ID: 1031052001

View in Genome Browser
Species Human (GRCh38)
Location 7:116953931-116953953
Sequence CCCGCAAGGCGGGCCGGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 277}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031051992_1031052001 6 Left 1031051992 7:116953902-116953924 CCGCGGAGGAAGAGCTGCGCCGC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1031052001 7:116953931-116953953 CCCGCAAGGCGGGCCGGGCCGGG 0: 1
1: 0
2: 4
3: 28
4: 277
1031051991_1031052001 7 Left 1031051991 7:116953901-116953923 CCCGCGGAGGAAGAGCTGCGCCG 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1031052001 7:116953931-116953953 CCCGCAAGGCGGGCCGGGCCGGG 0: 1
1: 0
2: 4
3: 28
4: 277
1031051989_1031052001 17 Left 1031051989 7:116953891-116953913 CCTTCACGGCCCCGCGGAGGAAG 0: 1
1: 0
2: 0
3: 18
4: 81
Right 1031052001 7:116953931-116953953 CCCGCAAGGCGGGCCGGGCCGGG 0: 1
1: 0
2: 4
3: 28
4: 277
1031051986_1031052001 24 Left 1031051986 7:116953884-116953906 CCGGTGGCCTTCACGGCCCCGCG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1031052001 7:116953931-116953953 CCCGCAAGGCGGGCCGGGCCGGG 0: 1
1: 0
2: 4
3: 28
4: 277
1031051990_1031052001 8 Left 1031051990 7:116953900-116953922 CCCCGCGGAGGAAGAGCTGCGCC 0: 1
1: 0
2: 1
3: 17
4: 112
Right 1031052001 7:116953931-116953953 CCCGCAAGGCGGGCCGGGCCGGG 0: 1
1: 0
2: 4
3: 28
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031052001 Original CRISPR CCCGCAAGGCGGGCCGGGCC GGG Exonic
900138573 1:1129117-1129139 CTGGCCAGGTGGGCCGGGCCTGG + Intergenic
900366437 1:2313706-2313728 CCTGCAAGGTGGGCCTGGCCAGG + Intergenic
900413280 1:2523352-2523374 CCCCCAGTGCTGGCCGGGCCCGG + Intronic
900514565 1:3075091-3075113 CCGGCCAGGCGGGCCAGCCCAGG - Intronic
900991028 1:6098428-6098450 CCAACAAGACGGGCCTGGCCTGG - Intronic
903175559 1:21578099-21578121 CCCTGAAGGAGGGCTGGGCCTGG - Exonic
903738236 1:25543798-25543820 CGCGTCAGCCGGGCCGGGCCGGG + Intronic
903778439 1:25807631-25807653 CCAGGAAGGCGGGCTCGGCCTGG + Intronic
903822240 1:26111584-26111606 CCCGCAGGGGTGGCCGGGCTCGG - Intronic
904641920 1:31937861-31937883 CCCGGAAGGAGGGCCGGGCCGGG - Intronic
904942794 1:34177006-34177028 TCGGCAAGGCAGGCTGGGCCGGG - Intronic
905990704 1:42335026-42335048 CCCGCCAGGGCGGCCGGGCCTGG - Intronic
906196514 1:43933666-43933688 CCCGAAAGGTGGGGCGGGGCAGG + Exonic
907185035 1:52602732-52602754 GCCGCGGGCCGGGCCGGGCCGGG - Intronic
908534751 1:65067138-65067160 GGCGCGGGGCGGGCCGGGCCGGG - Intergenic
911725564 1:101238090-101238112 ACAGCAAGGCGGGGCGGGCCTGG + Intronic
912927859 1:113929566-113929588 CCGGCGAGGCGGGGCCGGCCGGG + Intronic
915490591 1:156248059-156248081 CCAGGCAGGCGGGCCAGGCCTGG + Intronic
915530775 1:156500944-156500966 TCCCCAGGGCTGGCCGGGCCAGG + Intergenic
915600509 1:156920485-156920507 CCCGAGGGGCGGGCCAGGCCCGG - Intergenic
915621587 1:157089273-157089295 TCTCCAAGGCGGGCCGGGCACGG + Intergenic
