ID: 1031048225

View in Genome Browser
Species Human (GRCh38)
Location 7:116918235-116918257
Sequence TTGACCCCATTAAAAAGAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031048225_1031048227 -1 Left 1031048225 7:116918235-116918257 CCAGTTCTTTTTAATGGGGTCAA 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1031048227 7:116918257-116918279 ATAATGGACATTCTAGTTTAAGG 0: 1
1: 0
2: 0
3: 23
4: 205
1031048225_1031048229 9 Left 1031048225 7:116918235-116918257 CCAGTTCTTTTTAATGGGGTCAA 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1031048229 7:116918267-116918289 TTCTAGTTTAAGGTGGTTGATGG 0: 1
1: 0
2: 1
3: 19
4: 196
1031048225_1031048228 2 Left 1031048225 7:116918235-116918257 CCAGTTCTTTTTAATGGGGTCAA 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1031048228 7:116918260-116918282 ATGGACATTCTAGTTTAAGGTGG 0: 1
1: 1
2: 0
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031048225 Original CRISPR TTGACCCCATTAAAAAGAAC TGG (reversed) Exonic
902616253 1:17625126-17625148 CTGTCCCCATCAAAGAGAACAGG + Intronic
902863449 1:19262010-19262032 TTTACCCCACCCAAAAGAACTGG + Intergenic
904911913 1:33940848-33940870 TTGACATTATTAAAAAGTACAGG - Intronic
905977580 1:42189094-42189116 TTGACCACATTTAAAATAATTGG - Intronic
907136031 1:52140869-52140891 TTGAGCCTAAGAAAAAGAACTGG + Intergenic
908951217 1:69565821-69565843 TTGACTGTATTAAAAAGAACTGG + Intergenic
909935457 1:81545677-81545699 TTATCCCCATTATATAGAACAGG + Intronic
909978828 1:82073818-82073840 TTGAAACCATTAAAGAGAAAAGG - Intergenic
913277574 1:117154037-117154059 TTTACCCCAATAAAAAGTCCAGG - Intronic
915290899 1:154882577-154882599 TTGGTCCCATTAAAAGTAACTGG + Intergenic
916195879 1:162221908-162221930 ATGAGGCCATTAAAAAGAAATGG - Intronic
918028894 1:180783410-180783432 TTGAACCCATCAAAATGAAAAGG - Intronic
920456055 1:206101956-206101978 TGGACCCCATTAAAAATATTTGG - Exonic
920618646 1:207521968-207521990 TAGAAACTATTAAAAAGAACAGG - Intronic
920807808 1:209251478-209251500 TTGATCTCATTAAAAAGCCCAGG - Intergenic
1064510641 10:16086989-16087011 TTGAAGCCATAAAAAAGAATGGG + Intergenic
1066284591 10:33952253-33952275 TTGATTCTATTAAAAAGAAAAGG + Intergenic
1066621250 10:37353836-37353858 CTGAGCACCTTAAAAAGAACAGG + Intronic
1069043093 10:63714510-63714532 TTCACACTATAAAAAAGAACTGG - Intergenic
1071336624 10:84605626-84605648 TTGGCCCTATCAAAGAGAACAGG - Intergenic
1071371327 10:84954516-84954538 TTGTCCCCATTTTAAAGAAGAGG + Intergenic
1073573778 10:104603453-104603475 TTGCCCCCATGGAAAACAACTGG - Intergenic
1073972046 10:109055299-109055321 TTAACCCCTTTAGAAAGAACAGG + Intergenic
1074031048 10:109688419-109688441 TTCACCTCAATAAAAAGAAAAGG - Intergenic
1076894416 10:133302834-133302856 TTGACCTGCTTCAAAAGAACAGG - Exonic
