ID: 1031051990

View in Genome Browser
Species Human (GRCh38)
Location 7:116953900-116953922
Sequence GGCGCAGCTCTTCCTCCGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 112}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031051990_1031051996 -2 Left 1031051990 7:116953900-116953922 CCCCGCGGAGGAAGAGCTGCGCC 0: 1
1: 0
2: 1
3: 17
4: 112
Right 1031051996 7:116953921-116953943 CCGCGCACAGCCCGCAAGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 124
1031051990_1031051997 2 Left 1031051990 7:116953900-116953922 CCCCGCGGAGGAAGAGCTGCGCC 0: 1
1: 0
2: 1
3: 17
4: 112
Right 1031051997 7:116953925-116953947 GCACAGCCCGCAAGGCGGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 144
1031051990_1031052003 12 Left 1031051990 7:116953900-116953922 CCCCGCGGAGGAAGAGCTGCGCC 0: 1
1: 0
2: 1
3: 17
4: 112
Right 1031052003 7:116953935-116953957 CAAGGCGGGCCGGGCCGGGCCGG 0: 1
1: 1
2: 16
3: 162
4: 632
1031051990_1031051999 7 Left 1031051990 7:116953900-116953922 CCCCGCGGAGGAAGAGCTGCGCC 0: 1
1: 0
2: 1
3: 17
4: 112
Right 1031051999 7:116953930-116953952 GCCCGCAAGGCGGGCCGGGCCGG 0: 1
1: 0
2: 1
3: 18
4: 354
1031051990_1031052001 8 Left 1031051990 7:116953900-116953922 CCCCGCGGAGGAAGAGCTGCGCC 0: 1
1: 0
2: 1
3: 17
4: 112
Right 1031052001 7:116953931-116953953 CCCGCAAGGCGGGCCGGGCCGGG 0: 1
1: 0
2: 4
3: 28
4: 277
1031051990_1031051998 3 Left 1031051990 7:116953900-116953922 CCCCGCGGAGGAAGAGCTGCGCC 0: 1
1: 0
2: 1
3: 17
4: 112
Right 1031051998 7:116953926-116953948 CACAGCCCGCAAGGCGGGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 185
1031051990_1031051994 -3 Left 1031051990 7:116953900-116953922 CCCCGCGGAGGAAGAGCTGCGCC 0: 1
1: 0
2: 1
3: 17
4: 112
Right 1031051994 7:116953920-116953942 GCCGCGCACAGCCCGCAAGGCGG 0: 1
1: 0
2: 1
3: 6
4: 74
1031051990_1031051993 -6 Left 1031051990 7:116953900-116953922 CCCCGCGGAGGAAGAGCTGCGCC 0: 1
1: 0
2: 1
3: 17
4: 112
Right 1031051993 7:116953917-116953939 TGCGCCGCGCACAGCCCGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031051990 Original CRISPR GGCGCAGCTCTTCCTCCGCG GGG (reversed) Exonic
900166635 1:1246627-1246649 GCCGCAGCTCGTGCTCCTCGGGG - Exonic
902923174 1:19679317-19679339 GCCGCAGCTCGGGCTCCGCGGGG - Exonic
902987819 1:20166147-20166169 GGCGCTGCTTTTTCTCCACGTGG - Intronic
908402783 1:63786825-63786847 GGCGCAGCTCCACCTGCCCGAGG + Intronic
914463705 1:147908279-147908301 GGCCCAGCTCCTCCGCCTCGCGG - Exonic
914950254 1:152107804-152107826 GGCGTAGCTGTTCCTCCTCGCGG + Exonic
914950264 1:152107876-152107898 GGCGGAGCTGTTCCTCCTCGCGG + Exonic
914950281 1:152108020-152108042 GGCGCAGCTGTTCCTCCTCACGG + Exonic
914950344 1:152108524-152108546 GGCGCAGCTGTTCCTCCTCGCGG + Exonic
914950381 1:152108806-152108828 GGAGCAGCTGTTCCTCTTCGCGG + Exonic
