
1039617022 8:38963917-38963939 ATTTAGTAATTTAGTGAAGACGG - Intronic
1041127288 8:54656296-54656318 GTTGAGTAAATGAATGATTAAGG + Intergenic
1041487494 8:58395130-58395152 TGTTAGAAAATGAATGAAAACGG + Intergenic
1041856119 8:62457082-62457104 ATTTATTGAATGAATAAAGATGG + Intronic
1042210444 8:66375501-66375523 ATTTGTTGAATGAATGAATATGG - Intergenic
1042287524 8:67130453-67130475 TTTGTGTAAATGAATAAAGAAGG - Intronic
1042448481 8:68917302-68917324 ATTTAGTAAATGAATAAAAATGG + Intergenic
1042594071 8:70426741-70426763 AATGAGTGAATGAATGAATATGG + Intergenic
1042822435 8:72945173-72945195 ATTCAGTGAATGCATAAAGAAGG + Intergenic
1043178652 8:77054906-77054928 ATTTGGTAAATTAATGAATTGGG + Intergenic
1043320166 8:78974667-78974689 CAATAGTAAATGAATGAACATGG - Intergenic
1043485721 8:80697308-80697330 ATTTAAGAAATGAGTGAAAATGG + Intronic
1043539196 8:81240255-81240277 ATTTTGTAAATGAAGAAATAAGG - Intergenic
1043792536 8:84490630-84490652 ATTTATTAAAGGAAGGAAGTGGG + Intronic
1044670019 8:94670167-94670189 ACTTATTAAATAAATCAAGAAGG - Intronic
1045238064 8:100373755-100373777 ATTTGGGAAAAGAGTGAAGAAGG + Intronic
1045770544 8:105733630-105733652 TTTTAGTAAATGAACGATAAAGG + Intronic
1045783365 8:105894578-105894600 ATTGAATAAATAAATGTAGAAGG + Intergenic
1045784691 8:105907110-105907132 TTTTGGTGAATGAATGAATATGG - Intergenic
1045823252 8:106366903-106366925 ATGTAATACATGAAAGAAGATGG - Intronic
1046000225 8:108412077-108412099 ATTTATTAAATGTATGAGGCCGG + Intronic
1046717699 8:117585539-117585561 ATTTGGTAAATGGATGAAACAGG + Intergenic
1047635603 8:126758868-126758890 ATTTATCAAATAAATGAAAAAGG - Intergenic
1047905382 8:129467521-129467543 ATTTATTAAATAAGTGAATATGG - Intergenic
1047912058 8:129540912-129540934 ACTTAGTAAATAAGTGATGAAGG + Intergenic
1048051053 8:130816723-130816745 TTTTAATAAATTAATTAAGAAGG - Intronic
1048123414 8:131607003-131607025 ATATAGTAAATGATTAAGGAAGG - Intergenic
1048539744 8:135331901-135331923 AATTAGTAAAAGAATTTAGATGG - Intergenic
1048850246 8:138638391-138638413 ATCTAGTAAATAAAGGATGAGGG + Intronic
1050315255 9:4395144-4395166 AATTTGTAAATGTATGAACATGG - Intergenic
1051048782 9:12907054-12907076 ATTTAGCACATGAATGATAAGGG + Intergenic
1051293714 9:15572856-15572878 ATTGAATAAATGTATGAAAAGGG + Intronic
1051488732 9:17637265-17637287 AGTGAGTAAAGGAATGAAAATGG + Intronic
1051608713 9:18941334-18941356 ACTGCGTAAATGAATGAATATGG + Intronic
1052211236 9:25905880-25905902 ATTTGGTAAATGAACTAAAATGG - Intergenic
1052394904 9:27927257-27927279 ATTTAATAGATGAAGGAGGAAGG + Intergenic
1052699363 9:31919726-31919748 ATTCAGTAAATAAATGAAAAGGG + Intergenic
1052989217 9:34508990-34509012 AATGAGTAAGTGAATGAATAAGG - Intronic
1053341334 9:37336866-37336888 ATTTAGTACATGGATGGAGAAGG - Intronic
1053360095 9:37479602-37479624 TTATACTATATGAATGAAGATGG + Intergenic