923119755 1:230978974-230978996 CCGGCAAGGCGGCCCCGGGCTGG - Intronic
924198980 1:241640258-241640280 CCCGCCAGGCGCGCCGGCGCCGG - Exonic
1062843905 10:690039-690061 CCCGCGGGGCGGGGCGGGGCGGG + Intergenic
1065240029 10:23695389-23695411 CCCCCCAGGAGGGCCAGGCCGGG + Intronic
1066464608 10:35641228-35641250 CACGCAAGACGAGGCGGGCCTGG - Exonic
1069792229 10:71030072-71030094 CCCTGAAGGCAGGCAGGGCCAGG - Intergenic
1070781614 10:79140747-79140769 CCCTTAATGCGGGCCTGGCCTGG - Intronic
1073242460 10:102067238-102067260 GCAGCAGGGCGGGCCGGGCTGGG + Exonic
1074591864 10:114821694-114821716 GCCGCAGGGCAGGCCTGGCCGGG + Intergenic
1075401317 10:122163436-122163458 CCGGCGAGGCGGGAGGGGCCGGG + Intronic
1076189094 10:128470333-128470355 GCTGCCAGGCGGGCCCGGCCTGG + Intergenic
1076523485 10:131095311-131095333 CCCGAGAGGCGGGCAGGGCTGGG + Intronic
1076794202 10:132790839-132790861 CCTGCAAGGTGGGAGGGGCCCGG - Intergenic
1077229038 11:1450502-1450524 CCCGCAGGGCAGGCGGGCCCAGG - Intronic
1077524771 11:3057448-3057470 CCCGGAAGACGGGCCCGGCGTGG - Intronic
1077533430 11:3107860-3107882 CCTGCAAGCCGGGCCGAGACGGG - Exonic
1077635867 11:3840995-3841017 CCGGCGAGGCGGGGCGGGCCGGG + Intergenic
1078545002 11:12240874-12240896 CCCGCAAGCCGGGCCCAGCTGGG - Intronic
1081672405 11:44949629-44949651 CCCGCTGGGCGGGGCGGGGCGGG - Intronic
1081705567 11:45180645-45180667 CCCGCAAGGAATGCCGGGCCTGG + Intronic
1081863439 11:46347246-46347268 CCATCCAGGCGGGCCGGGCCGGG + Intronic
1081907157 11:46677427-46677449 TCCGCAAGCCAGGCTGGGCCTGG - Exonic
1082025102 11:47565789-47565811 CGCGCCAGGTGAGCCGGGCCGGG + Exonic
1083289223 11:61680518-61680540 CCGGCGCGGCGGGCCGGTCCTGG + Intronic
1083445628 11:62706380-62706402 CCAGCACGGCGGGGCGGGGCGGG + Intronic
1084005786 11:66322862-66322884 GCGGCAGGGCGGGCCGGGCTGGG + Intergenic
1084265713 11:68004134-68004156 CCCGCAGGGCGGGACAGGGCGGG - Intronic
1084272289 11:68035727-68035749 CAGGCAAGGCAGGCCGGGCACGG + Intronic
1084491955 11:69483815-69483837 CCCGCCAGCCGGGCCGGCCCGGG - Intergenic
1084621020 11:70270506-70270528 CCCGCGACCCGGGCGGGGCCTGG + Intergenic
1089208867 11:116787728-116787750 CCAGCCAGGTGGGCCCGGCCGGG - Intronic
1090068622 11:123525279-123525301 CCCGCAAGGCGGGGCAAGCAGGG - Intergenic
1090385544 11:126355871-126355893 CCCGCGGGGCGGGGCGGGGCGGG + Intronic
1090930073 11:131289651-131289673 ACTGCAAGGTGGGCCGGGCGCGG - Intergenic
1095938002 12:47705841-47705863 CCGGTGAGGCGGGGCGGGCCGGG - Intronic
1097288723 12:57896698-57896720 CCCGGGCGGCGGGCTGGGCCCGG - Intergenic
1098105999 12:67069400-67069422 CCGGGAGGCCGGGCCGGGCCGGG + Intergenic
1098888500 12:75984048-75984070 CCTGCTAGGCAGGCCGGGCATGG + Intergenic
1101661412 12:106768896-106768918 CCAGCAAGGCGGACCTGGCATGG - Intronic
1102151084 12:110689337-110689359 CCCGCAGGGTGGGCCTGTCCTGG + Intronic
1103719593 12:122966210-122966232 CCCCCAACGCGTGCCTGGCCTGG + Intronic