914950430 1:152109181-152109203 GGAGCAGCTGTTCCTCCTCGCGG + Exonic
917222636 1:172748329-172748351 CGCGCCGCTCTTCACCCGCGCGG - Intergenic
919639675 1:200036060-200036082 GACGCATCTCATCCTCCGCCGGG - Intronic
919740706 1:200979769-200979791 GGCGCAGCTCCACCTCTGCAGGG + Intronic
922734089 1:227970402-227970424 GGCCCACCTCTTCCTCACCGTGG + Intergenic
922734140 1:227970592-227970614 GGCCCAGCTCTTCCTCTCGGCGG + Intergenic
1067187847 10:44045169-44045191 GGCGGAGCTTTTCCTTCGTGGGG + Intergenic
1069908595 10:71746602-71746624 GGCCCAGCTCTTCCTTTGCAGGG - Intronic
1070152238 10:73811889-73811911 GGCCCGGCTCCCCCTCCGCGGGG - Intergenic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1079374328 11:19878726-19878748 GGCGCACTTCCTCCTCTGCGTGG + Intronic
1082260267 11:50072665-50072687 GGCCCAGCTCTTCCTCCTGGTGG - Intergenic
1082260710 11:50074646-50074668 GGCCCAGCTCTTCCTCCCAGCGG - Intergenic
1084169268 11:67392647-67392669 GGCCCAGCTCTCCCTCCGGACGG + Exonic
1089661780 11:119990797-119990819 GGGGCAGCTCTTCCACCTCTAGG + Intergenic
1089688626 11:120172450-120172472 GGCGCAGCCCTTCCTCCTGTGGG + Intronic
1091550255 12:1530876-1530898 GGCCCGGCTCTTCCTGCGCCCGG - Intronic
1096783194 12:54002463-54002485 GGGGCAGCGCTTCTTCCTCGTGG - Exonic
1099989611 12:89708742-89708764 GGTGCAGCTGCACCTCCGCGTGG - Exonic
1103822903 12:123712601-123712623 GGCGCAGCTCTTCCTGCAGTCGG + Exonic
1104435840 12:128755848-128755870 GGTGCAGCTCTTTCTCTACGAGG - Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1106157629 13:27172170-27172192 GCCGCACCCCTTCCTACGCGGGG - Intergenic
1109061649 13:57629598-57629620 AGCGCAGCCCTGACTCCGCGTGG - Intergenic
1115740142 14:36378921-36378943 GGCCCAGCACTTCCTCAGCCGGG + Intergenic
1122549998 14:102544607-102544629 GGCGCAGATGTTCTCCCGCGGGG - Intergenic
1122954038 14:105061601-105061623 GGCCCTGCTCTTCCTCGGGGAGG + Intronic
1127753609 15:62068597-62068619 GGCGCACTTCGTCCTCCGAGAGG - Exonic
1127763456 15:62163994-62164016 GGCGCACCTCGTCTTCCGAGAGG + Exonic
1127964788 15:63915528-63915550 GGCTTAGCTCTTCCTCCCCTGGG - Intronic
1129116382 15:73367649-73367671 GGCGCACCTCGGCCTCCGGGAGG + Exonic
1130301149 15:82680533-82680555 GGCGCAGCTCTACTTCCACCTGG - Exonic
1131839054 15:96416801-96416823 GGCCCAGCTCTGCCCCGGCGTGG + Intergenic
1132111627 15:99105862-99105884 GCCGCGTCTCTTCCTCCGCCTGG - Exonic
1132601019 16:773009-773031 GCCGCAGCTGATCCTCCGGGAGG + Exonic
1132684954 16:1158397-1158419 GGGGCAGCTCATCCTTCCCGGGG + Intronic
1142136682 16:88454745-88454767 GACGCAGGTCTTCCTCCCCGGGG + Intronic
1142382245 16:89739521-89739543 GGGGCGGCTCCTCCTCCGTGTGG - Exonic
1142400512 16:89855950-89855972 GGAGCAGCACTCCCTCCGGGTGG + Intronic
1143563694 17:7709258-7709280 GGCGCTGCTCTTGCTGGGCGTGG + Exonic
