ID: 1031051888

View in Genome Browser
Species Human (GRCh38)
Location 7:116953464-116953486
Sequence CGCGAGCTGCGCCTCCGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 114}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031051883_1031051888 0 Left 1031051883 7:116953441-116953463 CCGGGCCGCGGCGGCGGCGGCGG 0: 1
1: 93
2: 179
3: 488
4: 1295
Right 1031051888 7:116953464-116953486 CGCGAGCTGCGCCTCCGGGCCGG 0: 1
1: 0
2: 1
3: 8
4: 114
1031051878_1031051888 10 Left 1031051878 7:116953431-116953453 CCGGGGGCGCCCGGGCCGCGGCG 0: 1
1: 0
2: 8
3: 88
4: 520
Right 1031051888 7:116953464-116953486 CGCGAGCTGCGCCTCCGGGCCGG 0: 1
1: 0
2: 1
3: 8
4: 114
1031051870_1031051888 28 Left 1031051870 7:116953413-116953435 CCCGGCGGCGGGCGGGCTCCGGG 0: 1
1: 1
2: 6
3: 61
4: 413
Right 1031051888 7:116953464-116953486 CGCGAGCTGCGCCTCCGGGCCGG 0: 1
1: 0
2: 1
3: 8
4: 114
1031051882_1031051888 1 Left 1031051882 7:116953440-116953462 CCCGGGCCGCGGCGGCGGCGGCG 0: 1
1: 31
2: 220
3: 532
4: 1486
Right 1031051888 7:116953464-116953486 CGCGAGCTGCGCCTCCGGGCCGG 0: 1
1: 0
2: 1
3: 8
4: 114
1031051868_1031051888 29 Left 1031051868 7:116953412-116953434 CCCCGGCGGCGGGCGGGCTCCGG 0: 1
1: 0
2: 2
3: 24
4: 267
Right 1031051888 7:116953464-116953486 CGCGAGCTGCGCCTCCGGGCCGG 0: 1
1: 0
2: 1
3: 8
4: 114
1031051885_1031051888 -5 Left 1031051885 7:116953446-116953468 CCGCGGCGGCGGCGGCGGCGCGA 0: 1
1: 13
2: 35
3: 225
4: 685
Right 1031051888 7:116953464-116953486 CGCGAGCTGCGCCTCCGGGCCGG 0: 1
1: 0
2: 1
3: 8
4: 114
1031051872_1031051888 27 Left 1031051872 7:116953414-116953436 CCGGCGGCGGGCGGGCTCCGGGG 0: 1
1: 0
2: 2
3: 37
4: 328
Right 1031051888 7:116953464-116953486 CGCGAGCTGCGCCTCCGGGCCGG 0: 1
1: 0
2: 1
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031051888 Original CRISPR CGCGAGCTGCGCCTCCGGGC CGG Exonic
901279849 1:8025914-8025936 CCCGGGCTGCGCCGCCGGGGAGG + Intronic
902401916 1:16162564-16162586 TGCGGGCGGAGCCTCCGGGCAGG + Intergenic
904171112 1:28592671-28592693 CGCGCGCTGCAGCTGCGGGCCGG + Intronic
905656986 1:39691651-39691673 CGGGGGCTGAGCCTCAGGGCAGG - Exonic
907401973 1:54229839-54229861 CGTGAGCTGCTCCTCTGGGCTGG - Intronic
914376712 1:147078999-147079021 CCCGATCGGCGCCTCCGGGACGG - Intergenic
918051364 1:180975740-180975762 CGCAAGCTGCACCTCTGGGGAGG + Exonic
923299798 1:232630326-232630348 CGGGAGCTGCGCGTCCAGGAGGG + Intergenic
923674153 1:236065360-236065382 AGCGAACGGCGCCTCCGGGAGGG + Intergenic
1063458773 10:6202770-6202792 TGCGAGCTCCCCCTGCGGGCCGG - Intronic
1071293191 10:84201843-84201865 GGTGTGCTGCGCCTCCAGGCTGG + Exonic