1104854213 12:131894607-131894629 GCCGCACTGCGCGCCGGGCCGGG - Intergenic
1104900773 12:132188574-132188596 CCAGCAGGGCTGGCCAGGCCGGG - Intergenic
1104980752 12:132572209-132572231 CCGGCCAGGTGGGCGGGGCCCGG + Intronic
1104983641 12:132584978-132585000 GCCGCAAGGGGGGCAGGGCATGG - Exonic
1105476155 13:20729816-20729838 CCTGCAAGGAGGGCAGGGCAGGG - Intronic
1106212762 13:27665962-27665984 CCCGCAGGGCTGGCTGGCCCTGG - Intronic
1108518244 13:51222470-51222492 CCCGCAAGCCGAGCGCGGCCGGG + Exonic
1109831662 13:67799065-67799087 ACCTCAATGCGGGCCGGGCGCGG + Intergenic
1110318643 13:74135705-74135727 CACGCGGGGCGGGCCGGGCCGGG - Intergenic
1112438536 13:99408612-99408634 TCCGCACGGCTGGCCGCGCCAGG - Intergenic
1113805837 13:113109731-113109753 CCCGCGAGGGGAGACGGGCCTGG - Intronic
1115855053 14:37622233-37622255 CGCGCGGGGCGGGCCGGGCCGGG - Intronic
1117803153 14:59465131-59465153 CCCGCCAGGTGGGCCGGCCGCGG + Exonic
1118830073 14:69422563-69422585 CCGGCAAGGAGAGCCAGGCCCGG - Intronic
1118905258 14:70018882-70018904 CCCGCACAGCTGGCGGGGCCTGG + Intronic
1119230060 14:72972588-72972610 TACGCAAGGCTGGCCAGGCCTGG - Intronic
1121709542 14:96027366-96027388 CCTGCAAGGCAGCCCAGGCCAGG - Intergenic
1122599724 14:102915271-102915293 CCCGCAAGGCTGGCTGGACCAGG - Intergenic
1122719064 14:103712153-103712175 CCCGTGAGGCGGGCAGGGCAGGG + Intronic
1122959378 14:105087539-105087561 CCCGCCGGGCGGGAAGGGCCAGG - Intergenic
1125536034 15:40441546-40441568 CCTGCAAGGCGGGCGGCCCCCGG - Intronic
1125589145 15:40843932-40843954 GCCGCGGGGCGGGCCGGGCCTGG + Intergenic
1125754892 15:42056956-42056978 CCCCCAAGGCCGGCCCTGCCAGG - Intergenic
1126109325 15:45166671-45166693 CCCGCGGGGTGGGGCGGGCCTGG + Intergenic
1127433287 15:58933199-58933221 CCCGCGCCCCGGGCCGGGCCGGG - Intronic
1129299155 15:74615625-74615647 GGCGGGAGGCGGGCCGGGCCAGG + Exonic
1129468716 15:75738522-75738544 TCCGCAACCCGGGCCGGGCTGGG + Intergenic
1129483161 15:75843600-75843622 CGCGGAAGGGGAGCCGGGCCCGG - Exonic
1130347974 15:83066724-83066746 GCGGCAGCGCGGGCCGGGCCGGG - Intronic
1130657610 15:85802888-85802910 CCAACAAGGCGGGAAGGGCCAGG + Intergenic
1132079283 15:98851236-98851258 CATGCCAGGCGGGCAGGGCCGGG + Intronic
1132498779 16:275741-275763 CGCGCGGGGCGGGGCGGGCCTGG - Intronic
1132592319 16:731402-731424 CCCGCCAGGAGGGCCCTGCCTGG + Intronic
1132639334 16:970632-970654 CGGGCAAGGCGGGGCGGGCAGGG - Intronic
1132810113 16:1793309-1793331 CCCACAACGCGGGCCGTGCGGGG + Intronic
1132947214 16:2538204-2538226 CCGGCGAGGCGGGGCGGCCCGGG + Intronic
1133018693 16:2956416-2956438 ACCCCAAGGCTGGCAGGGCCCGG - Intergenic
1133035514 16:3031717-3031739 CCCTCAAAGCGGGATGGGCCTGG + Intronic
1135135809 16:19884881-19884903 GCAGCAGCGCGGGCCGGGCCAGG - Exonic
1136003559 16:27313829-27313851 CCCGCCCGGCGCGCCCGGCCCGG - Intronic
1136370653 16:29834022-29834044 CCCGCAAGGAGTGCTGGGACCGG + Exonic