1144001569 17:11059986-11060008 GGCTCAGCTCTTCCTTCCAGGGG + Intergenic
1148877275 17:50697288-50697310 GGCCCAGCTCTGCCTCTGCTGGG + Intronic
1151591384 17:75047087-75047109 GGCACAGCGCCTCCCCCGCGCGG + Intronic
1152332654 17:79682070-79682092 GGCTGAGCTCTGCCTCCGGGAGG - Intergenic
1157281148 18:46347130-46347152 GCTACAGCTCTTCCTCCTCGGGG - Intronic
1157769421 18:50332629-50332651 GGTGCATCTCTTCCTCCCCAGGG - Intergenic
1158437094 18:57441421-57441443 ACCGCAGCTCCTCCCCCGCGAGG + Intronic
1160050304 18:75427211-75427233 GGGGCAGCTCTTCCTCAGATTGG + Intronic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1163713592 19:18861390-18861412 GGCACAGCTCTGCCTCCATGAGG + Intronic
1164179188 19:22805389-22805411 GGCTCAGCTCTTCCTTGGGGAGG - Intergenic
1165321942 19:35090986-35091008 GGTGCAGCTCTGCGTCCCCGCGG + Intergenic
1168707030 19:58476219-58476241 GGCGCAGCCTTTCCACCCCGTGG + Exonic
926020638 2:9492039-9492061 AGAGCAGCTCTTCCTCAGGGTGG - Intronic
927141070 2:20131131-20131153 GGCCCAGCTCTTCCCCAGCTAGG + Intergenic
927207002 2:20617198-20617220 GGGCCAGGTCTTCCTCCGAGAGG - Intronic
930872525 2:56183813-56183835 GGCGCGGCTCTTTCTGCGCCCGG - Intergenic
932790122 2:74648014-74648036 GGCCCGGAGCTTCCTCCGCGGGG - Exonic
937262833 2:120597400-120597422 GGGGCAGCTCTTCCGCCCCAGGG + Intergenic
937944515 2:127320022-127320044 GGCACAGCTCTTCTTCTGCTAGG - Intronic
948423461 2:237874366-237874388 GGAGCAGCTCGGCCTCCGCACGG + Intronic
948767077 2:240228038-240228060 GGCGCAGCTCTTCCAGCCAGAGG + Intergenic
948860489 2:240750447-240750469 GGTGAAGGGCTTCCTCCGCGTGG - Exonic
948895873 2:240926590-240926612 GGCGCAGCACATCTTCCGGGGGG - Intronic
1176018097 20:62947760-62947782 GGAGCAGCTCCACCTCCCCGAGG - Exonic
1180033228 21:45226682-45226704 GCTGCAGCTCTGCCTCCACGTGG + Intergenic
1180614997 22:17121025-17121047 GCAGCCCCTCTTCCTCCGCGGGG - Exonic
1183167213 22:36156736-36156758 GGGGCAGCTCTACCTCTGTGTGG + Intronic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
950097450 3:10338223-10338245 GCCGCAGCTCCCGCTCCGCGTGG + Exonic
953023949 3:39134232-39134254 GGCGCAGCTCTACCTGCTCCAGG + Exonic
953849421 3:46454777-46454799 GGGGGAGCTCAGCCTCCGCGTGG + Intronic
953912179 3:46898788-46898810 CGCGCAGCTCCTCCTCGGTGAGG - Exonic
961522039 3:127472602-127472624 AGCCCAGCTCTTCCTCAGTGGGG - Intergenic
968646685 4:1744601-1744623 GCTGCAGCTTCTCCTCCGCGTGG - Exonic
969326507 4:6447402-6447424 TCCGGAGCTCTTCCTCCGCAGGG - Intronic
976402742 4:84625551-84625573 TGCACAGCTGTTCCTCCGCCTGG - Intronic
979259253 4:118633302-118633324 GGCCCACCTCTTCCTCACCGTGG + Intergenic
979259303 4:118633492-118633514 GGCCCAGCTCTTCCTCTCGGCGG + Intergenic
979329045 4:119407071-119407093 GGCCCAGCTCTTCCTCTCGGCGG - Intergenic
979329094 4:119407257-119407279 GGCCCACCTCTTCCTCACCGTGG - Intergenic