1075940770 10:126388600-126388622 AGCGAGCCGCGGCTCGGGGCGGG - Intergenic
1083721997 11:64607837-64607859 CTCGGGCTTCGCCTCCGGGGAGG - Exonic
1083800059 11:65041420-65041442 CGCGCGCTGCGGATCCGCGCGGG - Exonic
1088462310 11:110093747-110093769 CGCGATCTATGCCCCCGGGCGGG - Intronic
1089556091 11:119316683-119316705 CCCCAGCTGCGCCTCCTGCCCGG + Intronic
1089810620 11:121128384-121128406 GGCGAGCTCCTCCTCCTGGCTGG - Intronic
1091243265 11:134069285-134069307 CGCGCGCCGCCCCTCCGGCCCGG - Intronic
1091558621 12:1594269-1594291 TGCCGGCTGCGCCTCCGGCCCGG + Intronic
1095349156 12:41188800-41188822 CGGGGGCTGCGCTTCGGGGCTGG + Exonic
1100587815 12:95995842-95995864 AGTGAGCTGCGCGTCCTGGCAGG + Exonic
1103273186 12:119690245-119690267 CGCGTGCTGAGCATCCGGCCGGG + Exonic
1104195965 12:126538348-126538370 AGAGAGCTGTGCCTCTGGGCTGG + Intergenic
1106246399 13:27953939-27953961 TGAGAGCTGGGACTCCGGGCGGG - Intergenic
1117549094 14:56816753-56816775 CTCGAGCTGCGCCGCCCCGCTGG + Intergenic
1120935493 14:89891947-89891969 CGCGCGCTGCAGCTGCGGGCTGG + Intronic
1122811035 14:104288037-104288059 GACCAGCTGTGCCTCCGGGCAGG + Intergenic
1122982402 14:105197588-105197610 CCCCAGCTGGGCCTCAGGGCAGG + Intergenic
1123025479 14:105421770-105421792 GGGGAGCTGCACCTCCGGGATGG - Intronic
1123584164 15:21742300-21742322 CGCGCCCTCCGCCTCCTGGCAGG + Intergenic
1123620814 15:22184903-22184925 CGCGCCCTCCGCCTCCTGGCAGG + Intergenic
1127789936 15:62390630-62390652 CGCGGGCTGCACTCCCGGGCAGG + Intronic
1130411773 15:83654006-83654028 CGCGCCCTCCGCCTCTGGGCCGG + Intergenic
1132527858 16:426287-426309 CGCAAGCTGCCCCCGCGGGCCGG - Exonic
1132985175 16:2762353-2762375 CGAGACCTGCCCCTCCGGGCTGG - Exonic
1133040683 16:3058606-3058628 CGCGACCTGAGCCTCTGGGAAGG + Exonic
1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG + Intronic
1134070313 16:11256234-11256256 CGCCAGCCCCGCCTCCGAGCCGG - Intronic
1136711488 16:32240582-32240604 CGGGAGCTGCTGCTCCGGGAGGG - Intergenic
1136811689 16:33181550-33181572 CGGGAGCTGCTGCTCCGGGAGGG - Intergenic
1136818165 16:33291630-33291652 CGGGAGCTGCTGCTCCGGGAGGG - Intronic
1136824729 16:33348159-33348181 CGGGAGCTGCTGCTCCGGGAGGG - Intergenic
1136829795 16:33446930-33446952 CGGGAGCTGCTGCTCCGGGAGGG - Intergenic
1141590442 16:85065282-85065304 CGCCAGCTGCGTCCCCGGCCAGG - Intronic
1141609772 16:85174784-85174806 TGAGAGCTGGGGCTCCGGGCAGG + Intronic
1142120135 16:88383079-88383101 CGCGCGCTGCGCCTCGGGGCGGG - Intergenic
1202990267 16_KI270728v1_random:4519-4541 CGGGAGCTGCTGCTCCGGGAGGG - Intergenic
1203058566 16_KI270728v1_random:949177-949199 CGGGAGCTGCTGCTCCGGGAGGG + Intergenic