1137277710 16:46947491-46947513 ACCACAAGGAGGGCCGGGCGCGG - Intergenic
1137426382 16:48384856-48384878 CCCGGGAGGCGGGCCCGGCCGGG - Intronic
1138551431 16:57750981-57751003 CCAGCACTGAGGGCCGGGCCGGG - Intronic
1139402905 16:66696533-66696555 CGCGCGAGGCGGCCCGGGCCGGG - Exonic
1139448616 16:67013876-67013898 CCTGCCAGCCGGGCCGGGCCGGG + Intergenic
1139606633 16:68023383-68023405 TCCCCAAGGCTGGCCGGGTCTGG - Exonic
1139761359 16:69187113-69187135 CCCGCCCGGAGGGGCGGGCCCGG - Exonic
1139924383 16:70478183-70478205 CCAGCAAGGGGTGCAGGGCCGGG + Intronic
1139963463 16:70731122-70731144 CCCGCACTGGGGGCTGGGCCTGG + Intronic
1141054779 16:80804623-80804645 CCCGCCCCGGGGGCCGGGCCGGG - Intergenic
1141601101 16:85126888-85126910 CCAGCAAGACGGACAGGGCCAGG - Intergenic
1141700374 16:85639498-85639520 CCCGCAAGGCAGGCTAGGCCTGG - Intronic
1141989883 16:87603535-87603557 GCCGCGGGCCGGGCCGGGCCGGG + Intronic
1142177227 16:88650838-88650860 GGCGCCAGGCGGGCCAGGCCGGG - Intronic
1142210315 16:88805476-88805498 CCGGCAGGCCGGGCTGGGCCAGG - Exonic
1142295394 16:89218122-89218144 CCCGCCCCGAGGGCCGGGCCTGG - Intronic
1142369323 16:89669674-89669696 CTCACAAGGTGGGGCGGGCCTGG - Exonic
1142418357 16:89955307-89955329 CCCCCAAGGCAGGAAGGGCCAGG + Intronic
1142553010 17:752418-752440 CCCGGAAGAGGGGCCGGGCAGGG - Intronic
1143030365 17:3964146-3964168 CGCGCGGGCCGGGCCGGGCCGGG - Intronic
1143676417 17:8436150-8436172 CCGCCGGGGCGGGCCGGGCCGGG + Intronic
1144758629 17:17694798-17694820 CCCGCGAAGCATGCCGGGCCGGG - Intronic
1144784386 17:17823711-17823733 CCCGAAGGGCGGGGCGGGGCGGG - Intronic
1145760898 17:27425155-27425177 CCTGGAAGTGGGGCCGGGCCAGG - Intergenic
1145875949 17:28318460-28318482 CCCGCAACCCCGGCTGGGCCGGG + Intergenic
1147967122 17:44199496-44199518 CCCGCCCGGGGGGCCGCGCCGGG + Intronic
1148104214 17:45110767-45110789 CGAGCCAGGCGGGCCGGGCCAGG - Exonic
1148323682 17:46771640-46771662 CCGGCCCGGCGGCCCGGGCCCGG - Intronic
1149658893 17:58324404-58324426 CCCGCCTGGCTGGCCAGGCCTGG - Intronic
1150423223 17:65056743-65056765 CTCGCAGGGCGGGCCGGGCAGGG + Exonic
1150580656 17:66470576-66470598 CCCTAAAGCCAGGCCGGGCCAGG - Intronic
1151314307 17:73312212-73312234 CCCGGAAGCCGGGCGGGCCCAGG - Intergenic
1151565192 17:74893661-74893683 CAGGCGAGGCGGGGCGGGCCGGG + Intronic
1151978333 17:77494873-77494895 CCCGCAGGGTGGGCCCGGCAGGG - Intronic
1152057400 17:78040893-78040915 GCCGCAAGCCGGGCAGGGCTGGG - Intronic
1152711058 17:81870824-81870846 CCCGCAATCCGTGCCGGGCGTGG + Intronic
1152870673 17:82751668-82751690 CGCGCAACGGGGGCGGGGCCCGG - Intergenic
1153713179 18:7820271-7820293 GCTGCAAGGAGGGCCTGGCCGGG + Intronic
1155055339 18:22177190-22177212 CGCCCAAGGCAGGCCGAGCCAGG - Intronic
1156138190 18:34070307-34070329 AAGGCAAGGCGGGCCGGGCGCGG - Intronic
1156338115 18:36187504-36187526 CCATCCAGGCCGGCCGGGCCCGG - Exonic
1157612817 18:48968989-48969011 ACTCCAAGGGGGGCCGGGCCGGG - Intergenic
