ID: 1031057284

View in Genome Browser
Species Human (GRCh38)
Location 7:117006325-117006347
Sequence CATGCTACACTGCTACTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031057284_1031057287 20 Left 1031057284 7:117006325-117006347 CCAGTCAGTAGCAGTGTAGCATG 0: 1
1: 0
2: 2
3: 7
4: 78
Right 1031057287 7:117006368-117006390 TGTACCCTTTCTTAGACTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 129
1031057284_1031057285 -5 Left 1031057284 7:117006325-117006347 CCAGTCAGTAGCAGTGTAGCATG 0: 1
1: 0
2: 2
3: 7
4: 78
Right 1031057285 7:117006343-117006365 GCATGACTACCTATTCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031057284 Original CRISPR CATGCTACACTGCTACTGAC TGG (reversed) Intronic
902609552 1:17589041-17589063 TAGGCTACACTGCCTCTGACAGG - Intronic
906022573 1:42643302-42643324 CATGCTGCTCTGTCACTGACTGG - Intronic
906157374 1:43621676-43621698 CATGTTTCTCTGCTCCTGACTGG - Intronic
911971204 1:104440226-104440248 AATCCTTCATTGCTACTGACAGG + Intergenic
920909649 1:210204311-210204333 CATGCCACTGTGCTACAGACTGG - Intergenic
921100146 1:211921783-211921805 CATGCGCCACTGCGCCTGACAGG - Intergenic
921316621 1:213897840-213897862 CATGATACAATGGTACTGAGAGG + Intergenic
1064529447 10:16292713-16292735 CATCCCACTCTGCTACTGAACGG + Intergenic
1069798792 10:71069726-71069748 CATGGGACACTGTGACTGACAGG - Intergenic
1074840291 10:117344691-117344713 CATGCTAGACTTCTATTGCCAGG + Intronic
1078884354 11:15485172-15485194 CATTCTACATGGCTCCTGACAGG - Intergenic
1079367485 11:19821895-19821917 GATGCCACACTGTTACTGAGGGG - Intronic
1080329388 11:31117958-31117980 CATCATACTCAGCTACTGACAGG - Intronic
1083834201 11:65254142-65254164 CATGCTACACTGCCACCACCTGG + Intergenic
1084999580 11:73018443-73018465 CATCATACACTGTTACTGTCTGG + Intronic
1087785413 11:102348204-102348226 CCTGCTGTACTGCTGCTGACAGG + Intronic
1088945120 11:114504161-114504183 CATACTGCACTGCTACTGGCAGG - Intergenic
1092069180 12:5618860-5618882 GATGATACTCTGCTGCTGACAGG - Intronic
1092670305 12:10854317-10854339 CTGGCTACAGTGCTACTGTCAGG - Intronic
1097217307 12:57424186-57424208 CCTGCTACAGTGCTACAGGCTGG + Intronic
1100010299 12:89944949-89944971 CCGGCTTCACTGCTACTTACTGG - Intergenic
1104075637 12:125387258-125387280 TAAGCTACAGTGCTATTGACAGG - Intronic
1115064080 14:29233894-29233916 CATGCTTAACTGCTAGAGACAGG + Intergenic
1116689975 14:48093363-48093385 CATGCTACACTGGTTATGACAGG - Intergenic
1118530428 14:66699105-66699127 CATGCTACACTGCTGATAACTGG - Intronic
1119680294 14:76587252-76587274 CAGGCCACACAGCTAGTGACAGG + Intergenic
1125688644 15:41578866-41578888 CATGCTTCCCTGCAGCTGACCGG + Exonic
1130525675 15:84704263-84704285 CATACAACATTGCTTCTGACAGG + Intronic
1132256698 15:100382713-100382735 CAAGCAACACTCCTACTCACGGG + Intergenic
1150651386 17:67012523-67012545 CTTTCTACACTGCTTCTGAAGGG - Intronic
1158451519 18:57570211-57570233 CATGATAAACTGTTAATGACTGG + Intronic
1159241921 18:65751826-65751848 CATGGTACACTGCTACTTGCCGG + Intronic
925725197 2:6865336-6865358 CAGGCTGCTCTGCTACTGCCCGG - Exonic
928192739 2:29188343-29188365 GATGCTCCACTGATAATGACTGG + Intronic
930390610 2:50757246-50757268 TATGCTATACTCTTACTGACTGG - Intronic
931008729 2:57882551-57882573 CATGATTCACTCCTAATGACTGG + Intergenic
940603553 2:155891309-155891331 GATGCTTCACTCCTACTGATAGG - Intergenic
942509061 2:176676396-176676418 CATGCAAAACTTCTAATGACTGG + Intergenic
946407984 2:219502268-219502290 CATGCAGCTCTGCCACTGACAGG - Intronic