1143240464 17:5439162-5439184 CGCGGGAAGCGCTTCCGGGCAGG - Intronic
1143590900 17:7885368-7885390 CGCGAGCTGCGCGCGCGGACCGG + Intronic
1146182894 17:30708926-30708948 CCCGGGCGGCGACTCCGGGCCGG + Intergenic
1147738980 17:42659684-42659706 CGAGAGCTGCGCCTCCAGCCCGG + Intronic
1148852374 17:50561321-50561343 CGCAAGCTGAGCCCCCGGGAGGG - Intronic
1150675957 17:67245835-67245857 CGCGGTCTCCTCCTCCGGGCGGG + Intronic
1151674401 17:75590137-75590159 CTGGAGCTGAGCCTCCGGCCGGG + Intergenic
1152245457 17:79182774-79182796 CGCGCGCCGGGCCTCCGGGGAGG - Intronic
1152321274 17:79609972-79609994 CTCGAGCAGCGCGGCCGGGCTGG - Intergenic
1154177238 18:12093597-12093619 CGCGAGCGCCGCCTGCTGGCTGG - Intergenic
1157529355 18:48408862-48408884 CGGGCGCCGCGCCTCCTGGCTGG - Intronic
1157753077 18:50195193-50195215 TGCCACCTGGGCCTCCGGGCCGG + Intergenic
1160655590 19:267142-267164 CGCGAGCGGCGCCATCGGGACGG - Intergenic
1160858978 19:1229708-1229730 CGCGGGCTGCGGGGCCGGGCGGG + Exonic
1160862077 19:1241699-1241721 CGCGAACTACGACTCCCGGCAGG - Intergenic
1162497603 19:11032119-11032141 CGGAAGCTGCACCTCAGGGCTGG + Intronic
1162901080 19:13795780-13795802 CGAGAGCTGGGCCTTCGAGCAGG + Exonic
1162975917 19:14206879-14206901 CCCGGGCGGCGACTCCGGGCCGG - Intergenic
1163782731 19:19258788-19258810 CGCGCGCTGCGCCTCCGCGAAGG + Exonic
1166596972 19:44058836-44058858 AGCTAGCTGCACCTCCAGGCAGG + Intronic
1167465971 19:49651348-49651370 TGTGGGCTGCGCGTCCGGGCGGG - Exonic
1167978728 19:53254853-53254875 CGCGAGATCCGCTTCCGGGTCGG + Exonic
1168337650 19:55605576-55605598 CGCGACTTCCGCTTCCGGGCGGG + Intronic
1168405461 19:56108184-56108206 GGGGAGCGGCGCCTCCTGGCAGG - Intronic
927818741 2:26244410-26244432 AGAGGGCTGCGTCTCCGGGCTGG + Intronic
929742761 2:44621186-44621208 TGCAAGCTCCGCCTCCGGGTTGG - Intronic
929936980 2:46299950-46299972 TGTGAGCTGCGGCTCCGGGCTGG + Intronic
932257466 2:70300179-70300201 CGCGAGCTACGCGTCCAGCCAGG + Intronic
938795976 2:134718706-134718728 CGCGAGCTGCCCGACCCGGCCGG - Intronic
940666696 2:156618234-156618256 CGAGAGCTGCGCCGGTGGGCTGG + Intergenic
947800965 2:232928287-232928309 CGCGAGCGCCGACTGCGGGCTGG + Intronic
1168965237 20:1894722-1894744 TGCGAGCTGCGCGCCCGGCCGGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1171346402 20:24469484-24469506 CGGGAGCTGCGGCGCCGGGGCGG - Exonic
1172764822 20:37345916-37345938 CCCGAGCTGGGGGTCCGGGCGGG - Intronic
1176179500 20:63742715-63742737 CGTGGGCTGCGGCTCCAGGCGGG - Exonic
1177580995 21:23021664-23021686 CGCGCGCTGCGCTTGCCGGCCGG - Intergenic
1181085161 22:20436483-20436505 TGCGAGCCCCGCCTCCGGGGCGG - Intronic