982092574 4:151893087-151893109 GGCACAGCTCTTCCTATGGGTGG + Intergenic
984823624 4:183905819-183905841 GGAGCAGCGCTGCCGCCGCGCGG + Exonic
985556208 5:559156-559178 GGGGCAGCCCATCCTCCGTGAGG - Intergenic
985956948 5:3272780-3272802 GGGGCAGCTCTGCCTGCGGGTGG - Intergenic
986131456 5:4936022-4936044 GGCTCAGCTCTTCCTCCAGGTGG + Intergenic
990984129 5:61626189-61626211 TGCCCAGCTCTGCCTCCTCGGGG - Intergenic
998200543 5:140114580-140114602 GGCGCGGCTCGTCCTGCGCCTGG - Exonic
1003936073 6:10976618-10976640 GACGCTGCTCTTCTTCCCCGAGG - Intronic
1005784158 6:29225738-29225760 AGCTCAGCTCTTCCTCCCCCAGG + Intergenic
1009320773 6:62286035-62286057 CGCGCTGCTCCTCCTCCGCGCGG + Exonic
1013231387 6:108164852-108164874 GGCGCAGCAGGTCCTCCGCCTGG - Intronic
1023400745 7:39792023-39792045 GGCCCAGCTCTTCCTCCCGGCGG + Intergenic
1024074210 7:45810538-45810560 GGCCCAGCTCTTCCTCCCGGCGG + Intergenic
1024649122 7:51389660-51389682 GGCCCAGCTCTTCCTCCCAGCGG - Intergenic
1024649166 7:51389850-51389872 GGCCCACCTCTTCCTCACCGTGG - Intergenic
1025053201 7:55744990-55745012 GGCCCAGCTCTTCCTCTCGGCGG - Intergenic
1025131305 7:56375463-56375485 GGCCCAGCTCTTCCTCCCGGCGG - Intergenic
1025182114 7:56828532-56828554 GGCCGAGCTCTTCCTCCCGGCGG - Intergenic
1025689816 7:63748463-63748485 GGCTGAGCTCTTCCTCCCGGCGG + Intergenic
1025695755 7:63773452-63773474 GGCGCAGCACATCCTCCAAGTGG + Intergenic
1025977282 7:66378985-66379007 GGCCCAGCTCTTCCTCCTGGCGG - Intronic
1027263818 7:76483041-76483063 GGCGCAGCTCCTCCTTCCCTGGG + Exonic
1029249468 7:99225725-99225747 GGGGCAGCTCTTGCTGCACGGGG + Intergenic
1029448243 7:100626831-100626853 GCCGCAGCTTTTCCGCCGCCCGG + Exonic
1029483847 7:100827570-100827592 GGGGCAGCTCTCCCAACGCGGGG + Intronic
1030049077 7:105522185-105522207 AGCGCATCTGGTCCTCCGCGCGG - Exonic
1031051990 7:116953900-116953922 GGCGCAGCTCTTCCTCCGCGGGG - Exonic
1034470426 7:151251814-151251836 GGCGCATCTCTCCCTGCGCGGGG - Intronic
1045010097 8:97951378-97951400 TGCACAGCTTTTCCTCCGCTTGG + Intronic
1047998698 8:130359006-130359028 CGCCCAGCGCTTCCTTCGCGGGG - Intronic
1049393054 8:142381871-142381893 GCCGCAGCTCATCCTGCGTGTGG + Intronic
1049755442 8:144309414-144309436 GGGGCAGCTCTGCCTCAGGGCGG - Intronic
1057441419 9:95086358-95086380 GGCCCAGCTCTCCCACGGCGAGG + Intronic
1060842608 9:126805386-126805408 GGCGGAGCTCCGCCGCCGCGAGG - Intronic
1061300235 9:129700284-129700306 GGTCCAGCTCTTCCTCAGTGGGG + Intronic
1061612377 9:131755703-131755725 GGACCAGCTCTTCCTCCCCAGGG + Intergenic
1062461845 9:136665649-136665671 GGGGCAGCTCGTCCGCCGCGGGG + Intronic
1062518985 9:136949881-136949903 GGCGCGGCTGCTCCTCCCCGTGG + Intronic
1186493796 X:9995986-9996008 GGCTCAGCCATTCCTCCGCTAGG - Intergenic
1189407207 X:40735654-40735676 GGCGCAGCTTCCCCTCTGCGGGG - Intronic