1079477704 11:20848652-20848674 TTGAACCCAGGATAAAGAACAGG + Intronic
1079951242 11:26807784-26807806 TTGGCCCCTTGAAAAAGATCAGG + Intergenic
1080220137 11:29893459-29893481 TTGTCCCCATTAAAAAAAAAAGG + Intergenic
1081120454 11:39259166-39259188 TTGAACTCATGAAAAAGAAAAGG + Intergenic
1082801796 11:57420315-57420337 TTTATCTCATTAAAAAGGACTGG + Intronic
1088916885 11:114234405-114234427 TCTACCCCAGTAAAAGGAACTGG + Intronic
1089100199 11:115956699-115956721 CTGACCCAAGGAAAAAGAACTGG - Intergenic
1091028345 11:132161454-132161476 AGGACACCATGAAAAAGAACAGG - Intronic
1093028296 12:14264713-14264735 GTGATCCCAACAAAAAGAACAGG + Intergenic
1094773375 12:33692411-33692433 TTGAACCAAGTAAAAAGAATGGG - Intergenic
1098175758 12:67789159-67789181 TTGACCCCAGAAATAAGATCTGG - Intergenic
1098750528 12:74287999-74288021 TTGTCCCTATTAATAAAAACTGG - Intergenic
1099324575 12:81197970-81197992 TTGAGTCCATAAAAAACAACTGG + Intronic
1100365457 12:93916170-93916192 TTGAACCCATTAAATATAATAGG + Intergenic
1100758121 12:97774840-97774862 TTGACCACATTAACAGGAAAAGG + Intergenic
1101817298 12:108155119-108155141 TTGTCCCCATTATATAGATCAGG - Intronic
1103124919 12:118413458-118413480 TTGGCCCCATTTTAAAGAAGAGG - Intronic
1103222592 12:119258172-119258194 TTGACCACATCAAGAAGAGCTGG - Intergenic
1104700657 12:130901471-130901493 ATGCTCCCATTAAAAAGAATGGG - Intergenic
1107067054 13:36225751-36225773 ATAACCCCATTAAAAAAAATGGG + Intronic
1108719068 13:53111496-53111518 TTAATCACAATAAAAAGAACAGG + Intergenic
1111315068 13:86544951-86544973 TTGACACCATCACAATGAACTGG + Intergenic
1112828172 13:103416482-103416504 TTGAGAACATTAAAAAGAATGGG - Intergenic
1113627238 13:111856359-111856381 TTGAACGCATTACAAAGCACAGG + Intergenic
1113917938 13:113885445-113885467 TTGAGCCCTTTAAAAATATCAGG + Intergenic
1116142029 14:41009138-41009160 TTGACACTTTTAAAGAGAACAGG + Intergenic
1117592227 14:57282918-57282940 TGGACCTCTTTAAAAAGAAAAGG - Exonic
1117723688 14:58651625-58651647 GGAACCCCATTAAAAAGAATTGG - Intergenic
1119017805 14:71077526-71077548 TTTACTCCATCAATAAGAACAGG + Intronic
1120422640 14:84307738-84307760 TTAACCCCATTAAAAAAAATGGG + Intergenic
1120754838 14:88233152-88233174 TTGACCCCAGTAAATAGAAGGGG + Intronic
1121387409 14:93540904-93540926 TTTACTCCTTTTAAAAGAACAGG - Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1124449702 15:29775830-29775852 TTGACCCTATTATAAATAAAAGG + Intronic
1124505938 15:30273436-30273458 TTGAGCCCATTAAGTACAACTGG - Intergenic
1124737615 15:32265196-32265218 TTGAGCCCATTAAGTACAACTGG + Intergenic
1129143250 15:73622277-73622299 TTGAACCCATTAGAAAGAAAAGG + Intronic
1129290790 15:74565747-74565769 TTAATCCCAGTAAAAAGAAAAGG + Intronic
1130429503 15:83832268-83832290 TTTAGACCATTAATAAGAACAGG - Intronic