1183932058 22:41240901-41240923 CCTGCGCTGCGCCTCCAGGCTGG - Exonic
954195855 3:48996841-48996863 CCCAAGCTGAGTCTCCGGGCAGG - Intronic
958776301 3:98487252-98487274 CAGGAGCTGAGCCTCCAGGCTGG + Intergenic
958779375 3:98522817-98522839 CGGGACCTGCGTCGCCGGGCAGG - Intronic
961684130 3:128617797-128617819 AGCGAGCTGCGCCTGCGCCCTGG - Intergenic
967884332 3:194322892-194322914 CGCGAGCTGAGCCTCCTGGGTGG + Intergenic
968764828 4:2462799-2462821 CTCTAGCTGCGCCTGCAGGCCGG - Exonic
968979882 4:3841521-3841543 CGCCAGCTGAGTCTCAGGGCAGG - Intergenic
979624278 4:122827597-122827619 GGCGCGCCGCGGCTCCGGGCCGG - Intronic
984928207 4:184825480-184825502 CGCGAGCCCGGCCTCTGGGCAGG + Intronic
985897367 5:2756597-2756619 CGCCAGCTGCGGCTCCAGCCTGG + Intergenic
985921904 5:2984080-2984102 CACGGGCTCCGCCTCCTGGCAGG - Intergenic
990996559 5:61737701-61737723 CCTGAGCTGAGCCTCCTGGCTGG + Intronic
991587531 5:68215700-68215722 CGCTAGCCCCGCCTCCGGCCCGG - Exonic
998119042 5:139561343-139561365 GGCGGGCTGCGCCGCCGGGGTGG - Exonic
998406772 5:141878538-141878560 CCCGAGCTCCACCTCCCGGCCGG - Intronic
1003770143 6:9290615-9290637 CGAGAGCAGCGCCGGCGGGCTGG + Intergenic
1005838282 6:29723937-29723959 CGTGACCTGCGCCCCCGGCCGGG - Intronic
1013224878 6:108113752-108113774 GGCGAGATGCGCCTCGGGGTCGG + Intronic
1018774330 6:166999292-166999314 AGCGCGCTGCGCGTCGGGGCGGG + Exonic
1019427582 7:984690-984712 CAGGAGCTGGGCCTCCGGGCTGG + Intronic
1019711464 7:2519979-2520001 CGCGCGCTGCGCAGCCTGGCGGG + Exonic
1028762349 7:94509946-94509968 CGCCACCTGCGCCTCCCGCCGGG - Exonic
1031051888 7:116953464-116953486 CGCGAGCTGCGCCTCCGGGCCGG + Exonic
1033186519 7:139231660-139231682 CGGGGGCTGCGCGTCCGAGCGGG - Exonic
1035265678 7:157689337-157689359 CCCGAGCTGCGCGTCCCGGCCGG - Intronic
1039947180 8:42140231-42140253 GGCGAGCTGCGGCCCGGGGCTGG - Intergenic
1045489396 8:102656886-102656908 CGTGTGCTGCGCCTGGGGGCTGG + Intergenic
1049551328 8:143261325-143261347 AGCGAGCTGCGCCTCTGCACCGG + Intronic
1057054475 9:91950117-91950139 GCCGAGCGGCGCATCCGGGCCGG - Exonic
1062082356 9:134630748-134630770 CACAAGCTGAGCCTCCGGGAGGG - Intergenic
1062261642 9:135665908-135665930 CGTGAGCTGCGACTCGGGACGGG + Exonic
1062344807 9:136109763-136109785 CGCGCACTGCGCCTGGGGGCGGG - Intergenic
1062530717 9:136998417-136998439 CGCGAGCTGCCACACCCGGCCGG + Intergenic
1062696554 9:137878777-137878799 CGCGGACAGCGCCTCCGGCCCGG - Intronic
1187904023 X:24049876-24049898 CGAGAGCAGCGCCGGCGGGCTGG - Intergenic
1196122164 X:112062883-112062905 CGCAAGCTAAGCCTCCGAGCTGG - Intronic
1200235072 X:154464198-154464220 CGTGAGCTGCGCCTTCGAGGCGG + Exonic