1160500791 18:79400376-79400398 CCGTCATGGCGGGTCGGGCCGGG - Intronic
1160847823 19:1174102-1174124 CCCACAAGCGGGGTCGGGCCAGG + Intronic
1160897602 19:1409946-1409968 CCCGCTTGGAGGGCTGGGCCTGG + Intronic
1160899175 19:1418552-1418574 CCGGCGGGGCGGGGCGGGCCGGG + Intronic
1160943375 19:1630247-1630269 CCCGGCAGGGGGGCGGGGCCAGG + Intronic
1161084569 19:2328856-2328878 CCCCCAAGACGGGCCGAGCGGGG - Intronic
1161267124 19:3369555-3369577 CCCACTCGGCGGGCCGGGCCCGG - Intronic
1161461431 19:4400132-4400154 CCCGCATGGCGGGCAGGGCCTGG + Intronic
1161672932 19:5624091-5624113 CCCGGGAGGCGGGCAGAGCCTGG + Intronic
1162398310 19:10430676-10430698 CCCCCAGGGCGGGGCGGGTCTGG - Intronic
1162798150 19:13097117-13097139 CGCGCAGGGCGGGGCAGGCCCGG - Intronic
1163282449 19:16325754-16325776 CGCGTAATGCAGGCCGGGCCCGG - Exonic
1163316146 19:16542112-16542134 CCGGCAAGGCGGACGGGGGCTGG - Intronic
1163662187 19:18585113-18585135 CCCTCAAGGTAGGCCGGGCACGG - Intronic
1164179758 19:22807829-22807851 CCCGCTAGGAGGGCCCGTCCTGG - Intergenic
1164643689 19:29843719-29843741 CCCTCAGGGCCGGCCTGGCCTGG - Intergenic
1165046409 19:33108328-33108350 CCTGAAAGGCGGGCAGGGGCGGG - Intronic
1165242967 19:34482016-34482038 CCCGCAGGGCCAGCCCGGCCAGG - Exonic
1166873898 19:45885911-45885933 CGGGGAAGGGGGGCCGGGCCTGG - Exonic
1166890848 19:45991987-45992009 CCCTCAAGGCTGGCTTGGCCAGG + Intergenic
1167377506 19:49119730-49119752 GCTGCCAGGAGGGCCGGGCCGGG - Intronic
1167551393 19:50163225-50163247 CCTGGGAGGCGGGGCGGGCCGGG - Intergenic
1167649031 19:50719588-50719610 CCCCCCCCGCGGGCCGGGCCTGG + Intergenic
1167741722 19:51327910-51327932 CCGGGAAGGTGGGCGGGGCCGGG + Intronic
1167903364 19:52638400-52638422 CCCGCGAGGTGGGCGGGGCCTGG + Intronic
1167943056 19:52962922-52962944 CCCGAGAGGTGGGCGGGGCCTGG + Intergenic
1168689500 19:58368318-58368340 GCCGGAAGGCGCGCCGCGCCAGG + Exonic
925147584 2:1591485-1591507 CCCACAAGGCAGGCCCCGCCTGG - Intergenic
925912759 2:8583945-8583967 CCTGCGAGGCGGGCCGGGAGGGG - Intergenic
926149164 2:10415200-10415222 GCCGCATGGAGGGCCGGCCCTGG + Intronic
927519696 2:23691282-23691304 CACCCAAGGCAGGCAGGGCCGGG + Intronic
927714037 2:25341410-25341432 CCCGGAAGGCGGGGGCGGCCCGG + Intronic
927990195 2:27442281-27442303 CCCGCCAGGGGGAGCGGGCCCGG + Intergenic
929556131 2:42926752-42926774 CCCTCCAGGCTGGCTGGGCCTGG + Intergenic
931877156 2:66526383-66526405 CACCCATGGCAGGCCGGGCCTGG + Intronic
933304260 2:80577630-80577652 CCAGCAAGTCTGGCCTGGCCTGG - Intronic
934933201 2:98445082-98445104 CCAGGTAGGTGGGCCGGGCCGGG + Exonic
936063511 2:109313476-109313498 CCAGCAAGGAGGGCAGGGCCTGG - Intronic
938343363 2:130549656-130549678 CCCGCCAGGAGGGCCCAGCCAGG - Intronic
938346470 2:130571066-130571088 CCCGCCAGGAGGGCCCAGCCAGG + Intronic
940640841 2:156342694-156342716 CCCGCAGGGCGGGCCGGGGCGGG - Intergenic
941384923 2:164841346-164841368 CCCGGGAGGCGGGCCGGCCGGGG - Exonic