948186840 2:236027784-236027806 CATGGTGAACTGCTACTCACAGG + Intronic
1169835534 20:9873734-9873756 CAGGCTACACTAATTCTGACTGG - Intergenic
1176637483 21:9261641-9261663 TATGCTTCAATGCTAGTGACCGG + Intergenic
1183183576 22:36278190-36278212 CATGAGACACTGCTAGTGGCCGG - Intergenic
1185092431 22:48783453-48783475 CATGCCCCACTGCTCCTGGCCGG + Intronic
949888534 3:8714892-8714914 CATGTTTCTCTGCTACTGCCTGG + Intronic
957319521 3:78611527-78611549 CATGCTACAGTCACACTGACAGG - Intronic
959350407 3:105254880-105254902 CATGCTACATTGCTTCATACTGG + Intergenic
963309968 3:143699469-143699491 CATGCTACACTGCTGCTGCCAGG - Intronic
964479498 3:157127659-157127681 GATGCTACCCTGCTGCTGGCGGG - Intergenic
967380121 3:188848462-188848484 CACGCTGCCCTGCTATTGACTGG - Intronic
968236518 3:197033929-197033951 CATGTTACACTCTTGCTGACTGG + Intergenic
1202749412 3_GL000221v1_random:143379-143401 TATGCTTCAATGCTAGTGACCGG - Intergenic
969378553 4:6779269-6779291 CAGGCCACACTGCTACTAAAAGG - Intergenic
970481799 4:16483627-16483649 GCTGCTACACTGCTAGTGGCTGG + Intergenic
972940015 4:44184262-44184284 CATGCTACATTGAAACTTACAGG + Intronic
974349721 4:60729463-60729485 CAAATTACTCTGCTACTGACAGG - Intergenic
976468750 4:85402221-85402243 CATGCCACACTGCTCCAGCCTGG - Intergenic
981681931 4:147409252-147409274 CCTGCTGCACTGCTACTGACTGG + Intergenic
985384867 4:189434668-189434690 CATGCCACACAGCTGCTGCCAGG + Intergenic
986885341 5:12226800-12226822 CATGCCACACAGCTACTCCCAGG + Intergenic
989172455 5:38486144-38486166 CATACGACACAGCTAATGACTGG - Intronic
992371768 5:76151279-76151301 CATGCTACACTTCGACAAACTGG - Intronic
992579329 5:78155286-78155308 CATGCCACACTGCTGCTGCCAGG + Intronic
993287457 5:86017181-86017203 CATGCTGCACAGCTGCTGCCAGG + Intergenic
998332395 5:141340592-141340614 AATGATACATTGCTACTGAGTGG - Exonic
1017097879 6:150820921-150820943 GAAGCTGCTCTGCTACTGACAGG + Intronic
1021763823 7:23927329-23927351 CATGCAACACTTCTCCTCACAGG + Intergenic
1021950209 7:25766910-25766932 TATGCTAAGCTGCAACTGACTGG - Intergenic
1029552054 7:101241982-101242004 CATGCTACTGTGCTCCAGACTGG - Intronic
1030629326 7:111878615-111878637 CATGCTGCATAGCTACTGCCGGG - Intronic
1031057284 7:117006325-117006347 CATGCTACACTGCTACTGACTGG - Intronic
1033929911 7:146508438-146508460 CAGGCTTCACTCCCACTGACTGG + Intronic
1037400167 8:18487698-18487720 CATCCTACATTCCTACTTACAGG - Intergenic
1037551226 8:19973669-19973691 CATGCAACACTTGTGCTGACAGG - Intergenic
1038245865 8:25855351-25855373 CTTGGCACACTGCTACTGCCAGG + Intronic
1042904297 8:73757457-73757479 CAGGCTGCACTGCCACTGGCAGG - Intronic
1043214876 8:77573608-77573630 CATGCTACATGGCTGCTGCCAGG - Intergenic
1044058137 8:87598187-87598209 CATGCTACACAACTGCTTACAGG + Intronic
1047352549 8:124089359-124089381 CATGCTACAGGGCCACTGCCAGG + Intronic
1048459393 8:134608517-134608539 CATGCTACTCTGCAACACACTGG + Intronic
1050528757 9:6569113-6569135 GATGATACACTGATACTGAAAGG - Intronic
1056648189 9:88433121-88433143 CATGCTACTGTGCTCCAGACTGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062582657 9:137235348-137235370 CATGCTGCACCGCCGCTGACAGG + Intronic
1187612755 X:20960584-20960606 CATGCCACACAGCTACTGCCAGG - Intergenic
1189628042 X:42920689-42920711 CATGCCACACAGCTACTGCCAGG - Intergenic
1195222549 X:102760335-102760357 CTTGCTTCTCTGCTGCTGACAGG + Intergenic
1198965599 X:142226494-142226516 CAGGCTACACTGATTCTGATTGG + Intergenic