1130430744 15:83844600-83844622 TTAATTCCATTAAAAGGAACAGG - Intronic
1132645339 16:996965-996987 TTCACCCCATTTAACAGAAGAGG + Intergenic
1139059584 16:63232521-63232543 TTTATCGCATTAAAAACAACGGG + Intergenic
1140327914 16:74023573-74023595 TTGATCCTTCTAAAAAGAACAGG - Intergenic
1144035664 17:11363234-11363256 TTGACCCCATAAGAATAAACAGG - Intronic
1145290760 17:21543934-21543956 TTGCCCCCAGTAACAAGCACAGG - Intronic
1149206970 17:54259117-54259139 TTGGCACCTTTGAAAAGAACAGG + Intergenic
1151911154 17:77084102-77084124 AGGACCCCATTTTAAAGAACAGG - Intergenic
1152294751 17:79460268-79460290 TTTACCTCATTAAAAAAAAATGG + Intronic
1153544276 18:6190201-6190223 ATGACTCCATTAATAAGAACAGG + Intronic
1153920324 18:9783226-9783248 TTGGCCCCATTTCACAGAACAGG + Intronic
1155384303 18:25260358-25260380 TGGTCAGCATTAAAAAGAACAGG + Intronic
1155582668 18:27327969-27327991 TTGACCACATCATAAAGACCTGG + Intergenic
1167849670 19:52191667-52191689 TTAACCCCATTAAAGAGAAGAGG - Intronic
925948264 2:8886668-8886690 TTAAATCCATTTAAAAGAACAGG + Intronic
926661368 2:15470761-15470783 TTCACCATATTAAAAATAACTGG - Intronic
927624808 2:24704428-24704450 TTGTCTCCATTAAAAATACCAGG - Intronic
931132713 2:59355375-59355397 TTGGCCTCATTAATAAGGACTGG - Intergenic
931785905 2:65619309-65619331 TTGACACCAGAAAGAAGAACAGG - Intergenic
932055873 2:68443574-68443596 TTGACATCAATAAAAAGGACTGG + Intergenic
935170281 2:100606054-100606076 AAGACCTCAATAAAAAGAACAGG - Intergenic
935733604 2:106087581-106087603 TTCAACACATTTAAAAGAACTGG - Intergenic
938987305 2:136590314-136590336 TTCACCCCATTAAGAATAACTGG + Intergenic
939502267 2:143002681-143002703 TTGATCCCATTGAAAATAAATGG + Intronic
940863934 2:158798143-158798165 TAGACCCAATTAAAAAGTGCAGG - Intronic
941827226 2:169913574-169913596 TTTACACAATTAAAAAGAAAGGG - Intronic
945247162 2:207729101-207729123 TTGGTCCCAATAAAAAGAAAAGG - Intronic
947930919 2:233964611-233964633 TTCACCCCCCTAAAAAGACCAGG + Exonic
1169975017 20:11315123-11315145 TTGCCCCTTTTAAAAAGAATTGG - Intergenic
1175433538 20:58926070-58926092 TTTGCCACATTAAAAAGATCAGG - Intergenic
1179166548 21:38939573-38939595 TTGACACCAGTAAAAATCACTGG + Intergenic
1179404993 21:41118479-41118501 TTGACACCATTTCAAAGATCAGG - Intergenic
1179638565 21:42731692-42731714 TTGCCCCCATAAAATAGACCTGG + Intronic
950403546 3:12789701-12789723 TTGACACTTTTTAAAAGAACTGG - Intergenic
950714857 3:14840582-14840604 TTGCAGTCATTAAAAAGAACGGG - Intronic
953328540 3:42033090-42033112 CAGAGCCCATTAAAAAGCACTGG - Intronic
953344132 3:42160768-42160790 TTGATTCCATTACAAAGATCGGG - Intronic
956353392 3:68363704-68363726 TTTACTTCTTTAAAAAGAACCGG - Intronic
956949107 3:74259365-74259387 ATGGCACCAATAAAAAGAACTGG - Intergenic