941905181 2:170713058-170713080 CCAGGGAGGCGGGCAGGGCCGGG - Exonic
942453435 2:176122514-176122536 GCCGCTGGGCGGGCCAGGCCAGG + Intergenic
942799733 2:179861422-179861444 CCCGCTGGGCGCGCCCGGCCCGG + Exonic
946248395 2:218399731-218399753 ACTGGGAGGCGGGCCGGGCCGGG - Intronic
946391371 2:219418632-219418654 CGCGCACGTCGGGCGGGGCCGGG + Exonic
948115772 2:235493827-235493849 CGCCCCCGGCGGGCCGGGCCAGG - Intergenic
948174948 2:235935970-235935992 CCAGCGGGGAGGGCCGGGCCAGG - Intronic
948207170 2:236168426-236168448 CACGTGAGGCGAGCCGGGCCAGG - Intergenic
1168891195 20:1296276-1296298 CCCGCAGAAAGGGCCGGGCCAGG - Intronic
1171453030 20:25248829-25248851 CCCACAAGGCTGCCCAGGCCTGG - Intronic
1174373963 20:50113071-50113093 CCCCCTCGGCCGGCCGGGCCCGG + Intronic
1174423467 20:50415840-50415862 GCCGCAAGGCGGGGCGGCCAGGG + Intergenic
1175250791 20:57609191-57609213 CACGCAAGGTGGGGAGGGCCAGG - Intronic
1175399579 20:58692845-58692867 GCCGAGCGGCGGGCCGGGCCGGG + Exonic
1178534976 21:33403609-33403631 CCCGCCAGGTGAGCCGGGCCTGG + Exonic
1178922479 21:36747770-36747792 CCCGCCAGGCCGCCCGGGACGGG + Exonic
1179010585 21:37553042-37553064 CCCTCGAGGCGGCCTGGGCCTGG + Intergenic
1181477817 22:23179784-23179806 CCCGCAAGGCAGGGAGGGCCAGG - Intronic
1182472568 22:30557454-30557476 CCCCCAAGGCTGCCCAGGCCTGG + Intronic
1182529438 22:30944046-30944068 CCAGCAAAATGGGCCGGGCCTGG - Intronic
1183149829 22:36028709-36028731 GCGGCGCGGCGGGCCGGGCCGGG - Intergenic
1183149939 22:36029027-36029049 CCCGCGGGGGGGGCGGGGCCAGG + Intergenic
1184171749 22:42764256-42764278 CCAGTGAGGCTGGCCGGGCCCGG - Intergenic
1184649527 22:45913218-45913240 CCCCCAAGGCGGGCAGGGGGAGG + Intergenic
1184663422 22:45976001-45976023 CCCGCCCGCCGGGCCGCGCCAGG + Intronic
1185046667 22:48531853-48531875 CCCGGAAGGACGGACGGGCCTGG + Intronic
951611325 3:24495099-24495121 CCCGGGAAGCGGGCCGGGGCGGG - Intronic
952817378 3:37457447-37457469 TCAGCAAGACGGGCAGGGCCAGG - Intronic
953773063 3:45793569-45793591 TCCTCATGCCGGGCCGGGCCTGG + Intronic
953925835 3:46982040-46982062 CCCCCAAGCCAGGCGGGGCCAGG + Intronic
955977079 3:64489648-64489670 CCCGCATGTCGGGCCAGGACAGG + Intergenic
961018602 3:123485747-123485769 CCTGCAAGGCTGGCTGGGCAGGG + Intergenic
961448602 3:126992415-126992437 CCCGCGAGTGGGGCTGGGCCGGG + Intronic
961538797 3:127586753-127586775 GCCCCAAGACGGGCAGGGCCAGG + Intronic
961650926 3:128416314-128416336 CCTGCAGGGTGGGCCAGGCCGGG - Intergenic
961665858 3:128492829-128492851 GGTGCCAGGCGGGCCGGGCCGGG + Intronic
961680855 3:128599018-128599040 GCCCCAAGGCAGGCCGAGCCTGG + Intergenic
966015074 3:175131791-175131813 CCCGGACGGGGGGCCTGGCCGGG + Intronic
966372134 3:179261331-179261353 CCCCCCCCGCGGGCCGGGCCAGG + Intronic
966874658 3:184315134-184315156 CCCGGAGGGCGGGCGGGGCCGGG - Intronic
966936261 3:184711719-184711741 CCTGCGAGGCGGTCGGGGCCCGG + Exonic