1055040452 9:71865327-71865349 AATTTGTAAATGAATGAATATGG - Intronic
1055590683 9:77810352-77810374 ACTTAGTAAGTGAATGGAGGAGG - Intronic
1056726628 9:89124897-89124919 ATTTATTAATTGAGTGATGAGGG - Intronic
1056728917 9:89147197-89147219 ATTTACTGAATGAATGGTGAGGG - Intronic
1056937949 9:90932152-90932174 ATTCAGGAACAGAATGAAGAGGG + Intergenic
1057630709 9:96716877-96716899 ATTTAGTAAAAGAATGTTGCTGG + Intergenic
1057849940 9:98557386-98557408 GTTGAATAAATGAATGCAGAGGG + Intronic
1058329850 9:103746394-103746416 AATTAGAAAATGGATGAAAATGG + Intergenic
1058489676 9:105483680-105483702 ATTTACTAGATGAATGTGGAGGG - Intronic
1058565657 9:106282277-106282299 AATTAATAAATGAATAAACAGGG - Intergenic
1058691323 9:107523036-107523058 GTTGAATAAATGAATGAATATGG + Intergenic
1058917089 9:109578053-109578075 ATTTTTTAAAAGAATTAAGAAGG + Intergenic
1058978915 9:110151171-110151193 AGTAAGTAAATGAATACAGAAGG - Intronic
1058978918 9:110151209-110151231 AGTAAGTAAATGAATACAGAAGG - Intronic
1059197841 9:112387550-112387572 ATTTAGTAGTTGAATAAACATGG + Intronic
1059203063 9:112436476-112436498 ATTTGTTAAATGAATGAAAAAGG + Intronic
1059664716 9:116435665-116435687 GTTTAGAAACAGAATGAAGAAGG - Intronic
1059701560 9:116779824-116779846 ATTTAAAAAATGAATGAAAATGG - Intronic
1060508929 9:124218223-124218245 AATGAGTGAATGAATGAATATGG + Intergenic
1061124326 9:128664418-128664440 ATTGTTTAAATGAATGAATATGG + Intergenic
1061206863 9:129169328-129169350 ATTTACTGAATGAATGAAACAGG + Intergenic
1185721521 X:2386008-2386030 AATAAGTAAATGAATGTATATGG + Intronic
1186709133 X:12174190-12174212 AATTTGTAAATGAATGAGTATGG + Intronic
1186830127 X:13381893-13381915 ATTTAGTATATGAAGAAAAAAGG + Intergenic
1186858531 X:13648723-13648745 ATTTAGTGGAGGAATGATGAAGG - Intergenic
1186887924 X:13933311-13933333 AATTATTAAATGGATGATGATGG + Intronic
1186927722 X:14353505-14353527 AGTACGTAAATGAATGAACATGG - Intergenic
1186955766 X:14680079-14680101 AATATGTAAATGAATGAATATGG + Intronic
1187019496 X:15365538-15365560 AATAAGTAAATGAATGGACATGG - Intronic
1187078403 X:15959742-15959764 AGATAATAAATGAAAGAAGAAGG + Intergenic
1187254691 X:17631542-17631564 ATTAAATAACTGAATGAAGGTGG + Intronic
1187421327 X:19136439-19136461 AATATGTGAATGAATGAAGAAGG + Intergenic
1187457041 X:19450698-19450720 AGTTAGTAAATAAAGGAGGAAGG + Intronic
1187497278 X:19806100-19806122 ATTAAGTACATGACTGGAGAGGG - Intronic
1187659425 X:21523863-21523885 AATGACTAAATGAATGAAAAAGG - Intronic
1187660439 X:21540871-21540893 ATTTAGAATATGAATGTACAAGG - Intronic
1188447390 X:30270081-30270103 ATGTATTAAATAAATGAAAATGG - Intergenic
1188658322 X:32727443-32727465 CTCTAGTAAATGAATTTAGAAGG - Intronic
1189273606 X:39769046-39769068 ATTTGTTGAATGAATGAAGAAGG - Intergenic
1189400930 X:40667863-40667885 ATTTGGTAAATGACCGAACATGG + Intronic
