ID: 1031046176

View in Genome Browser
Species Human (GRCh38)
Location 7:116890612-116890634
Sequence ACATATATACAAAAATTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152764
Summary {0: 6, 1: 91, 2: 1888, 3: 15560, 4: 135219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031046176 Original CRISPR ACATATATACAAAAATTAGC AGG Intronic
Too many off-targets to display for this crispr