967867747 3:194204194-194204216 CCCGAGACGCGGCCCGGGCCCGG + Intergenic
968502676 4:958382-958404 CCCGCAGGGTGGCCAGGGCCAGG - Exonic
968659470 4:1793195-1793217 CCCGCGAGCCGGGCGGGGACCGG + Intergenic
969239119 4:5888011-5888033 CCCGCATGGCGGGGCGGGGCTGG - Intronic
969431934 4:7160486-7160508 GCCCCAAGGCGGGCCTGGCCGGG - Intergenic
969463368 4:7340562-7340584 CCCGCAGTGAGGGACGGGCCTGG - Intronic
971244042 4:24912780-24912802 CCGGCCAGGCGGGATGGGCCGGG - Intronic
985652092 5:1112018-1112040 GGCGCAGCGCGGGCCGGGCCGGG - Exonic
985727318 5:1523280-1523302 CTGCCAAGGCGGGCGGGGCCCGG + Intronic
985860921 5:2470170-2470192 CATGCCAGGCGGGCAGGGCCAGG - Intergenic
988528484 5:32007206-32007228 CCAGCATGGCAGGCCGGGCGCGG - Intronic
988577769 5:32444032-32444054 GCCGCGGGCCGGGCCGGGCCGGG + Intronic
988577782 5:32444051-32444073 CGGGCAAGGCGGGGCGGGGCGGG + Intronic
992381693 5:76243789-76243811 CACCCAAGGAGGGCCCGGCCAGG - Intronic
999311081 5:150552652-150552674 AACCCAAGGCGGGCAGGGCCAGG - Intronic
1002073152 5:176692592-176692614 CCAGCAAGTTGGGCAGGGCCAGG + Intergenic
1002196893 5:177506026-177506048 CCCGGGAGGCGGGCTGGGCGCGG - Intronic
1002662779 5:180802850-180802872 CCCGGCAGGCGGGGCGGGGCGGG + Intronic
1004503173 6:16227024-16227046 CCCGCAGGGCGGGGCGGGGCGGG - Intergenic
1004720455 6:18264252-18264274 CCGGCAGCTCGGGCCGGGCCGGG - Intronic
1006642662 6:35496953-35496975 GCCGCAAGGGGGGCCGGGGAAGG + Exonic
1012401408 6:98845236-98845258 CCCGCGGGGCGGGGCGGGACGGG - Intergenic
1014098293 6:117482951-117482973 GCTGCGGGGCGGGCCGGGCCGGG + Intronic
1016732197 6:147439002-147439024 GCCGCAAGGTGGGCCGGTGCAGG - Intergenic
1017750544 6:157487167-157487189 CCGGCAAGGTGGCCAGGGCCGGG - Intronic
1019538051 7:1538987-1539009 CCCTCAGGACGGGCTGGGCCCGG + Intronic
1019559295 7:1647995-1648017 CCCCCAAGGCGGGCAGGCCCTGG - Intergenic
1022008887 7:26292033-26292055 CCCGCAAGCCCGGCTCGGCCCGG + Exonic
1022106200 7:27199641-27199663 CCCGCCGGGCCCGCCGGGCCGGG + Exonic
1026994460 7:74606538-74606560 GGCGCCAGGTGGGCCGGGCCCGG - Intergenic
1027202245 7:76071638-76071660 CCGGCAAGGAGAGCTGGGCCTGG + Intergenic
1027202852 7:76073957-76073979 CCCGGATGGAGAGCCGGGCCTGG + Intergenic
1027236797 7:76303113-76303135 CTAGCAGGGCGGGCAGGGCCGGG + Intronic
1029525758 7:101092640-101092662 CCCGGAAGGCGCGGCTGGCCGGG - Intergenic
1029821282 7:103149653-103149675 GTCGCGAGGCGGGCCGGGGCAGG - Intergenic
1030070651 7:105694769-105694791 GAAGCAAGGAGGGCCGGGCCAGG - Intronic
1031052001 7:116953931-116953953 CCCGCAAGGCGGGCCGGGCCGGG + Exonic
1032274263 7:130440818-130440840 CCCGGAAGGCGGGAAGGGGCCGG - Intronic
1034439324 7:151078627-151078649 CCCGCAACCGGTGCCGGGCCAGG + Exonic
1035167343 7:156999791-156999813 CCCGCGGGCCGGGGCGGGCCGGG - Intronic
1035168017 7:157003013-157003035 CCCGCAAGGCGGGCAGAGCCGGG + Intronic
1035203477 7:157280518-157280540 CCCTCAAGGCTGCCCAGGCCAGG + Intergenic