1190850897 X:54240507-54240529 ATGTAGTAACTGGATCAAGATGG + Intronic
1191157780 X:57294492-57294514 ATTTGGGAAAAGAAGGAAGAAGG - Intronic
1192015980 X:67331620-67331642 AATTACAAAATGAATGAAGGTGG + Intergenic
1192596277 X:72411628-72411650 AATGAATAAATGAATGAAAAGGG + Intronic
1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG + Intronic
1193207895 X:78770303-78770325 ATCTGTTAATTGAATGAAGATGG - Intergenic
1193673158 X:84414717-84414739 GTTTAGTAAATGATTGAATGTGG - Intronic
1193825002 X:86214002-86214024 ATTAGGTAAATGATTGAAAATGG - Intronic
1194173005 X:90612007-90612029 ATTTATTAAATGAGTGAATAAGG + Intergenic
1194424054 X:93715293-93715315 GTAAAGTAATTGAATGAAGATGG - Intergenic
1194599346 X:95901309-95901331 ATTTGTTAAATGAATGAATGAGG - Intergenic
1194768339 X:97869700-97869722 ATTTAGGAAAGAAAAGAAGAGGG - Intergenic
1195617576 X:106924934-106924956 TCTTAATAAATGAATGAAGTTGG - Intronic
1196503875 X:116417707-116417729 ATTTTGGAAATAAAAGAAGAAGG - Intergenic
1196552039 X:117040188-117040210 AGTTAGTATATGAATGAAGAAGG - Intergenic
1197194302 X:123682794-123682816 ATTTCTTAAATGAATGAATTTGG + Intronic
1197292510 X:124676310-124676332 ATATACTCAATGAATGGAGATGG + Intronic
1197371694 X:125634766-125634788 ACTTAGTCAATAAATGAAAAGGG - Intergenic
1197388974 X:125837498-125837520 TTTTAGTACTTGAATGAAAATGG - Intergenic
1197604669 X:128571409-128571431 AATAAATGAATGAATGAAGAAGG + Intergenic
1197628045 X:128825219-128825241 ATTTAGTAAATTACAGAACAGGG + Intergenic
1197676153 X:129332837-129332859 AATTATTAAATGAATTAAAATGG - Intergenic
1197690709 X:129497753-129497775 AATAAGTGAATGAATGAATATGG + Intronic
1198126474 X:133649104-133649126 ATTGAATAAATGAATGCAAATGG + Intronic
1198522961 X:137471292-137471314 ATTTGGTGAATGAATGAATTGGG - Intergenic
1198767835 X:140096279-140096301 ATTTATTAAATGAGTGGAGGAGG + Intergenic
1198833966 X:140781799-140781821 AGTAAGTAAATGAATGGGGATGG - Intergenic
1199143647 X:144339379-144339401 GTTTAATAAGTGAAAGAAGAAGG + Intergenic
1199386299 X:147226955-147226977 GTTTAGTAGATGAATGAGAATGG - Intergenic
1199653456 X:149971182-149971204 GTTTAGTGTATGAATGAACATGG + Intergenic
1200312432 X:155091605-155091627 AATTAGACAATGAATGAACATGG - Intronic
1200519230 Y:4189730-4189752 ATTTATTAAATGAGTGAATAAGG + Intergenic
1200821391 Y:7587154-7587176 ATTTAATAAATGAATAAAGCAGG + Intergenic
1200876487 Y:8160918-8160940 ATTTAATAAATGAATAAAGCAGG + Intergenic
1200947066 Y:8853423-8853445 AATTAGAAAATGAAAGAAAAAGG + Intergenic
1201467922 Y:14305127-14305149 ATTTAGTCAAAGAAGGAAAAGGG - Intergenic
1201666314 Y:16460164-16460186 ATTTTTTAAATAAATAAAGATGG - Intergenic
1202065720 Y:20937717-20937739 AGTTAGAAAATCAATGAAAATGG - Intergenic
1202238914 Y:22745597-22745619 ATTTAATAAATGAATAAAGCAGG - Intergenic