957724035 3:84041738-84041760 TTAACCTCATTGTAAAGAACAGG + Intergenic
959366620 3:105467987-105468009 TTTGCCCCATGAAAAAGAAGTGG + Intronic
959836743 3:110926621-110926643 TTGAGCTCATTAAAAAAAACTGG + Intergenic
963465314 3:145672932-145672954 TTGTGACCATTGAAAAGAACAGG - Intergenic
965730863 3:171771000-171771022 TTGACCATATTAAATACAACTGG - Intronic
965976501 3:174630485-174630507 TTTTCCCCATTCAAAAAAACAGG + Intronic
971788196 4:31132585-31132607 TTGAGACCATTAAAATGAAGTGG + Intronic
974183934 4:58421116-58421138 TTGATTCCATTAAATAGAAGAGG - Intergenic
975070383 4:70129549-70129571 TTAACCCCTTTAAAAAGCAGAGG + Intergenic
975999432 4:80355621-80355643 TCAACCCCATTAAAAAGCAAAGG - Intronic
976267985 4:83203495-83203517 TAGACCCCATTTATAAAAACTGG + Intergenic
976871464 4:89798877-89798899 TTTAACAAATTAAAAAGAACCGG + Intronic
977454315 4:97238343-97238365 TTGACCTCACAAAAATGAACGGG + Intronic
982797443 4:159663316-159663338 ATGATCCCATTAAAAAAAATTGG + Intergenic
982923658 4:161306857-161306879 TTGTCTCTATTAAAAAGAAGAGG - Intergenic
985396109 4:189545963-189545985 CTAACCACATTAGAAAGAACAGG + Intergenic
986376404 5:7136465-7136487 GTAACCCCATTACAAAGCACTGG + Intergenic
986755684 5:10833920-10833942 TTTACCCCTTTGAGAAGAACAGG - Intergenic
988350686 5:30102961-30102983 TTGTCCTTATGAAAAAGAACTGG + Intergenic
989017359 5:36954376-36954398 TTTACCCCACTAAAACCAACTGG - Intronic
989245762 5:39252525-39252547 TTGACCTTTTTAAAAAGAATTGG - Intronic
994816632 5:104594342-104594364 TAGACCCCATTTACAAAAACTGG + Intergenic
996316454 5:122165928-122165950 ATGACCTCATCAAAAAGAACAGG + Intronic
996940997 5:129005268-129005290 TTTATCCCATTAGAAATAACTGG - Intronic
997312637 5:132901050-132901072 CTGGCCCAATTAAACAGAACAGG + Intronic
997609047 5:135198841-135198863 TTGAGCCCATTAAATAAAACAGG - Intronic
998181399 5:139947890-139947912 TTTACCACAATAAAAAGAATTGG - Intronic
1000824582 5:166029337-166029359 TTGATGGCATTAGAAAGAACGGG - Intergenic
1006745503 6:36339202-36339224 TTTACCACAATAAAAAGAAGGGG + Intergenic
1006980477 6:38143798-38143820 TAGACTCCAATAAACAGAACTGG - Intronic
1007322279 6:41036148-41036170 ATGGCCACATTAAAAAGAACAGG + Intronic
1007887490 6:45247439-45247461 TTGACTCCAAGAAAGAGAACAGG - Intronic
1008266780 6:49437561-49437583 TTCACACCATGAAAAACAACTGG + Intronic
1008482290 6:51998340-51998362 TTGACCTCAAAATAAAGAACTGG + Intronic
1009922604 6:70081062-70081084 TTGACAAAATTAAAAAGAAAGGG - Intronic
1010879167 6:81147012-81147034 TTGAACACATTATATAGAACTGG + Intergenic
1011067393 6:83342136-83342158 TTCACCCCATTTAAATGAAGTGG - Intronic
1012946819 6:105475095-105475117 TTTACCACAGTAAAAAGAATGGG - Intergenic
1013485949 6:110596078-110596100 TTAACACCATTAAAAAGAACAGG - Intergenic
1015952908 6:138572066-138572088 GTCACCCAATTAAAAAGAAAGGG + Exonic