1036733300 8:11284770-11284792 CCCGTGGGGCGGGGCGGGCCGGG - Exonic
1037807406 8:22066411-22066433 GCCGCAGGCCGGGCCGGGGCGGG + Intronic
1037819952 8:22130732-22130754 GCCGCGGGGAGGGCCGGGCCGGG + Exonic
1038828708 8:31033708-31033730 CGAGAAAGGCGAGCCGGGCCGGG + Exonic
1039531822 8:38269242-38269264 TCCGCGGGGAGGGCCGGGCCGGG + Intronic
1040471618 8:47738824-47738846 CCCCCAGGGCCGGCCGGACCCGG - Exonic
1049223176 8:141437043-141437065 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223191 8:141437080-141437102 TCCCCATGGCGGGCAGGGCCAGG - Intergenic
1049223206 8:141437117-141437139 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223221 8:141437154-141437176 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223236 8:141437191-141437213 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223251 8:141437228-141437250 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223266 8:141437265-141437287 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223280 8:141437302-141437324 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049237154 8:141518167-141518189 CCGGCAGGGCGGGGAGGGCCGGG - Intronic
1049465835 8:142750935-142750957 CACGGAAGGCGGGCAGGGCTGGG - Intronic
1049465857 8:142751019-142751041 CACAGAAGGCGGGCAGGGCCGGG - Intronic
1049758070 8:144319594-144319616 GTCGCAAGGGGGGCTGGGCCTGG + Intronic
1049772839 8:144391704-144391726 CCAGCAAGGTGGGCTGGGCCAGG + Exonic
1049791650 8:144475142-144475164 TCCGCAAGGTGGGGCAGGCCAGG - Exonic
1049938008 9:518026-518048 CCCTCAAGGTTGGCCGGGCAAGG - Intronic
1050437918 9:5629159-5629181 CCCGCTGGCCTGGCCGGGCCGGG - Exonic
1057077767 9:92147845-92147867 CCCGAGAGGCGGGCAGGGCTGGG + Intergenic
1057478638 9:95426794-95426816 CGCGCAGGCAGGGCCGGGCCGGG - Intergenic
1057495788 9:95559971-95559993 CTGGCAAGGCGGGCGGGACCTGG + Intergenic
1060106780 9:120877438-120877460 CCCGCGGGGCGGGCGGGGGCGGG - Intronic
1060139838 9:121201066-121201088 CCCTGCAGCCGGGCCGGGCCGGG - Intronic
1060974197 9:127755037-127755059 CCCGCCACGCGCGCCGGGCTGGG - Intronic
1061061066 9:128250773-128250795 CCCGCGACCCGGGCCGGGCTGGG - Exonic
1061438242 9:130579946-130579968 CCCGCCCGACAGGCCGGGCCTGG - Intronic
1062230725 9:135480101-135480123 CCTGCACGGCGCGCCGGCCCCGG - Intronic
1062624846 9:137438126-137438148 CCGGCAGGGGAGGCCGGGCCGGG - Intronic
1186979055 X:14939598-14939620 CCCCCAAGGTGGGCTGGGCATGG - Intergenic
1187281467 X:17860992-17861014 CCCGCCAGGCGCGCCCAGCCCGG + Intronic
1188452208 X:30319536-30319558 CCTGGAAGGCGGGCGGGGCGGGG - Intergenic
1189363187 X:40369008-40369030 CTGGCAAGGCGGCCAGGGCCAGG - Intergenic
1195625108 X:106999568-106999590 CGCGCGGGGCGGGCCGGGGCTGG - Intronic
1197262323 X:124332630-124332652 GCCGCAAGGCTGGCTGGGACCGG - Intronic
1200093119 X:153644901-153644923 CCCCCACGGCAGGGCGGGCCGGG + Intronic
1200259018 X:154602224-154602246 CCCGCAGGGAGGGCCGGCCAGGG + Intergenic