1017429819 6:154359971-154359993 TTGTATCCATTAAAAAGAACAGG + Intronic
1017762595 6:157582200-157582222 ATGACCCAATTAAAAGGCACAGG - Intronic
1017804089 6:157928149-157928171 TTGACATCCTTAGAAAGAACTGG + Intronic
1022317178 7:29256544-29256566 CTGACCTCATTACAAAGAAGTGG + Intronic
1026615151 7:71895578-71895600 TAGACCCCATAAAAGAGAATTGG - Intronic
1029294905 7:99532773-99532795 TTAACCCCTTTGAAAAGAAATGG + Exonic
1030139271 7:106288064-106288086 TTGACCTCAGTAAAAAACACTGG + Intergenic
1030983119 7:116210207-116210229 TTGACCCAAATAAAAAGTCCTGG + Intergenic
1031048225 7:116918235-116918257 TTGACCCCATTAAAAAGAACTGG - Exonic
1031197259 7:118631540-118631562 TAGAACCCAGTAAAAAGAAAGGG + Intergenic
1032202733 7:129834208-129834230 TCTACCCCAAGAAAAAGAACTGG + Exonic
1033375306 7:140755782-140755804 TTGTCTCCATTAGAAAGAAAGGG + Intronic
1036421805 8:8603219-8603241 TGGACCCTATTAAAATGATCTGG + Intergenic
1038466258 8:27766813-27766835 ATGTACCCATTAAAAAGAAACGG + Intronic
1040353371 8:46590848-46590870 TTGATTTCATTATAAAGAACTGG - Intergenic
1040364138 8:46696906-46696928 TTGATTTCATTATAAAGAACTGG + Intergenic
1042066847 8:64886953-64886975 TTTACCCCACAAAAAAGAAGAGG - Intergenic
1043540410 8:81255936-81255958 TCTACCCCAAGAAAAAGAACCGG - Intergenic
1045512076 8:102819562-102819584 TTGACCTCTTTAAAAAGCAGAGG - Intergenic
1046966418 8:120171958-120171980 ATTTCCCCATTGAAAAGAACAGG - Intronic
1047089799 8:121561254-121561276 TTGACCCCCTTAAAAAGCAATGG - Intergenic
1048130122 8:131686958-131686980 TTAAGGCCATTAAAAACAACAGG + Intergenic
1050268484 9:3916466-3916488 TTGACGCCACTCAAAGGAACTGG + Intronic
1051513420 9:17905310-17905332 TTTACCCAATTGAAAAGAGCAGG + Intergenic
1057441520 9:95087086-95087108 TGGGCGCCATTTAAAAGAACAGG + Exonic
1058389843 9:104482956-104482978 TCAACTCCATTAAAAATAACTGG - Intergenic
1059276711 9:113103890-113103912 TTTATCCCATTAAAAATAAAGGG + Intergenic
1186533333 X:10319736-10319758 TTGACCCCTCTAGAATGAACTGG - Intergenic
1186757738 X:12690648-12690670 TTGAAACCATTAAAAAGAAATGG + Intronic
1186922526 X:14297833-14297855 TTGACCCAATGGAAAAGAAGGGG + Intergenic
1187752640 X:22484407-22484429 TTGAAACACTTAAAAAGAACTGG + Intergenic
1189414767 X:40804073-40804095 TTGACCAAATTATGAAGAACTGG - Intergenic
1191654626 X:63583098-63583120 TTCACCCCATTATGAAGCACAGG - Intergenic
1194455219 X:94095023-94095045 TTGACCCATTTTAACAGAACAGG - Intergenic
1194862562 X:99020116-99020138 TTGATCCTATTAGAAAGAATTGG + Intergenic
1199219451 X:145300519-145300541 ATAACCCCATTAAAAATGACAGG - Intergenic
1200965265 Y:9029571-9029593 TTGAACACATTAAAAGAAACAGG + Intergenic
1202179198 Y:22125054-22125076 TTGACTCCTTTAGAAAGAAAAGG - Intergenic
1202212163 Y:22461340-22461362 TTGACTCCTTTAGAAAGAAAAGG + Intergenic